The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 2
NZ_CP024420	Brucella suis strain QH05 chromosome 1, complete sequence	2107832	854202	866129	2107832	tRNA	uncultured_Mediterranean_phage(90.0%)	13	NA	NA
WP_002968731.1|854202_855054_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.5	4.4e-31
WP_006190130.1|855046_855772_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	45.7	1.5e-43
WP_002964012.1|855917_856136_+	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	65.1	1.5e-07
WP_004686803.1|856246_856828_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_002964014.1|856824_857649_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	41.1	9.8e-44
WP_004690784.1|857725_859009_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.0	3.5e-104
WP_004683703.1|859157_859925_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	40.2	1.0e-39
WP_004683704.1|859921_860590_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	38.5	6.6e-14
WP_002964018.1|860734_860920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004690785.1|860968_862267_+	peptidoglycan DD-metalloendopeptidase family protein	NA	Q8SBN9	Clostridium_phage	41.1	1.0e-18
WP_002964020.1|862315_863182_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_002964021.1|863341_863683_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	9.1e-12
WP_006642797.1|863801_866129_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	43.5	6.2e-51
>prophage 3
NZ_CP024420	Brucella suis strain QH05 chromosome 1, complete sequence	2107832	937841	947876	2107832	integrase,transposase	Brucella_phage(37.5%)	15	937724:937764	952839:952879
937724:937764	attL	AGCTTGGGAAGCTGACAGGCTACCATTACATCATACCCGCA	NA	NA	NA	NA
WP_002966804.1|937841_938867_-|integrase	site-specific integrase	integrase	A0A141GEZ3	Brucella_phage	38.2	4.3e-49
WP_004690812.1|938853_939057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002971459.1|939059_939275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964088.1|939271_939475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006072696.1|939524_940244_+	hypothetical protein	NA	A0A076GD06	Sinorhizobium_phage	46.8	4.6e-05
WP_002964091.1|940240_940471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002964092.1|940467_940743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683738.1|940765_941353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683739.1|941587_942298_+	porin family protein	NA	O11861	Bartonella_henselae_phage	36.8	5.1e-41
WP_002964095.1|942645_942816_-	DUF1508 domain-containing protein	NA	A0A2P1N580	Mycobacterium_phage	45.1	3.1e-05
WP_002964097.1|943163_943478_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	43.4	6.9e-06
WP_004688321.1|943477_943723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110248372.1|944563_945320_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.2	1.4e-15
WP_006132649.1|945321_946095_+	hypothetical protein	NA	A0A141GEY5	Brucella_phage	97.3	2.9e-122
WP_004689673.1|946229_947876_+	hypothetical protein	NA	A0A141GEY6	Brucella_phage	62.0	1.3e-175
952839:952879	attR	AGCTTGGGAAGCTGACAGGCTACCATTACATCATACCCGCA	NA	NA	NA	NA
