The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024489	Klebsiella pneumoniae strain INF249 chromosome, complete genome	5583461	780379	787503	5583461		uncultured_Caudovirales_phage(100.0%)	9	NA	NA
WP_013095191.1|780379_781102_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	73.0	1.8e-97
WP_047028317.1|781400_781898_-	phosphatase	NA	NA	NA	NA	NA
WP_007372635.1|782037_782547_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	37.8	6.5e-22
WP_007372636.1|782619_783048_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.8e-49
WP_013095195.1|783105_784395_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	72.5	3.3e-171
WP_013095196.1|784435_786202_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_044158970.1|786225_786591_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_013095198.1|786613_787093_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	51.3	1.8e-34
WP_013095199.1|787149_787503_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	47.2	5.9e-22
>prophage 2
NZ_CP024489	Klebsiella pneumoniae strain INF249 chromosome, complete genome	5583461	1737000	1743905	5583461	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_032429748.1|1737000_1737864_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_047669696.1|1737874_1738648_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	5.1e-26
WP_002912636.1|1738888_1739782_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1740027_1741389_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1741707_1742430_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|1742426_1743905_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 3
NZ_CP024489	Klebsiella pneumoniae strain INF249 chromosome, complete genome	5583461	2704749	2711179	5583461		Escherichia_phage(100.0%)	6	NA	NA
WP_021440085.1|2704749_2705838_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	5.2e-210
WP_004176262.1|2705924_2706185_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_021440083.1|2706476_2707343_+	class A beta-lactamase SHV-187	NA	A0A077SL40	Escherichia_phage	99.6	1.7e-155
WP_002210513.1|2707363_2708125_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004224682.1|2709300_2710566_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
WP_002210516.1|2710558_2711179_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 4
NZ_CP024489	Klebsiella pneumoniae strain INF249 chromosome, complete genome	5583461	2905561	2975334	5583461	protease,tail,portal,plate,holin,integrase,head,capsid,terminase	Klebsiella_phage(42.0%)	75	2902842:2902856	2974685:2974699
2902842:2902856	attL	CATGACGGCGCTGGG	NA	NA	NA	NA
WP_004176418.1|2905561_2906647_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_021440010.1|2906610_2908365_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004183804.1|2908443_2910036_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_021440009.1|2910032_2913482_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_021440008.1|2913471_2914653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023302025.1|2914601_2914859_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_064185090.1|2914901_2917301_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_023302028.1|2917288_2917819_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_021440005.1|2917843_2918620_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_023302029.1|2918623_2921002_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.0	2.4e-18
WP_047670330.1|2920994_2923637_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.5	4.0e-99
WP_002902160.1|2923901_2924393_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_021440002.1|2924397_2926104_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004176431.1|2926100_2926790_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004197477.1|2926786_2928127_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_021440001.1|2928139_2929684_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004176434.1|2929726_2930218_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002902136.1|2931063_2931312_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
WP_074194671.1|2932362_2932785_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	43.8	1.2e-24
WP_064185091.1|2932862_2933411_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	95.6	5.4e-91
WP_099725673.1|2934297_2935590_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	37.2	1.4e-68
WP_085841178.1|2935590_2936340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064185172.1|2936471_2937071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064185171.1|2937312_2939259_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	85.2	7.2e-53
WP_099725604.1|2939333_2942411_-	kinase	NA	A0A286S259	Klebsiella_phage	62.3	0.0e+00
WP_023341479.1|2942407_2942788_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	81.7	8.5e-59
WP_004864228.1|2942800_2943277_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
WP_004177132.1|2943263_2943737_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.1	1.4e-55
WP_099725605.1|2943757_2947144_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.7	9.5e-303
WP_016530182.1|2947204_2947438_-	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
WP_099725606.1|2947511_2947817_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
WP_021313622.1|2947819_2948224_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	57.7	8.5e-33
WP_021313623.1|2948254_2948959_-	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.9	2.5e-80
WP_016530186.1|2949015_2949363_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_064185142.1|2949359_2949809_-	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	81.9	1.5e-62
WP_064185143.1|2949805_2950144_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	70.5	1.0e-39
WP_032415158.1|2950155_2950482_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	70.4	2.8e-42
WP_032442228.1|2950481_2950715_-	hypothetical protein	NA	A0A1P8DTJ1	Proteus_phage	68.1	1.5e-10
WP_064160189.1|2950757_2951975_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.1	1.9e-197
WP_023317649.1|2951984_2952833_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	89.6	3.0e-136
WP_004177155.1|2952846_2954154_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	85.7	4.9e-215
WP_023342855.1|2955849_2956314_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	61.4	1.7e-48
WP_023342856.1|2956496_2956838_-	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	73.9	2.3e-47
WP_004177166.1|2956893_2957139_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	63.0	4.7e-18
WP_004177168.1|2957536_2957737_-	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	75.0	3.4e-19
WP_004177172.1|2958047_2958320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004177174.1|2958452_2958737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032409976.1|2958827_2959022_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.1	6.9e-25
WP_004177178.1|2958972_2959248_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	96.7	8.4e-08
WP_004177180.1|2959244_2959592_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	83.5	1.9e-41
WP_004177182.1|2959588_2960128_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	2.0e-101
WP_031280382.1|2960124_2960424_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	99.0	2.9e-46
WP_004177186.1|2960709_2960955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064185145.1|2961150_2961966_-	molecular chaperone	NA	A0A286N2Q2	Klebsiella_phage	74.2	9.5e-108
WP_064185146.1|2961962_2962280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064185147.1|2962282_2964154_-	AAA family ATPase	NA	K7PK08	Enterobacteria_phage	61.4	1.0e-226
WP_064185148.1|2964257_2965175_-	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	46.9	1.1e-38
WP_032730699.1|2965171_2965360_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_072025957.1|2965435_2965663_-	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	60.0	9.0e-16
WP_032433006.1|2965787_2966495_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	50.2	4.0e-54
WP_064185149.1|2966653_2966962_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	60.6	1.6e-23
WP_064185150.1|2966951_2967146_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	50.0	7.7e-08
WP_085841219.1|2967317_2967542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023304721.1|2967542_2967908_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	97.5	5.8e-57
WP_064185151.1|2967900_2968155_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	94.0	5.0e-39
WP_004177208.1|2968126_2968345_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_004152156.1|2968341_2968767_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|2968763_2968958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|2968954_2969782_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_064185152.1|2969886_2970405_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	97.7	1.4e-93
WP_009309074.1|2970526_2970718_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	75.4	2.3e-20
WP_064185153.1|2970698_2971880_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.0	1.3e-201
WP_016197745.1|2972076_2972625_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004183778.1|2972823_2974356_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	8.8e-22
WP_019705447.1|2974572_2975334_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	4.1e-20
2974685:2974699	attR	CCCAGCGCCGTCATG	NA	NA	NA	NA
>prophage 5
NZ_CP024489	Klebsiella pneumoniae strain INF249 chromosome, complete genome	5583461	3015806	3064784	5583461	protease,tail,portal,holin,integrase,head,capsid,terminase	Klebsiella_phage(22.22%)	58	3007984:3007999	3062090:3062105
3007984:3007999	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_073901102.1|3015806_3017099_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	36.7	8.9e-68
WP_073900719.1|3017971_3021049_-	kinase	NA	A0A286S259	Klebsiella_phage	61.6	0.0e+00
WP_022615519.1|3021045_3021426_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	80.2	1.6e-57
WP_004864228.1|3021438_3021915_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
WP_004884312.1|3021901_3022375_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.7	1.1e-55
WP_073900721.1|3022396_3025783_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.7	1.9e-303
WP_016530182.1|3025843_3026077_-	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
WP_023317588.1|3026150_3026456_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
WP_064185099.1|3026458_3026863_-|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	55.4	5.5e-32
WP_032412035.1|3026893_3027598_-	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.5	9.5e-80
WP_065800435.1|3027654_3028002_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	64.6	4.3e-33
WP_099725607.1|3027998_3028448_-	hypothetical protein	NA	Q9MCS9	Enterobacteria_phage	81.9	1.5e-62
WP_072071528.1|3028444_3028783_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	67.0	1.2e-37
WP_032734570.1|3028795_3029128_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6JIM5	Burkholderia_virus	31.6	8.8e-12
WP_048323772.1|3029133_3029388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047666511.1|3029433_3030654_-|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	64.3	1.7e-140
WP_064185102.1|3030663_3031371_-|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	63.0	2.4e-67
WP_064182870.1|3031346_3032666_-|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	58.9	1.7e-138
WP_025713389.1|3032672_3034409_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.3	1.3e-138
WP_038808146.1|3034362_3034827_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.7	4.8e-48
WP_040241924.1|3035010_3035352_-	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	75.7	5.4e-49
WP_071889493.1|3035361_3035598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004184480.1|3036092_3036338_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	97.5	1.6e-34
WP_099725608.1|3037612_3037972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077267460.1|3038282_3038651_-	TonB family protein	NA	NA	NA	NA	NA
WP_073900727.1|3039002_3039191_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.1	5.9e-21
WP_032436040.1|3039141_3039417_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	66.3	2.4e-23
WP_064185104.1|3039413_3039761_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	79.1	4.4e-38
WP_004206700.1|3039757_3040297_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	99.4	5.1e-102
WP_024176410.1|3040293_3040593_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	83.8	4.5e-39
WP_012967891.1|3041715_3042342_-	YagU family protein	NA	NA	NA	NA	NA
WP_064185105.1|3042594_3043410_-	molecular chaperone	NA	A0A286N2Q2	Klebsiella_phage	73.0	8.0e-107
WP_038421389.1|3043406_3043703_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	71.9	1.3e-35
WP_064185106.1|3043911_3044508_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	79.6	5.5e-89
WP_023304767.1|3044543_3044777_-	hypothetical protein	NA	A0A0M4R5D9	Salmonella_phage	57.1	9.9e-18
WP_134726016.1|3045451_3045931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064185108.1|3046269_3046818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064185109.1|3046852_3048835_-	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	53.1	2.1e-201
WP_060876940.1|3048831_3049089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064185110.1|3049088_3049457_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	41.8	5.4e-10
WP_064185111.1|3049464_3050214_-	ATP-binding protein	NA	H6WRX8	Salmonella_phage	81.5	1.2e-117
WP_064185122.1|3050216_3051056_-	hypothetical protein	NA	Q8HA96	Salmonella_phage	52.2	2.6e-23
WP_023279102.1|3051121_3051916_-	ParB/RepB/Spo0J family partition protein	NA	C7BGF1	Burkholderia_phage	51.7	1.3e-64
WP_064185112.1|3052044_3052581_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	70.1	2.6e-61
WP_023279104.1|3052592_3052814_-	hypothetical protein	NA	A0A0M4QX15	Salmonella_phage	63.0	6.9e-21
WP_032413870.1|3052917_3053301_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	76.5	3.4e-47
WP_023279106.1|3053945_3054122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064185113.1|3054133_3055030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157770523.1|3055355_3055520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064185123.1|3055659_3055854_+	YebW family protein	NA	NA	NA	NA	NA
WP_074194676.1|3055862_3056018_+	DNA breaking-rejoining protein	NA	H6WRX3	Salmonella_phage	74.5	2.6e-14
WP_099725609.1|3056155_3059104_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	53.8	9.2e-278
WP_064185124.1|3059116_3060226_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	86.4	4.5e-185
WP_022631172.1|3060266_3060506_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	67.5	6.8e-22
WP_085841215.1|3060726_3061914_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.2	2.4e-120
WP_004151901.1|3062090_3062981_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
3062090:3062105	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_004140266.1|3062980_3063973_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|3063974_3064784_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 6
NZ_CP024489	Klebsiella pneumoniae strain INF249 chromosome, complete genome	5583461	3467901	3543034	5583461	protease,tail,portal,tRNA,holin,integrase,head,capsid,terminase	Cronobacter_phage(61.36%)	79	3511734:3511752	3543106:3543124
WP_004224003.1|3467901_3469623_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3469667_3470369_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3470722_3470941_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3471060_3473340_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3473370_3473688_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3474013_3474235_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_032429904.1|3474311_3476252_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.4	2.9e-38
WP_002896440.1|3476248_3477364_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004176693.1|3477510_3479169_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_032429902.1|3479587_3480283_+	aquaporin Z	NA	NA	NA	NA	NA
WP_038806830.1|3480398_3481298_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_004176696.1|3481441_3483094_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_004147771.1|3483104_3484073_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|3484284_3484719_-	DoxX family protein	NA	NA	NA	NA	NA
WP_004176700.1|3484870_3486589_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_032429901.1|3486627_3487629_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_004209682.1|3487639_3489082_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3489169_3490183_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004209681.1|3490179_3491010_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004176708.1|3491041_3492181_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|3493059_3493575_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|3493801_3494530_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3494550_3495282_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3495288_3496005_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004141917.1|3496004_3496673_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3496856_3497588_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3497674_3499147_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3499143_3499860_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_004147758.1|3499938_3501066_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.8e-19
WP_002896376.1|3501107_3501596_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3501653_3502499_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3502495_3503449_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|3503459_3504593_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|3504756_3505869_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3506217_3506697_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3506785_3507688_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_004179133.1|3507802_3508525_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_004179132.1|3508508_3508796_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3508998_3509262_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3509268_3509652_-	membrane protein	NA	NA	NA	NA	NA
WP_004147745.1|3509918_3511604_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3511734:3511752	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_099725619.1|3512068_3512254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142367404.1|3512296_3513094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099725620.1|3513605_3515285_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	59.0	2.7e-189
WP_064185068.1|3515288_3515840_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	67.2	4.8e-55
WP_064185067.1|3515811_3516537_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	47.1	3.6e-50
WP_064185066.1|3516536_3516776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064185065.1|3516798_3519411_-	hypothetical protein	NA	F1BUK3	Cronobacter_phage	59.8	1.1e-93
WP_064185064.1|3519420_3520059_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	70.4	2.5e-71
WP_064185063.1|3520051_3521236_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	76.2	5.5e-173
WP_064185062.1|3521232_3521562_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	70.6	2.1e-37
WP_064185061.1|3521558_3523442_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	61.1	1.5e-225
WP_157770524.1|3523441_3523597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064185060.1|3523629_3523893_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	56.1	3.5e-19
WP_064185059.1|3524039_3524372_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	1.1e-35
WP_064185058.1|3524371_3524713_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	94.1	9.0e-52
WP_042920132.1|3524709_3525000_-|holin	holin	holin	C7BGD7	Burkholderia_phage	50.6	8.8e-16
WP_064185056.1|3525009_3525468_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	74.0	1.1e-57
WP_064185055.1|3525464_3526583_-	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	71.7	5.2e-149
WP_064185054.1|3526569_3527286_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	72.6	6.4e-92
WP_064185053.1|3527285_3527789_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	67.1	6.3e-62
WP_042920119.1|3527785_3528238_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	78.0	1.8e-60
WP_099725621.1|3528334_3529036_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	63.8	1.1e-83
WP_064185051.1|3529039_3530062_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.8	1.5e-158
WP_064185050.1|3530124_3530919_-|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	53.0	4.8e-64
WP_099725622.1|3531091_3532864_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	82.4	7.5e-291
WP_099725623.1|3532860_3533910_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	78.0	6.4e-157
WP_038431884.1|3533906_3534230_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	90.4	4.4e-48
WP_099725625.1|3534535_3536557_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.2	5.3e-301
WP_099725626.1|3536553_3537405_-	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	92.7	2.5e-143
WP_099725627.1|3537395_3537629_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_099725628.1|3537695_3538097_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	53.4	1.7e-38
WP_038431890.1|3538096_3538525_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	48.4	2.2e-23
WP_038431891.1|3538718_3539222_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	70.7	5.6e-58
WP_099725629.1|3539254_3539476_-	regulator	NA	NA	NA	NA	NA
WP_038431893.1|3539601_3540168_+	phage repressor protein CI	NA	F1BUN8	Cronobacter_phage	42.2	1.0e-36
WP_038431894.1|3540170_3541304_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_038431895.1|3541309_3541906_+	DUF4276 family protein	NA	NA	NA	NA	NA
WP_038431896.1|3541978_3543034_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.6	5.2e-106
3543106:3543124	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 7
NZ_CP024489	Klebsiella pneumoniae strain INF249 chromosome, complete genome	5583461	4635784	4711851	5583461	holin,transposase,tRNA	Escherichia_phage(18.18%)	54	NA	NA
WP_019725322.1|4635784_4639171_+|holin	choline trimethylamine-lyase	holin	A0A1S6UAD4	Serratia_phage	45.0	9.7e-05
WP_004182804.1|4639256_4640204_+|holin	choline TMA-lyase-activating enzyme	holin	NA	NA	NA	NA
WP_004182802.1|4640216_4640615_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_021441127.1|4640611_4641232_+	phosphate propanoyltransferase	NA	NA	NA	NA	NA
WP_021441126.1|4641244_4641913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020316589.1|4641944_4642358_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_004204123.1|4642375_4642705_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_021441125.1|4642905_4643913_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_004178470.1|4644219_4645287_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_021441124.1|4645283_4648028_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	2.7e-21
WP_032428511.1|4648027_4649152_+	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_021441122.1|4649192_4649510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021441121.1|4655702_4656824_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_004178461.1|4656871_4657405_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002887278.1|4657415_4657682_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_021441120.1|4657784_4659218_-	Cu(+)/Ag(+) sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	27.6	2.0e-12
WP_002887273.1|4659207_4659891_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	36.0	7.9e-31
WP_038806759.1|4660063_4661449_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_021441118.1|4661466_4661811_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_021441117.1|4661855_4663118_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_026055975.1|4665869_4666793_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	8.4e-177
WP_021441109.1|4667043_4668363_-	xylose isomerase	NA	NA	NA	NA	NA
WP_004178429.1|4668774_4670229_+	MFS transporter	NA	NA	NA	NA	NA
WP_099725648.1|4670287_4671967_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_021441107.1|4672049_4672688_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_000183578.1|4673738_4674548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021441105.1|4674645_4676868_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_021441102.1|4678772_4679900_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004192273.1|4679889_4680153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099725649.1|4680314_4681556_+	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_004178415.1|4681518_4681785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021441098.1|4682727_4684215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104467992.1|4684497_4685609_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	24.4	1.9e-05
WP_044865629.1|4686541_4687057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012695466.1|4688215_4689139_+|transposase	IS5-like element IS903B family transposase	transposase	Q1MVF0	Enterobacteria_phage	98.7	4.6e-175
WP_072031781.1|4689567_4689909_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_017694582.1|4689919_4690462_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_017694583.1|4690474_4690918_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.1	3.9e-15
WP_023343037.1|4690948_4691770_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	36.5	5.7e-44
WP_023343036.1|4691889_4692363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026094405.1|4692434_4692887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012543038.1|4692922_4693639_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_099725650.1|4693882_4694758_-	GTPase family protein	NA	NA	NA	NA	NA
WP_047670580.1|4695037_4697203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017694594.1|4697581_4698499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017694595.1|4698913_4699492_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_017694596.1|4699598_4699805_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_017694597.1|4699900_4700524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017694598.1|4700733_4700961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017694600.1|4701560_4704215_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_017694601.1|4704204_4706106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047670511.1|4706102_4707485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023343028.1|4707665_4709789_-	ATP-dependent helicase	NA	G3MA40	Bacillus_virus	24.8	2.4e-09
WP_026055975.1|4710927_4711851_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	8.4e-177
>prophage 8
NZ_CP024489	Klebsiella pneumoniae strain INF249 chromosome, complete genome	5583461	5048966	5071518	5583461	integrase,transposase	Escherichia_phage(40.0%)	17	5048910:5048928	5080416:5080434
5048910:5048928	attL	TTTTCGGCACTGTTGCAAA	NA	NA	NA	NA
WP_001067855.1|5048966_5049671_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032140899.1|5051292_5051535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000470728.1|5051566_5052244_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|5052322_5053522_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|5053553_5054438_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001351729.1|5054575_5054968_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000509965.1|5055744_5056350_-	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	31.2	1.9e-12
WP_001553819.1|5056444_5059342_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_014386481.1|5061749_5062394_+	quinolone resistance pentapeptide repeat protein QnrB1	NA	NA	NA	NA	NA
WP_001067855.1|5063266_5063971_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845048.1|5064516_5065530_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|5065685_5066159_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	A0A140HLG8	Bacillus_phage	33.8	5.3e-18
WP_001144737.1|5066379_5066646_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001389365.1|5066788_5067553_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004098817.1|5067813_5069028_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001288432.1|5069061_5070495_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_001067855.1|5070813_5071518_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
5080416:5080434	attR	TTTGCAACAGTGCCGAAAA	NA	NA	NA	NA
>prophage 9
NZ_CP024489	Klebsiella pneumoniae strain INF249 chromosome, complete genome	5583461	5146955	5209709	5583461	protease,integrase,transposase	Bacillus_phage(26.67%)	60	5135759:5135774	5181126:5181141
5135759:5135774	attL	CTGCTTGAGTTGCTGC	NA	NA	NA	NA
WP_001515717.1|5146955_5147696_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_032430723.1|5148839_5149787_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_071527918.1|5149813_5150125_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004182026.1|5150189_5151113_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	7.1e-176
WP_004197688.1|5151785_5152043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080895248.1|5152662_5154099_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152070.1|5155081_5156359_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_004178088.1|5156421_5158419_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_085955172.1|5159458_5160666_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178091.1|5162094_5162526_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|5162776_5164252_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|5164244_5164925_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|5165114_5166500_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|5166528_5166882_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004098959.1|5166995_5168288_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|5168298_5171445_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	NA	NA	NA	NA
WP_000758228.1|5171531_5171972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023317528.1|5172098_5174552_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.5	9.9e-84
WP_000843497.1|5174592_5174790_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004182013.1|5174823_5175561_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	41.0	3.6e-13
WP_001023257.1|5175849_5176299_-	copper resistance protein	NA	NA	NA	NA	NA
WP_000925242.1|5176532_5178350_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|5178349_5179246_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|5179285_5179666_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|5179670_5180600_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|5180654_5181335_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
5181126:5181141	attR	CTGCTTGAGTTGCTGC	NA	NA	NA	NA
WP_004152084.1|5181331_5182732_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_004152085.1|5182948_5183383_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_024623170.1|5183614_5183794_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_004196769.1|5185536_5186046_+	major intrinsic family protein	NA	NA	NA	NA	NA
WP_004196778.1|5186095_5186593_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152092.1|5186924_5187251_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085921126.1|5187250_5187961_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004182005.1|5187969_5188515_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152095.1|5188590_5188953_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004152096.1|5190849_5191386_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152097.1|5191418_5191844_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152098.1|5191856_5193146_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152099.1|5193193_5194945_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152100.1|5194962_5195325_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152101.1|5195374_5195725_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_019725036.1|5196082_5196331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015065504.1|5196327_5196900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009310053.1|5196930_5197425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015065502.1|5197468_5197837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019725040.1|5197870_5198074_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_019725034.1|5198087_5198318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019725033.1|5198361_5198556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|5198762_5199029_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|5199016_5199499_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_077253535.1|5199706_5201053_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004143398.1|5201101_5201497_+	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_004152113.1|5202986_5203949_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_009483782.1|5203935_5204685_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152115.1|5204922_5205120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152116.1|5205119_5207915_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152117.1|5208038_5208608_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152118.1|5208642_5208924_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004118208.1|5209167_5209431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118209.1|5209445_5209709_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP024489	Klebsiella pneumoniae strain INF249 chromosome, complete genome	5583461	5222211	5293297	5583461	integrase,transposase	Escherichia_phage(26.32%)	52	5223383:5223442	5277341:5278681
WP_072143344.1|5222211_5223180_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	2.0e-173
5223383:5223442	attL	TATTTAATGAGATGGTCACTCCCTCCTTCCCAGTACTATGCTGAGGACAGGCTTTCATTC	NA	NA	NA	NA
WP_000427619.1|5223453_5224458_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_004118832.1|5226417_5228151_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.7	1.1e-15
WP_004118225.1|5228158_5229106_-	acetamidase/formamidase family protein	NA	NA	NA	NA	NA
WP_004152278.1|5229150_5230755_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118227.1|5230767_5231688_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118228.1|5231687_5232536_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118229.1|5232532_5233126_-	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_004118840.1|5233122_5234250_-	transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118231.1|5234534_5234702_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_004197062.1|5235804_5236326_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004197067.1|5236322_5237276_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_032430169.1|5237368_5239693_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_023157913.1|5239737_5240640_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_004118243.1|5240636_5241635_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004118246.1|5241631_5242588_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	5.3e-17
WP_004152282.1|5242588_5243356_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004118251.1|5243454_5243748_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
WP_071785586.1|5244078_5244321_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000427619.1|5244618_5245623_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_004152286.1|5246209_5247292_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
WP_029498501.1|5247413_5250488_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.6	0.0e+00
WP_023158026.1|5250539_5251793_+	lactose permease	NA	NA	NA	NA	NA
WP_058350821.1|5252762_5253017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197675.1|5254041_5255685_-	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
WP_023157975.1|5255798_5258246_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	69.2	6.1e-25
WP_009653212.1|5258264_5259698_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_004099051.1|5259786_5261070_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_004099052.1|5261199_5263392_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_040147694.1|5263809_5264712_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.0	1.5e-167
WP_019706030.1|5266424_5267429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|5270407_5271112_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_011977766.1|5272132_5272468_-	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
WP_001568067.1|5272640_5272922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176305.1|5272975_5273587_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001445937.1|5273771_5274728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|5275108_5275813_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000427619.1|5277411_5278416_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000954592.1|5278597_5278774_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
5277341:5278681	attR	TATTTAATGAGATGGTCACTCCCTCCTTCCCAGTACTATGCTGAGGACAGGCTTTCATTCGGAGAACCATCATGGAAAACATTGCGCTTATTGGTATCGATCTGGGTAAGAACTCTTTCCATATTCATTGTCAGGATCATCGTGGGAAGGCCGTTTACCGTAAAAAATTCACCCGACCAAAGCTAATCGAATTTCTGGCGACATGCCCGGCAACAACCATCGCGATGGAAGCCTGTGGCGGTTCTCACTTTATGGCACGCAAGCTGGAAGAGTTAGGGCATTTTCCAAAGCTGATATCACCGCAATTTGTCCGCCCATTCGTTAAAAGCAACAAAAATGACTTCGTTGATGCTGAAGCTATCTGTGAAGCAGCATCACGTCCATCTATGCGTTTCGTGCAGCCCAGAACCGAATCTCAGCAGGCAATGCGAGCTCTGCATCGTGTCCGTGAATCCCTGGTTCAGGATAAGGTGAAAACAACTAATCAGATGCATGCTTTTCTGCTGGAATTTGGTATCAGCGTTCCGCGAGGTGCTGCCGTTATTAGTCGACTGAGTACCCTTCTTGAGGACAGTAGTTTGCCTCTTTATCTCAGCCAGTTACTGCTGAAATTACAACAGCATTATCACTATCTTGTTGAGCAGATTAAAGATCTGGAATCTCAGTTGAAACGAAAGTTGGACGAAGATGAGGTTGGACAGCGCTTGCTGAGTATTCCCTGCGTTGGAACGCTGACTGCCAGTACTATTTCAACTGAGATTGGCGACGGGAAGCAGTACGCCAGCAGCCGTGACTTTGCGGCGGCAACAGGGCTGGTACCCCGACAGTACAGCACGGGAGGTCGGACGACATTGTTAGGGATTAGCAAGCGGGGCAACAAAAAGATCCGAACTTTGTTGGTTCAGTGTGCCAGGGTATTCATACAAAAACTGGAACACCAGTCTGGCAAGTTGGCCGACTGGGTCAGGGAGTTGTTGTGTCGGAAAAGCAACTTTGTCGTCACCTGTGCTCTGGCAAACAAGCTGGCCAGAATAGCCTGGGCACTGACGGCGCGACAGCAAACTTACGAAGCATAAAGGCAGAAATACACCAGTTTAAACAATCATTCATCTGGTTTTGCGAATACTGATATTGATGATACTAACGGCCCACCGGCCTGTTGAGGAACCTGTAAAACGGAAAGGCTCATTGAAGCCGTATATTTTCTGGAGGTTCATCAGGCGCGGAACTCATCGAGGCGCGGGAATAAAATCCCATTCAGACGCCGGATAGATTCAAGCAAGCCAACTTGTCGTCAAAATCGGTGTTGCAAAAACGGGAGTGACCATAGATTCCGTTTTC	NA	NA	NA	NA
WP_001043260.1|5279103_5279919_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|5279979_5280783_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|5280782_5281619_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001120891.1|5281590_5282130_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|5282339_5283200_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|5283382_5283940_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000608644.1|5284503_5285766_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000239590.1|5286021_5286897_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|5286943_5287276_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_001067855.1|5289597_5290302_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001334766.1|5290933_5291764_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|5291894_5292449_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|5292592_5293297_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
NZ_CP024490	Klebsiella pneumoniae strain INF249 plasmid unnamed1, complete sequence	71104	23581	36253	71104	integrase	Escherichia_phage(33.33%)	12	22009:22020	27144:27155
22009:22020	attL	TGCTGTCGGATA	NA	NA	NA	NA
WP_029497485.1|23581_24361_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	7.1e-52
WP_000764642.1|24418_24676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012539983.1|25551_26307_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	95.2	1.7e-135
WP_000368714.1|27072_28278_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
27144:27155	attR	TATCCGACAGCA	NA	NA	NA	NA
WP_086523286.1|28274_29252_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.8	1.4e-86
WP_029497486.1|29333_30605_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	62.8	2.2e-151
WP_015632467.1|30604_31036_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.7	7.2e-30
WP_004152765.1|31444_32929_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_001568038.1|33177_34149_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_050888056.1|34151_34823_+	Mediator of plasmid stability	NA	NA	NA	NA	NA
WP_001568040.1|34884_35115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568041.1|35551_36253_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
