The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024478	Pseudomonas sp. HLS-6 chromosome, complete genome	5276694	1272613	1371634	5276694	head,integrase,terminase,tRNA,tail,plate,capsid,holin,portal,lysis,protease	Pseudomonas_phage(26.92%)	102	1304184:1304202	1341104:1341122
WP_099773721.1|1272613_1273966_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_099773722.1|1274040_1276389_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_099773723.1|1276433_1276937_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_099773724.1|1276938_1277994_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_099773725.1|1278105_1278546_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_099773726.1|1278542_1279319_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_099773727.1|1279321_1280449_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_099773728.1|1280449_1281079_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	41.3	6.8e-29
WP_099773729.1|1281183_1284705_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	35.8	6.6e-190
WP_099773730.1|1284803_1285751_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_099773731.1|1285851_1287159_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_099773732.1|1287430_1289059_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.6	9.0e-158
WP_099773733.1|1289062_1289908_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.0	1.0e-48
WP_099773734.1|1290067_1291357_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	59.2	4.1e-137
WP_099773735.1|1291517_1291796_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_099773736.1|1291792_1292500_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_099773737.1|1292526_1293426_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099773738.1|1293534_1294647_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.8	8.0e-33
WP_099773739.1|1294655_1295498_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_099773740.1|1295574_1296048_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_099773741.1|1296044_1297103_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_099773742.1|1297090_1297840_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.8	1.8e-65
WP_177442435.1|1297875_1298514_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.7	2.3e-40
WP_099773744.1|1298692_1299550_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV79	Clostridium_phage	36.2	3.2e-13
WP_099773745.1|1299657_1300665_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	35.8	8.6e-34
WP_065760817.1|1301178_1301502_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_177442436.1|1301641_1304212_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	23.3	1.8e-27
1304184:1304202	attL	ATCGGAGTGTGTGCGGAAA	NA	NA	NA	NA
WP_099773747.1|1304639_1305344_+	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_157767120.1|1305402_1305687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099773749.1|1305697_1306285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099773750.1|1306232_1307522_-|integrase	site-specific integrase	integrase	A0A1I9KF78	Aeromonas_phage	39.1	2.3e-68
WP_099773751.1|1307488_1307686_-	excisionase	NA	Q774Z6	Bordetella_phage	45.5	7.8e-08
WP_099773752.1|1307884_1308421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157767121.1|1308417_1308606_-	hypothetical protein	NA	K4NZ29	Pseudomonas_phage	57.1	4.8e-07
WP_099776556.1|1308798_1309044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099773753.1|1309091_1310777_-	DNA cytosine methyltransferase	NA	A0A1I9KFW0	Aeromonas_phage	35.9	1.1e-89
WP_099773754.1|1310773_1311271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099773755.1|1311367_1311607_-	pyocin activator PrtN family protein	NA	A0A2H4J8B4	uncultured_Caudovirales_phage	68.4	1.4e-22
WP_099773756.1|1311603_1312113_-	hypothetical protein	NA	A0A2H4J897	uncultured_Caudovirales_phage	66.7	4.4e-18
WP_099773758.1|1312360_1313200_-	HIRAN domain-containing protein	NA	NA	NA	NA	NA
WP_099773759.1|1313214_1313895_-	LexA family transcriptional regulator	NA	A0A2H4J0J9	uncultured_Caudovirales_phage	51.0	4.7e-36
WP_099773760.1|1313999_1314221_+	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	54.5	3.8e-11
WP_099773761.1|1314450_1314939_+	hypothetical protein	NA	A0A2H4JFM0	uncultured_Caudovirales_phage	61.1	1.1e-34
WP_099773762.1|1314931_1315135_+	TraR/DksA C4-type zinc finger protein	NA	A0A2H4JDJ0	uncultured_Caudovirales_phage	63.8	2.6e-14
WP_099773763.1|1315131_1317903_+	bifunctional DNA primase/polymerase	NA	A0A2H4JF22	uncultured_Caudovirales_phage	68.6	0.0e+00
WP_099773764.1|1318897_1319230_+|holin	pyocin R2, holin	holin	B5TK61	Pseudomonas_phage	78.5	2.7e-45
WP_099773765.1|1319226_1319595_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	54.7	2.8e-27
WP_099773766.1|1319759_1320293_+|terminase	phage terminase small subunit P27 family	terminase	A0A0S2GLF2	Bacillus_phage	30.4	3.6e-07
WP_099773767.1|1320255_1322088_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	39.2	7.1e-111
WP_177442391.1|1322084_1322261_+	hypothetical protein	NA	Q8W6U8	Burkholderia_virus	57.1	7.2e-05
WP_099773768.1|1322263_1323532_+|portal	phage portal protein	portal	A4JWZ9	Burkholderia_virus	59.8	9.8e-144
WP_099776558.1|1323594_1324476_+	S49 family peptidase	NA	A4JX00	Burkholderia_virus	56.7	2.6e-87
WP_099773769.1|1324543_1325866_+|capsid	phage major capsid protein	capsid	A4JX01	Burkholderia_virus	54.7	2.8e-125
WP_099773770.1|1325913_1326183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099773771.1|1326185_1326737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099773772.1|1326739_1327123_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_099773773.1|1327100_1327625_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	32.8	2.2e-09
WP_099773774.1|1327682_1328282_+	hypothetical protein	NA	B5TK65	Pseudomonas_phage	42.7	3.8e-37
WP_177442437.1|1328287_1328452_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_099773776.1|1328448_1329948_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	63.9	3.6e-169
WP_099773777.1|1330005_1330353_+|tail	phage tail tube protein	tail	B5TK68	Pseudomonas_phage	54.8	9.8e-30
WP_099773778.1|1330352_1330667_+|tail	phage tail assembly protein	tail	B5TK69	Pseudomonas_phage	55.7	2.0e-21
WP_099773779.1|1332934_1334305_+	DNA circularization N-terminal domain-containing protein	NA	B5TK71	Pseudomonas_phage	35.9	1.5e-68
WP_099773780.1|1334308_1335421_+|plate	baseplate protein	plate	B5TK72	Pseudomonas_phage	57.3	5.6e-111
WP_099773781.1|1335417_1335909_+|plate	phage baseplate assembly protein	plate	B5TK73	Pseudomonas_phage	66.9	6.9e-53
WP_099773782.1|1335910_1336312_+	phage GP46 family protein	NA	B5TK74	Pseudomonas_phage	52.7	2.7e-31
WP_099773783.1|1336301_1337339_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	57.3	1.1e-105
WP_099773784.1|1337329_1337932_+	DUF2313 domain-containing protein	NA	B5TK76	Pseudomonas_phage	66.2	1.2e-70
WP_099773785.1|1337932_1339258_+	hypothetical protein	NA	A0A077K818	Ralstonia_phage	60.8	7.1e-44
WP_099773786.1|1339259_1339694_+|tail	phage tail protein	tail	B5TK82	Pseudomonas_phage	40.0	9.1e-17
WP_099773787.1|1339749_1340301_+	glycoside hydrolase family 19 protein	NA	A0A2H4JHX4	uncultured_Caudovirales_phage	75.3	3.7e-71
WP_099773788.1|1340297_1340819_+|lysis	lysis protein	lysis	A0A2H4JBH9	uncultured_Caudovirales_phage	50.9	9.3e-32
WP_065760815.1|1341450_1341933_+	nicotinamide-nucleotide amidohydrolase family protein	NA	B5TK85	Pseudomonas_phage	77.4	4.1e-58
1341104:1341122	attR	ATCGGAGTGTGTGCGGAAA	NA	NA	NA	NA
WP_099773789.1|1342036_1343113_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	62.1	1.7e-112
WP_065760813.1|1343121_1343589_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_099773790.1|1343621_1344740_-	TIGR00730 family Rossman fold protein	NA	NA	NA	NA	NA
WP_065760811.1|1345161_1345356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065760810.1|1345361_1345781_-	quorum-sensing-regulated virulence factor family protein	NA	NA	NA	NA	NA
WP_099773791.1|1345985_1346696_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_065760808.1|1346941_1347592_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_065760807.1|1347666_1348029_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_065760806.1|1348025_1348952_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065760805.1|1349072_1349852_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_099773792.1|1349923_1350619_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_065760803.1|1350626_1351088_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	54.0	1.3e-40
WP_099776560.1|1351137_1351848_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_065760802.1|1351966_1352437_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_065760801.1|1352523_1353861_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_065760799.1|1354127_1356026_+	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	34.8	1.3e-78
WP_099773794.1|1356072_1357368_-	virulence factor family protein	NA	NA	NA	NA	NA
WP_099773795.1|1357367_1360010_-	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_065760796.1|1360726_1361791_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_099773796.1|1361836_1362790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099773797.1|1362810_1364526_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_099773798.1|1364691_1365957_-	OprD family porin	NA	NA	NA	NA	NA
WP_065761592.1|1366754_1367180_+	HIT domain-containing protein	NA	NA	NA	NA	NA
WP_065761591.1|1367183_1367390_+	SlyX family protein	NA	NA	NA	NA	NA
WP_099773799.1|1367458_1368040_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	47.6	1.0e-10
WP_065761589.1|1368367_1368838_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	38.0	1.3e-19
WP_065761588.1|1369101_1369431_+	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_065761587.1|1369542_1369764_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_099776564.1|1369858_1371634_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	26.1	1.9e-12
>prophage 2
NZ_CP024478	Pseudomonas sp. HLS-6 chromosome, complete genome	5276694	1984919	2105039	5276694	integrase,terminase,tail,transposase,lysis,protease	Pseudomonas_phage(42.86%)	131	2039486:2039530	2077965:2078009
WP_002553164.1|1984919_1985222_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	1.8e-11
WP_010222411.1|1985202_1985559_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099774114.1|1985805_1986984_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A059VF45	Pseudomonas_phage	70.4	1.1e-160
WP_099774115.1|1987295_1988030_-	metallophosphoesterase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	84.0	5.2e-129
WP_099774116.1|1988064_1988394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099774117.1|1988447_1988927_-	class I SAM-dependent methyltransferase	NA	A0A0N7IRF6	Acinetobacter_phage	62.7	1.5e-57
WP_099774118.1|1988923_1989358_-	DUF2591 family protein	NA	A0A1B0VMD7	Pseudomonas_phage	38.6	3.8e-15
WP_099774119.1|1989354_1989714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099774120.1|1989746_1989995_-	hypothetical protein	NA	A0A2H4J399	uncultured_Caudovirales_phage	84.3	2.6e-32
WP_099774121.1|1990818_1991340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157767126.1|1991389_1991950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099774123.1|1991942_1992701_-	hypothetical protein	NA	A0A1J0GVP2	Pseudoalteromonas_phage	50.3	1.4e-49
WP_099774124.1|1992753_1993419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099774125.1|1993510_1993954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099774126.1|1993971_1994523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099774127.1|1994634_1994892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099774128.1|1994881_1995403_-	hypothetical protein	NA	A0A2H4JAQ1	uncultured_Caudovirales_phage	52.4	1.9e-08
WP_099774130.1|1995647_1996196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099774131.1|1996192_1997863_-	YqaJ viral recombinase family protein	NA	A0A2H4J6P1	uncultured_Caudovirales_phage	63.5	1.7e-183
WP_099774132.1|1997859_1998747_-	recombinase RecT	NA	A0A0F6TJP0	Escherichia_coli_O157_typing_phage	64.7	1.3e-78
WP_099774133.1|1998908_1999355_-	hypothetical protein	NA	A0A2H4J7X7	uncultured_Caudovirales_phage	77.7	4.0e-60
WP_099774134.1|1999351_1999606_-	hypothetical protein	NA	A0A2H4J404	uncultured_Caudovirales_phage	70.7	3.7e-26
WP_099774135.1|1999629_1999851_-	DUF551 domain-containing protein	NA	A0A2H4J1U4	uncultured_Caudovirales_phage	82.2	8.7e-32
WP_099774136.1|1999847_2000090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099774137.1|2000470_2000743_-	hypothetical protein	NA	A0A2I7RQ39	Vibrio_phage	46.5	6.5e-13
WP_099774138.1|2000800_2001319_-	hypothetical protein	NA	A0A059VFZ8	Pseudomonas_phage	63.0	2.8e-57
WP_099774139.1|2001383_2001599_-	hypothetical protein	NA	A0A2H4J2M2	uncultured_Caudovirales_phage	58.9	6.3e-19
WP_099774140.1|2001595_2001802_-	hypothetical protein	NA	A0A2H4J8N9	uncultured_Caudovirales_phage	68.7	4.6e-19
WP_177442396.1|2001908_2002382_-	HNH endonuclease	NA	Q2NPG0	Xanthomonas_virus	40.3	1.1e-26
WP_099774142.1|2002938_2003256_+	DUF1654 domain-containing protein	NA	A0A0S2SYC9	Pseudomonas_phage	59.2	1.3e-23
WP_099774143.1|2003308_2003815_-	hypothetical protein	NA	A0A1B0VMC8	Pseudomonas_phage	62.4	3.8e-46
WP_099776603.1|2003993_2004479_+	hypothetical protein	NA	B9UDL3	Salmonella_phage	44.1	3.4e-20
WP_099774144.1|2004842_2005097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099776605.1|2005634_2006462_-	S24 family peptidase	NA	A0A2D1GNH0	Pseudomonas_phage	56.6	1.1e-63
WP_099774146.1|2006575_2006812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028941800.1|2006840_2007035_+	hypothetical protein	NA	B5WZX7	Pseudomonas_phage	57.4	5.0e-07
WP_099774147.1|2007055_2007292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099776607.1|2007456_2008179_+	Rha family transcriptional regulator	NA	A0A2H4J111	uncultured_Caudovirales_phage	92.0	5.1e-121
WP_099774148.1|2008180_2009161_+	phage replication protein	NA	A0A1B0VME0	Pseudomonas_phage	76.7	4.5e-120
WP_099774149.1|2009147_2009954_+	hypothetical protein	NA	A0A1B0VMD9	Pseudomonas_phage	51.9	2.5e-60
WP_099774150.1|2009953_2010133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099774151.1|2010132_2010438_+	hypothetical protein	NA	A0A0S2SYA7	Pseudomonas_phage	74.7	4.0e-35
WP_099774152.1|2010434_2011013_+	ead/Ea22-like family protein	NA	A0A2H4JCF4	uncultured_Caudovirales_phage	52.1	6.1e-16
WP_099776609.1|2011161_2011509_+	recombination protein NinB	NA	A0A0H5AUD0	Pseudomonas_phage	84.3	3.8e-50
WP_099774153.1|2011505_2012072_+	HNH endonuclease	NA	A0A240EWM4	Vibrio_phage	42.5	3.7e-18
WP_099774154.1|2012068_2012650_+	recombination protein NinG	NA	A0A059VA66	Pseudomonas_phage	67.4	5.6e-70
WP_099774155.1|2012640_2013231_+	hypothetical protein	NA	A0A059VF83	Pseudomonas_phage	61.7	4.1e-68
WP_012273046.1|2014142_2014466_+	hypothetical protein	NA	A0A1B0VME9	Pseudomonas_phage	89.7	1.5e-43
WP_031688028.1|2014467_2014731_+	hypothetical protein	NA	A0A1B0VME7	Pseudomonas_phage	72.9	7.4e-30
WP_015269843.1|2014788_2015019_+	hypothetical protein	NA	A0A1S6UB66	Serratia_phage	62.0	3.7e-17
WP_031688030.1|2015065_2015317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078452196.1|2015320_2015533_+	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	67.2	2.0e-17
WP_099774156.1|2015529_2015982_+	proteasome subunit beta	NA	A0A2H4J821	uncultured_Caudovirales_phage	98.6	1.6e-72
WP_099774157.1|2015956_2016580_+	hypothetical protein	NA	A0A1B0VRJ1	Pseudomonas_phage	69.6	2.7e-86
WP_099774158.1|2016611_2017088_+	DUF2280 domain-containing protein	NA	A0A0S2SY97	Pseudomonas_phage	77.7	2.0e-57
WP_099774159.1|2017059_2018358_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	60.4	7.9e-149
WP_177442397.1|2018360_2019740_+	DUF4055 domain-containing protein	NA	A0A0H5AWC7	Pseudomonas_phage	67.9	1.4e-183
WP_099774161.1|2019739_2020816_+	hypothetical protein	NA	A0A0H5BBX3	Pseudomonas_phage	52.4	4.8e-99
WP_099774162.1|2020899_2021610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099774163.1|2021848_2022595_+	hypothetical protein	NA	A0A0H5AWD1	Pseudomonas_phage	79.7	2.7e-101
WP_099774164.1|2022604_2023573_+	hypothetical protein	NA	A0A0H5ARK0	Pseudomonas_phage	78.3	2.5e-139
WP_099774165.1|2023615_2023912_+	hypothetical protein	NA	A0A0H5BBX8	Pseudomonas_phage	56.7	4.5e-07
WP_099774166.1|2023911_2024283_+	hypothetical protein	NA	A0A0S2SYB7	Pseudomonas_phage	57.5	4.7e-30
WP_099774167.1|2024284_2024668_+	glutamate 5-kinase	NA	A0A0H5ARS2	Pseudomonas_phage	48.9	1.9e-18
WP_099774168.1|2024670_2025060_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	46.3	7.4e-26
WP_099774169.1|2025056_2025461_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_099774170.1|2025522_2026692_+	Ig-like domain-containing protein	NA	A0A059VG08	Pseudomonas_phage	39.5	1.9e-56
WP_099774171.1|2026749_2027193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099776611.1|2027360_2027540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099774172.1|2027579_2030477_+|tail	phage tail length tape measure family protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.5	1.2e-96
WP_099774173.1|2030485_2030833_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_099774174.1|2030829_2031537_+|tail	phage minor tail protein L	tail	A0A2I6PHT9	Pseudomonas_phage	56.1	2.1e-71
WP_099774175.1|2031536_2032256_+	C40 family peptidase	NA	A0A2I6PHT8	Pseudomonas_phage	52.7	3.6e-66
WP_099774176.1|2032252_2032807_+|tail	tail assembly protein	tail	V9QL88	Rhizobium_phage	32.0	4.9e-15
WP_099774177.1|2032806_2036025_+	host specificity protein J	NA	A0A2I6PHT2	Pseudomonas_phage	44.2	5.1e-205
WP_099774178.1|2036041_2036887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099774179.1|2036888_2037323_+|tail	phage tail protein	tail	Q9ZXK5	Pseudomonas_virus	43.6	1.1e-14
WP_099774180.1|2037363_2037858_+	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	59.5	2.8e-46
WP_099774181.1|2037854_2038406_+|lysis	lysis protein	lysis	B5TK84	Pseudomonas_phage	50.0	4.3e-27
WP_157767127.1|2038664_2038904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099774184.1|2038921_2039125_+	hypothetical protein	NA	NA	NA	NA	NA
2039486:2039530	attL	ATGGGGTGCAAGGGGTAGAGTGTTCGAATCACTCCGTCCCGACCA	NA	NA	NA	NA
WP_177442441.1|2039811_2042685_+	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	43.7	8.3e-215
WP_079761861.1|2043128_2043446_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_145991801.1|2043451_2043778_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_099773211.1|2043839_2045375_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	46.7	5.9e-119
WP_099774186.1|2045374_2046865_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_099774187.1|2046857_2047658_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.1	8.3e-32
WP_099774188.1|2048352_2048622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099774189.1|2048871_2050563_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	37.9	1.5e-22
WP_099774190.1|2050599_2052165_-	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	57.0	1.4e-43
WP_041167218.1|2052563_2053367_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_070087347.1|2053394_2055065_-	TIGR01244 family phosphatase	NA	NA	NA	NA	NA
WP_014753621.1|2055116_2055995_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_070087346.1|2056230_2057556_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_070087345.1|2057623_2057914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014753617.1|2057910_2059482_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_070087344.1|2059474_2060611_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_014753615.1|2060633_2060756_+	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_070087343.1|2060752_2061040_+	cyd operon YbgE family protein	NA	NA	NA	NA	NA
WP_028697513.1|2062212_2063457_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_099774192.1|2064340_2065288_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_083279670.1|2065773_2066079_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_070087264.1|2066261_2067821_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.2	2.2e-12
WP_099774193.1|2068131_2068629_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_099774194.1|2068678_2069593_-	hydrolase or metal-binding protein	NA	NA	NA	NA	NA
WP_099774195.1|2069670_2070675_-	YqaJ viral recombinase family protein	NA	A0A139ZPJ9	Marinitoga_camini_virus	46.3	1.3e-45
WP_099774196.1|2070751_2071720_-	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	43.2	9.4e-62
WP_033726379.1|2071849_2072182_-	membrane protein	NA	NA	NA	NA	NA
WP_099774197.1|2072793_2073003_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004574260.1|2073319_2073559_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_099774198.1|2073579_2075058_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_157767128.1|2075250_2076270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099774200.1|2076355_2077768_-|integrase	site-specific integrase	integrase	A0A2H4IYX8	uncultured_Caudovirales_phage	68.2	4.4e-169
WP_157767129.1|2078203_2078347_-	hypothetical protein	NA	NA	NA	NA	NA
2077965:2078009	attR	ATGGGGTGCAAGGGGTAGAGTGTTCGAATCACTCCGTCCCGACCA	NA	NA	NA	NA
WP_099774201.1|2078503_2079082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099774202.1|2079148_2080411_-	PAS domain-containing protein	NA	A0A127AWB9	Bacillus_phage	41.4	7.0e-17
WP_099774203.1|2080784_2081741_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	28.5	9.1e-09
WP_099774204.1|2081789_2082230_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_099774205.1|2082288_2083740_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_065760820.1|2084200_2085622_+	amino acid permease	NA	NA	NA	NA	NA
WP_099774206.1|2086326_2087871_+|protease	protease	protease	NA	NA	NA	NA
WP_099774207.1|2087867_2088068_+	cellulose biosynthesis protein BcsF	NA	NA	NA	NA	NA
WP_099774208.1|2088054_2089683_+	cellulose biosynthesis protein BcsG	NA	NA	NA	NA	NA
WP_099774209.1|2089652_2089892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065760020.1|2089888_2090611_+	cellulose synthase operon protein YhjQ	NA	NA	NA	NA	NA
WP_099774210.1|2090607_2093202_+	UDP-forming cellulose synthase catalytic subunit	NA	NA	NA	NA	NA
WP_099774211.1|2093198_2095499_+	cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB	NA	NA	NA	NA	NA
WP_099774212.1|2095513_2096614_+	cellulase	NA	NA	NA	NA	NA
WP_099774213.1|2096601_2100039_+	cellulose biosynthesis protein BcsC	NA	NA	NA	NA	NA
WP_099774214.1|2100326_2103125_+	PAS domain-containing protein	NA	A0A1V0SGX0	Hokovirus	32.9	2.6e-19
WP_099774215.1|2103212_2105039_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	C7U047	Ostreococcus_tauri_virus	41.2	2.4e-103
>prophage 3
NZ_CP024478	Pseudomonas sp. HLS-6 chromosome, complete genome	5276694	2246344	2362455	5276694	head,integrase,terminase,tail,plate,capsid,holin,portal,transposase,lysis,protease	uncultured_Caudovirales_phage(38.95%)	139	2317934:2317993	2364018:2364114
WP_157767171.1|2246344_2247844_+|transposase	IS21-like element ISPst3 family transposase	transposase	NA	NA	NA	NA
WP_099773209.1|2247836_2248640_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	36.2	5.2e-34
WP_099774300.1|2249561_2251055_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_099774301.1|2251042_2252587_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_099774302.1|2253066_2253828_+	DUF2262 domain-containing protein	NA	NA	NA	NA	NA
WP_099774303.1|2253842_2254556_-	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_099774304.1|2254702_2256274_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_083199718.1|2256584_2257904_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	1.4e-23
WP_065757735.1|2257915_2258254_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_099776629.1|2258382_2258880_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_065757737.1|2258982_2259837_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_065757738.1|2259907_2261038_-	aminomethyl transferase family protein	NA	NA	NA	NA	NA
WP_099774305.1|2261071_2262088_-	DUF3445 domain-containing protein	NA	NA	NA	NA	NA
WP_099774306.1|2262108_2263047_-	oxidoreductase	NA	NA	NA	NA	NA
WP_099774307.1|2263043_2263592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099774308.1|2263954_2264935_+	histidine kinase	NA	NA	NA	NA	NA
WP_099774309.1|2264931_2265618_+	response regulator	NA	NA	NA	NA	NA
WP_099774310.1|2265604_2266345_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_099774311.1|2266398_2268741_-	DUF1989 domain-containing protein	NA	NA	NA	NA	NA
WP_065757745.1|2268775_2270143_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_099774312.1|2270420_2271410_+	PAS domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	71.0	9.7e-14
WP_099774313.1|2271526_2271940_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_099774314.1|2271936_2273280_+	dihydroorotase	NA	NA	NA	NA	NA
WP_099774315.1|2273445_2274645_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.7	8.7e-17
WP_099774316.1|2274971_2276036_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	56.9	2.3e-106
WP_099774317.1|2276039_2276294_-	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	80.3	7.9e-29
WP_099776631.1|2276345_2276861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099774318.1|2276866_2277478_-	hypothetical protein	NA	Q6J1P0	Burkholderia_virus	48.4	3.6e-11
WP_099774319.1|2277546_2278365_-	DUF2303 family protein	NA	A0A2R2Z323	Escherichia_phage	44.7	1.2e-49
WP_099774320.1|2278409_2278757_-	hypothetical protein	NA	A0A2D1GMS3	Marinobacter_phage	37.6	2.2e-13
WP_099774321.1|2278800_2279040_-	pyocin activator PrtN family protein	NA	A0A2H4J8B4	uncultured_Caudovirales_phage	69.6	3.2e-24
WP_099774322.1|2279036_2279408_-	hypothetical protein	NA	A0A2H4J897	uncultured_Caudovirales_phage	74.6	9.8e-44
WP_157767131.1|2279404_2279686_-	phage antirepressor KilAC domain-containing protein	NA	A0A2H4JBX5	uncultured_Caudovirales_phage	55.9	4.2e-23
WP_099774323.1|2279695_2280268_-	deoxynucleotide monophosphate kinase	NA	A0A2H4J8A1	uncultured_Caudovirales_phage	57.2	6.8e-60
WP_099774324.1|2280264_2280453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099774325.1|2280569_2281382_-	helix-turn-helix transcriptional regulator	NA	A0A0A0YR73	Pseudomonas_phage	46.7	6.9e-58
WP_099774326.1|2281500_2281710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099774327.1|2281851_2282340_+	hypothetical protein	NA	A0A2H4JFM0	uncultured_Caudovirales_phage	59.4	6.4e-35
WP_099774328.1|2282332_2282536_+	TraR/DksA C4-type zinc finger protein	NA	A0A2H4JDJ0	uncultured_Caudovirales_phage	60.0	1.5e-06
WP_099774329.1|2282532_2285229_+	bifunctional DNA primase/polymerase	NA	A0A2H4JF22	uncultured_Caudovirales_phage	71.3	0.0e+00
WP_099774330.1|2286222_2286570_+|holin	pyocin R2, holin	holin	B5TK61	Pseudomonas_phage	76.8	2.6e-46
WP_099774331.1|2286619_2286868_-	hypothetical protein	NA	A0A2H4J888	uncultured_Caudovirales_phage	56.8	1.2e-16
WP_099774332.1|2286988_2287294_+	hypothetical protein	NA	A0A2H4JBW4	uncultured_Caudovirales_phage	59.6	3.5e-23
WP_099774333.1|2287473_2288070_+|terminase	terminase small subunit	terminase	A0A2H4JG15	uncultured_Caudovirales_phage	59.4	2.5e-49
WP_099774334.1|2288074_2290099_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4J898	uncultured_Caudovirales_phage	75.7	1.0e-307
WP_099774335.1|2290100_2290307_+	hypothetical protein	NA	A0A2H4JA19	uncultured_Caudovirales_phage	82.4	1.4e-23
WP_099774336.1|2290303_2291785_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	78.5	5.4e-226
WP_099774337.1|2291781_2292951_+|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	68.2	3.4e-135
WP_099774338.1|2292947_2293295_+|head	head decoration protein	head	A0A2H4JF15	uncultured_Caudovirales_phage	75.0	1.3e-37
WP_099774339.1|2293357_2294353_+|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	77.3	1.1e-150
WP_099774340.1|2294355_2294670_+	hypothetical protein	NA	A0A2H4J879	uncultured_Caudovirales_phage	61.2	6.8e-30
WP_099774341.1|2294666_2295335_+	hypothetical protein	NA	A0A2H4JBV1	uncultured_Caudovirales_phage	65.9	6.4e-78
WP_099774342.1|2295327_2295828_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	58.2	5.9e-44
WP_099774343.1|2295824_2296385_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	57.4	2.1e-53
WP_099774344.1|2296433_2296670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099774345.1|2296674_2297001_+	GPW/gp25 family protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	66.7	6.6e-36
WP_099774346.1|2296997_2297879_+|plate	baseplate J/gp47 family protein	plate	A0A2H4JFK9	uncultured_Caudovirales_phage	73.3	1.5e-114
WP_099774347.1|2297881_2298493_+|tail	phage tail protein I	tail	A0A2H4JDH5	uncultured_Caudovirales_phage	63.6	7.5e-65
WP_099774348.1|2298485_2300375_+|tail	phage tail protein	tail	A0A077K818	Ralstonia_phage	39.9	8.4e-99
WP_099774349.1|2300371_2300800_+|tail	phage tail protein	tail	Q9ZXK5	Pseudomonas_virus	41.3	8.7e-20
WP_177442399.1|2300872_2302054_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	79.5	8.8e-179
WP_099774351.1|2302066_2302576_+|tail	phage major tail tube protein	tail	A0A2H4JBU0	uncultured_Caudovirales_phage	74.3	2.3e-67
WP_099774352.1|2302588_2302891_+|tail	phage tail assembly protein	tail	K4I007	Acidithiobacillus_phage	42.0	5.0e-06
WP_099774353.1|2303032_2305654_+|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	33.0	8.1e-76
WP_177442400.1|2305663_2306509_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	67.1	9.2e-106
WP_099774354.1|2306483_2306690_+|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	73.1	3.1e-23
WP_099774355.1|2306754_2307801_+	late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	76.4	4.7e-152
WP_099774356.1|2307842_2308394_+	glycoside hydrolase family 19 protein	NA	A0A2H4JHX4	uncultured_Caudovirales_phage	72.5	9.4e-67
WP_099774357.1|2308390_2308918_+|lysis	lysis protein	lysis	A0A2H4JBH9	uncultured_Caudovirales_phage	53.8	8.5e-33
WP_099774358.1|2309072_2309867_+	DNA adenine methylase	NA	C7BGE1	Burkholderia_phage	66.2	2.2e-101
WP_099774359.1|2309919_2310612_-	SOS response-associated peptidase family protein	NA	A0A2H4J991	uncultured_Caudovirales_phage	76.0	1.6e-103
WP_099774360.1|2310713_2311139_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A218MND2	uncultured_virus	37.4	6.4e-15
WP_099774361.1|2311131_2312406_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	50.0	1.2e-109
WP_099774362.1|2312754_2314167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099774363.1|2314920_2315568_-	RloB domain-containing protein	NA	NA	NA	NA	NA
WP_099774364.1|2315584_2316862_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_099774365.1|2317318_2317525_-	hypothetical protein	NA	NA	NA	NA	NA
2317934:2317993	attL	ATCGGATTGCAAATCCGTCTACGCCGGTTCGATTCCGACCTCGGCCTCCATATTTGAAAG	NA	NA	NA	NA
WP_099774366.1|2318082_2319132_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	57.7	5.7e-105
WP_099774367.1|2319133_2319376_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_099774368.1|2319956_2320190_-	hypothetical protein	NA	A0A248H4E8	Dickeya_phage	45.5	2.0e-10
WP_099774369.1|2320233_2320728_-	hypothetical protein	NA	I2GUG5	Acinetobacter_phage	29.5	4.0e-08
WP_099774370.1|2320812_2321736_-	DNA cytosine methyltransferase	NA	A0A142KB20	Gordonia_phage	37.5	1.5e-24
WP_099774371.1|2321732_2322890_-	reverse transcriptase	NA	A0A0N7AE80	Bacillus_phage	34.3	1.3e-49
WP_099774372.1|2323091_2323448_-	four helix bundle protein	NA	NA	NA	NA	NA
WP_099774373.1|2323502_2324117_-	DUF1566 domain-containing protein	NA	H2BDH2	Pseudomonas_virus	34.4	6.9e-18
WP_099774374.1|2324182_2324782_-	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_099774375.1|2324802_2325618_-	DUF2303 family protein	NA	A0A2R2Z323	Escherichia_phage	41.7	1.4e-45
WP_099774376.1|2325644_2325992_-	hypothetical protein	NA	I3PUY8	Vibrio_phage	49.1	8.9e-23
WP_157767132.1|2326083_2326248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099774377.1|2326244_2326790_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099774378.1|2326786_2327056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099774379.1|2327320_2327506_-	carbon storage regulator CsrA	NA	H2BD56	Pseudomonas_phage	61.7	9.2e-11
WP_099774380.1|2327565_2327787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099774381.1|2327783_2328224_-	tellurite resistance TerB family protein	NA	Q1MVI3	Enterobacteria_phage	50.0	4.0e-28
WP_099774382.1|2328293_2328500_-	hypothetical protein	NA	A0A0U4IJ22	Pseudomonas_phage	64.7	4.0e-23
WP_099776637.1|2329242_2329485_+	DUF1654 domain-containing protein	NA	A0A2K8HZW3	Pseudomonas_phage	64.8	3.4e-13
WP_099774383.1|2329573_2330605_+	virulence RhuM family protein	NA	NA	NA	NA	NA
WP_099774384.1|2330666_2331518_-	Cro/Cl family transcriptional regulator	NA	A0A0S2SYF7	Pseudomonas_phage	48.6	4.1e-69
WP_099774385.1|2331606_2331783_+	Cro/Cl family transcriptional regulator	NA	A0A0S2SYB8	Pseudomonas_phage	64.4	4.2e-13
WP_099774386.1|2331848_2332271_+	Rha family transcriptional regulator	NA	A0A2D1GNM7	Pseudomonas_phage	54.3	1.4e-33
WP_099776639.1|2332621_2333290_+	phage regulatory protein/antirepressor Ant	NA	A0A1B0YZY9	Pseudomonas_phage	56.7	5.7e-58
WP_099774387.1|2333301_2334069_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099774388.1|2334065_2334734_+	replication P family protein	NA	A0A1B0YZY6	Pseudomonas_phage	45.0	1.0e-43
WP_099776641.1|2334742_2334934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099774389.1|2334930_2335227_+	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	69.5	2.4e-32
WP_099774390.1|2335223_2335652_+	VRR-NUC domain-containing protein	NA	A0A2D1GNH3	Pseudomonas_phage	68.5	4.4e-48
WP_099774391.1|2335648_2336950_+|integrase	site-specific integrase	integrase	A0A2D1GND4	Pseudomonas_phage	56.5	5.4e-129
WP_099774392.1|2336946_2337264_+	hypothetical protein	NA	A0A2D1GNG3	Pseudomonas_phage	70.5	2.9e-36
WP_099774393.1|2337274_2337961_+	hypothetical protein	NA	A0A1B0VMF2	Pseudomonas_phage	66.2	2.2e-81
WP_157767133.1|2338347_2338518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157767134.1|2338624_2338831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099774395.1|2339118_2339454_+|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	73.4	6.6e-39
WP_177442401.1|2339450_2339777_+	HNH endonuclease	NA	B5WZZ4	Pseudomonas_phage	59.0	1.4e-30
WP_099774397.1|2339913_2340381_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	58.4	1.2e-43
WP_099774399.1|2340340_2342149_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	40.3	1.4e-114
WP_099774401.1|2342145_2342334_+	hypothetical protein	NA	Q8W6U8	Burkholderia_virus	62.3	1.3e-07
WP_099774403.1|2342336_2343608_+|portal	phage portal protein	portal	A4JWZ9	Burkholderia_virus	63.7	3.1e-153
WP_099774405.1|2343604_2344579_+	S49 family peptidase	NA	A4JX00	Burkholderia_virus	54.5	8.5e-87
WP_099774407.1|2344640_2345954_+|capsid	phage major capsid protein	capsid	A4JX01	Burkholderia_virus	60.5	1.0e-143
WP_099774409.1|2346008_2346266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099774411.1|2346268_2346820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099774412.1|2346822_2347206_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_099774414.1|2347183_2347708_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	31.5	1.1e-08
WP_099774416.1|2347765_2348365_+	hypothetical protein	NA	B5TK65	Pseudomonas_phage	42.2	5.5e-36
WP_176717418.1|2348370_2348535_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_099774418.1|2348531_2350031_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	63.9	5.5e-170
WP_099773777.1|2350088_2350436_+|tail	phage tail tube protein	tail	B5TK68	Pseudomonas_phage	54.8	9.8e-30
WP_099773778.1|2350435_2350750_+|tail	phage tail assembly protein	tail	B5TK69	Pseudomonas_phage	55.7	2.0e-21
WP_099774420.1|2353017_2354388_+	DNA circularization N-terminal domain-containing protein	NA	B5TK71	Pseudomonas_phage	37.4	1.2e-73
WP_099774422.1|2354391_2355504_+|plate	baseplate protein	plate	B5TK72	Pseudomonas_phage	57.4	1.6e-110
WP_099774423.1|2355500_2355992_+|plate	phage baseplate assembly protein	plate	B5TK73	Pseudomonas_phage	67.5	1.4e-53
WP_099773782.1|2355993_2356395_+	phage GP46 family protein	NA	B5TK74	Pseudomonas_phage	52.7	2.7e-31
WP_099774425.1|2356384_2357422_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	57.0	5.6e-105
WP_099774427.1|2357412_2358015_+	DUF2313 domain-containing protein	NA	B5TK76	Pseudomonas_phage	61.5	4.8e-64
WP_099774429.1|2358015_2359608_+	hypothetical protein	NA	A4PE45	Ralstonia_virus	51.3	1.7e-44
WP_099774431.1|2359609_2360044_+|tail	phage tail protein	tail	Q9ZXK5	Pseudomonas_virus	46.7	2.7e-16
WP_099774433.1|2360084_2360579_+	glycoside hydrolase family 104 protein	NA	A0A2P0PAW6	Pectobacterium_phage	61.3	4.8e-46
WP_099774435.1|2360575_2361106_+|lysis	lysis protein	lysis	A0A2H4JBH9	uncultured_Caudovirales_phage	48.8	2.7e-26
WP_157767135.1|2361231_2362455_+	autotransporter domain-containing protein	NA	A0A2P0VNA6	Tetraselmis_virus	84.5	2.3e-25
2364018:2364114	attR	ATCGGATTGCAAATCCGTCTACGCCGGTTCGATTCCGACCTCGGCCTCCATATTTGAAAGCCCCGCAGATTAACGTCTGCGGGGCTTTTTCGTTGTG	NA	NA	NA	NA
>prophage 4
NZ_CP024478	Pseudomonas sp. HLS-6 chromosome, complete genome	5276694	3239889	3314692	5276694	head,integrase,terminase,tail,tRNA,protease,plate,holin,portal,transposase,lysis,capsid	uncultured_Caudovirales_phage(54.39%)	93	3279383:3279398	3304674:3304689
WP_099773594.1|3239889_3241320_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_099775221.1|3241443_3242574_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_065759662.1|3244479_3245250_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_065759663.1|3245353_3245860_-	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_083199802.1|3246104_3246431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065759664.1|3246771_3248451_+	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_065759666.1|3248952_3249225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065759667.1|3249461_3249935_-	OsmC family protein	NA	NA	NA	NA	NA
WP_157767146.1|3249997_3250579_-	DUF3841 domain-containing protein	NA	NA	NA	NA	NA
WP_099775223.1|3250856_3251822_+	endonuclease	NA	NA	NA	NA	NA
WP_099775224.1|3252116_3252926_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099775225.1|3253002_3254352_-	MFS transporter	NA	NA	NA	NA	NA
WP_083199803.1|3254438_3254627_-	DUF2783 domain-containing protein	NA	NA	NA	NA	NA
WP_099775226.1|3254637_3256338_-	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_099776714.1|3257182_3257623_-|lysis	lysis protein	lysis	A0A2H4JBH9	uncultured_Caudovirales_phage	52.4	7.6e-27
WP_099775227.1|3257709_3258246_-	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	59.5	1.0e-46
WP_099775228.1|3258320_3259376_-	late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	77.0	1.9e-153
WP_099774354.1|3259440_3259647_-|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	73.1	3.1e-23
WP_177442408.1|3259621_3260467_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	67.5	5.4e-106
WP_099775229.1|3260476_3263104_-|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	41.5	1.9e-80
WP_099774352.1|3263245_3263548_-|tail	phage tail assembly protein	tail	K4I007	Acidithiobacillus_phage	42.0	5.0e-06
WP_099775230.1|3263560_3264070_-|tail	phage major tail tube protein	tail	A0A2H4JBU0	uncultured_Caudovirales_phage	73.1	9.6e-66
WP_177442409.1|3264082_3265264_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	80.1	5.1e-179
WP_099775232.1|3265336_3265762_-|tail	tail fiber assembly protein	tail	B5TK82	Pseudomonas_phage	40.1	1.7e-20
WP_099775233.1|3265777_3267715_-|tail	phage tail protein	tail	A0A077K818	Ralstonia_phage	40.9	3.4e-103
WP_099774347.1|3267707_3268319_-|tail	phage tail protein I	tail	A0A2H4JDH5	uncultured_Caudovirales_phage	63.6	7.5e-65
WP_099775234.1|3268321_3269203_-|plate	baseplate J/gp47 family protein	plate	A0A2H4JFK9	uncultured_Caudovirales_phage	72.9	8.7e-115
WP_099775235.1|3269199_3269526_-	GPW/gp25 family protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	65.7	1.9e-35
WP_099775236.1|3269530_3269737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099775237.1|3269802_3270126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099775238.1|3270133_3270694_-|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	59.6	2.9e-55
WP_099775239.1|3270690_3271191_-	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	56.9	4.3e-42
WP_099775240.1|3271183_3271846_-	hypothetical protein	NA	A0A2H4JBV1	uncultured_Caudovirales_phage	66.8	3.9e-75
WP_099775241.1|3271842_3272157_-	hypothetical protein	NA	A0A2H4J879	uncultured_Caudovirales_phage	60.2	8.9e-30
WP_099775242.1|3272159_3273155_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	77.0	1.8e-148
WP_099775243.1|3273217_3273565_-|head	head decoration protein	head	A0A2H4JF15	uncultured_Caudovirales_phage	73.2	1.6e-35
WP_099775244.1|3273561_3274713_-|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	66.8	4.7e-129
WP_099775245.1|3274709_3276191_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	78.3	5.4e-226
WP_099775246.1|3276187_3276394_-	hypothetical protein	NA	A0A2H4JA19	uncultured_Caudovirales_phage	82.4	1.1e-23
WP_099775247.1|3276395_3278336_-|terminase	phage terminase large subunit family protein	terminase	A0A1B0Z2K0	Pseudomonas_phage	57.5	5.4e-210
WP_099775248.1|3278307_3278850_-|terminase	terminase small subunit	terminase	A0A1B0Z033	Pseudomonas_phage	53.3	2.6e-45
WP_099775249.1|3278955_3279273_-|holin	holin	holin	B5TK61	Pseudomonas_phage	41.7	7.1e-11
3279383:3279398	attL	AAAGCAAAAAGCCCGC	NA	NA	NA	NA
WP_099775250.1|3279497_3279986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099775251.1|3280045_3280387_-	antitermination protein Q	NA	A0A2D1GNB4	Pseudomonas_phage	79.5	3.9e-47
WP_099775252.1|3280396_3280714_-	hypothetical protein	NA	A0A2D1GNG3	Pseudomonas_phage	52.4	5.6e-24
WP_099775253.1|3280710_3282012_-|integrase	site-specific integrase	integrase	A0A2D1GND4	Pseudomonas_phage	56.5	7.0e-129
WP_099775254.1|3282008_3282437_-	VRR-NUC domain-containing protein	NA	A0A2D1GNH3	Pseudomonas_phage	69.2	1.2e-48
WP_099775255.1|3282433_3282730_-	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	69.5	1.1e-32
WP_099776717.1|3282726_3282918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099775256.1|3282926_3283595_-	replication P family protein	NA	A0A1B0YZY6	Pseudomonas_phage	45.0	6.1e-44
WP_099775257.1|3283591_3284359_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099776719.1|3284370_3285036_-	phage regulatory protein/antirepressor Ant	NA	A0A1B0YZY9	Pseudomonas_phage	53.9	3.5e-52
WP_099776721.1|3285179_3285797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099775258.1|3285932_3286118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099775259.1|3286136_3286337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099775260.1|3286370_3286610_-	hypothetical protein	NA	A0A2H4J0V8	uncultured_Caudovirales_phage	82.3	1.2e-29
WP_157767147.1|3286648_3287260_+	hypothetical protein	NA	A0A2H4IZH7	uncultured_Caudovirales_phage	70.7	4.1e-31
WP_099775262.1|3287237_3288113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099775263.1|3288109_3288985_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_099775264.1|3289612_3289819_+	hypothetical protein	NA	A0A0U4IJ22	Pseudomonas_phage	64.7	5.3e-23
WP_099775265.1|3289888_3290329_+	tellurite resistance TerB family protein	NA	Q1MVI3	Enterobacteria_phage	49.3	6.8e-28
WP_099775266.1|3290325_3290547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099775267.1|3290645_3290915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099775268.1|3290911_3291457_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099776723.1|3292239_3292725_+	DUF1566 domain-containing protein	NA	A0A0A0YR68	Pseudomonas_phage	47.1	1.5e-31
WP_099775269.1|3292790_3293405_+	DUF1566 domain-containing protein	NA	H2BDH2	Pseudomonas_virus	34.9	1.6e-19
WP_099775270.1|3293459_3293816_+	four helix bundle protein	NA	NA	NA	NA	NA
WP_099775271.1|3294017_3295172_+	reverse transcriptase	NA	A0A0N7AE80	Bacillus_phage	34.0	4.1e-48
WP_099775272.1|3295234_3295831_+	hypothetical protein	NA	A0A2I7RF87	Vibrio_phage	30.6	3.7e-16
WP_157767148.1|3295846_3296200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099775274.1|3296281_3298069_+	DNA cytosine methyltransferase	NA	Q5QF27	Pseudomonas_virus	57.8	5.7e-222
WP_099775275.1|3298153_3298648_+	hypothetical protein	NA	I2GUG5	Acinetobacter_phage	29.1	1.2e-07
WP_099775276.1|3298644_3298896_+	hypothetical protein	NA	A0A2H4J399	uncultured_Caudovirales_phage	89.2	2.3e-36
WP_099775277.1|3298892_3299195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099775278.1|3299191_3299470_+	hypothetical protein	NA	A0A2H4J0W8	uncultured_Caudovirales_phage	76.1	3.3e-36
WP_099775279.1|3299564_3299930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099775280.1|3300031_3300241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099775281.1|3300352_3300775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099775282.1|3300819_3301062_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_099775283.1|3301062_3302112_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	60.8	1.3e-109
WP_065760993.1|3302442_3303114_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	91.5	1.7e-107
WP_099775284.1|3303237_3304620_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	52.6	2.2e-27
WP_065760995.1|3304722_3305115_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	79.8	5.5e-53
3304674:3304689	attR	GCGGGCTTTTTGCTTT	NA	NA	NA	NA
WP_099775285.1|3305116_3305476_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	65.0	4.7e-35
WP_065760997.1|3305475_3305775_+	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	65.7	6.1e-28
WP_065760998.1|3305771_3306107_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	81.1	7.2e-46
WP_099775286.1|3306103_3307102_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	82.1	1.4e-158
WP_065761000.1|3307176_3308562_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_065761001.1|3308562_3309843_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.3	2.4e-97
WP_099775287.1|3309860_3310235_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	43.4	1.3e-08
WP_099775288.1|3310231_3311557_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	39.7	6.8e-79
WP_065761816.1|3311575_3312199_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_099775289.1|3312262_3314692_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	51.1	5.6e-87
>prophage 5
NZ_CP024478	Pseudomonas sp. HLS-6 chromosome, complete genome	5276694	3452442	3493616	5276694	head,integrase,terminase,tail,holin,lysis,protease	uncultured_Caudovirales_phage(69.44%)	52	3458083:3458099	3493780:3493796
WP_065761178.1|3452442_3453726_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.6	9.6e-139
WP_065761177.1|3453831_3454473_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	58.0	2.1e-57
WP_065761176.1|3454564_3455875_-	trigger factor	NA	NA	NA	NA	NA
WP_099775325.1|3456127_3456433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065760262.1|3456753_3457296_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_099775326.1|3457430_3457922_+	ATPase	NA	NA	NA	NA	NA
3458083:3458099	attL	TGGTGCGGACGAAGAGA	NA	NA	NA	NA
WP_099775327.1|3458227_3458608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099775328.1|3458604_3460242_-	hypothetical protein	NA	A0A2H4J3Z5	uncultured_Caudovirales_phage	50.3	2.2e-34
WP_099775329.1|3460266_3461895_-|terminase	phage terminase large subunit	terminase	A0A2H4JCA3	uncultured_Caudovirales_phage	88.9	2.4e-291
WP_065760230.1|3461884_3462223_-	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	89.3	5.8e-51
WP_099775330.1|3462224_3464768_-	hypothetical protein	NA	T1S9I6	Salmonella_phage	45.1	4.2e-202
WP_157767149.1|3464841_3465021_-	hypothetical protein	NA	A0A2D2W6B5	Pectobacterium_phage	55.6	2.4e-08
WP_157767150.1|3465094_3467014_-	hypothetical protein	NA	A0A2H4J9W0	uncultured_Caudovirales_phage	52.5	2.0e-164
WP_157767151.1|3467010_3469032_-	hypothetical protein	NA	A0A2H4JE92	uncultured_Caudovirales_phage	64.1	1.7e-246
WP_099775333.1|3469031_3469547_-	hypothetical protein	NA	A0A2H4J679	uncultured_Caudovirales_phage	61.2	6.6e-22
WP_065760235.1|3469549_3469993_-	GNAT family N-acetyltransferase	NA	A0A2H4J9Z5	uncultured_Caudovirales_phage	64.6	1.2e-48
WP_099776733.1|3470001_3472170_-	hypothetical protein	NA	A0A2H4J6H2	uncultured_Caudovirales_phage	70.4	7.5e-293
WP_099776731.1|3472169_3472751_-	hypothetical protein	NA	A0A2H4JCY7	uncultured_Caudovirales_phage	77.9	1.1e-81
WP_099775334.1|3472830_3473292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099775335.1|3473335_3474211_-	hypothetical protein	NA	A0A2H4JC66	uncultured_Caudovirales_phage	85.5	1.6e-137
WP_099775336.1|3474404_3475250_-	hypothetical protein	NA	A0A2H4JEQ5	uncultured_Caudovirales_phage	75.5	2.6e-108
WP_099775337.1|3475246_3475489_-	hypothetical protein	NA	A0A2C9CY14	Yersinia_phage	63.4	2.3e-17
WP_099776735.1|3475491_3475701_-	hypothetical protein	NA	A0A2H4JC55	uncultured_Caudovirales_phage	72.5	2.9e-21
WP_177442411.1|3475721_3477320_-|head,tail	head-tail connector protein	head,tail	A0A2H4J3N6	uncultured_Caudovirales_phage	84.9	2.2e-249
WP_099775339.1|3477316_3477523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099775340.1|3477527_3477959_-	hypothetical protein	NA	A0A2H4J6K8	uncultured_Caudovirales_phage	45.2	1.6e-21
WP_099775341.1|3478030_3478468_-|lysis	lysis protein	lysis	A0A2H4IZW4	uncultured_Caudovirales_phage	34.7	1.7e-07
WP_099775342.1|3478467_3478977_-	glycoside hydrolase family protein	NA	I6X6V3	Burkholderia_virus	59.2	2.4e-53
WP_099775343.1|3478973_3479225_-|holin	holin	holin	A0A0U1UNM6	Pseudomonas_phage	67.6	7.4e-19
WP_099775344.1|3479340_3479697_-	hypothetical protein	NA	A0A2H4JEE3	uncultured_Caudovirales_phage	75.9	5.9e-30
WP_099775345.1|3479677_3479968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065760247.1|3479964_3480408_-	RusA family crossover junction endodeoxyribonuclease	NA	J7I4J7	Pseudomonas_phage	68.3	4.0e-52
WP_099776736.1|3480400_3480970_-	hypothetical protein	NA	A0A2H4J903	uncultured_Caudovirales_phage	50.0	1.6e-37
WP_177442412.1|3480917_3481811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099775347.1|3481853_3482162_-	transcriptional regulator	NA	A0A2H4J960	uncultured_Caudovirales_phage	71.0	4.9e-33
WP_099776738.1|3482164_3482404_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JEY0	uncultured_Caudovirales_phage	79.5	1.4e-27
WP_099775348.1|3482521_3483154_+	helix-turn-helix domain-containing protein	NA	A0A2H4J6J6	uncultured_Caudovirales_phage	68.5	8.8e-77
WP_157767152.1|3484130_3484382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157767153.1|3484378_3484528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157767154.1|3484711_3484999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099775352.1|3484995_3485364_+	hypothetical protein	NA	A0A2H4J5P2	uncultured_Caudovirales_phage	51.2	5.0e-24
WP_099775353.1|3485488_3486250_+	hypothetical protein	NA	A0A2H4IZU8	uncultured_Caudovirales_phage	68.5	5.2e-92
WP_099775354.1|3486236_3487892_+	YqaJ viral recombinase family protein	NA	A0A2H4J6P1	uncultured_Caudovirales_phage	67.5	1.1e-155
WP_099775355.1|3487907_3488108_+	hypothetical protein	NA	J7I437	Pseudomonas_phage	60.3	3.7e-13
WP_099775356.1|3488117_3488948_+	cell division protein FtsK	NA	A0A2H4J7E6	uncultured_Caudovirales_phage	56.7	2.6e-76
WP_099775357.1|3489017_3489629_+	3'-5' exonuclease	NA	A0A2H4J7C9	uncultured_Caudovirales_phage	67.3	5.7e-73
WP_099775358.1|3489660_3489876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099775359.1|3489960_3490638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099775360.1|3490724_3491045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099775361.1|3491164_3492088_+	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_065761834.1|3492169_3492385_+	AlpA family phage regulatory protein	NA	B7SYF9	Stenotrophomonas_phage	50.0	3.1e-10
WP_099775362.1|3492389_3493616_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A0U1UNT3	Pseudomonas_phage	60.3	8.3e-132
3493780:3493796	attR	TGGTGCGGACGAAGAGA	NA	NA	NA	NA
>prophage 6
NZ_CP024478	Pseudomonas sp. HLS-6 chromosome, complete genome	5276694	4852004	4904174	5276694	head,integrase,terminase,tail,plate,holin,portal,capsid	Pseudomonas_phage(65.62%)	65	4873123:4873173	4904270:4904320
WP_099776084.1|4852004_4852952_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_177442455.1|4853018_4853867_+|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_065760218.1|4853863_4855042_+|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	36.8	2.9e-25
WP_065760219.1|4855088_4855859_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_007921811.1|4855869_4856607_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_065760220.1|4856649_4856910_-	DUF2164 domain-containing protein	NA	NA	NA	NA	NA
WP_065760221.1|4856909_4857548_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_010221320.1|4857547_4858141_-	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_099776088.1|4858328_4859987_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_099776090.1|4860210_4860618_+	aspartate 1-decarboxylase autocleavage activator PanM	NA	NA	NA	NA	NA
WP_099776092.1|4860709_4862947_+	AsmA family protein	NA	NA	NA	NA	NA
WP_065760225.1|4862943_4864011_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_065760226.1|4864007_4864280_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_176717483.1|4864827_4865724_+	polyphosphate kinase 2	NA	NA	NA	NA	NA
WP_065761809.1|4865825_4866269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099776096.1|4866522_4867920_-	GABA permease	NA	NA	NA	NA	NA
WP_099776098.1|4868520_4869294_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	4.2e-20
WP_065761806.1|4869307_4870060_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_099776100.1|4870116_4870812_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_065761804.1|4870808_4871498_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_099776102.1|4871478_4872744_+	methyltransferase	NA	NA	NA	NA	NA
4873123:4873173	attL	TGACTTGTAATCAGTAGGTCCCGGGTTCGATTCCTGGTGCCGGCACCATAC	NA	NA	NA	NA
WP_099776801.1|4873791_4874151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099776104.1|4874645_4874963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099776106.1|4875065_4876043_-	hypothetical protein	NA	A0A0U4IBV2	Pseudomonas_phage	67.6	9.6e-123
WP_099776107.1|4876015_4876726_-	hypothetical protein	NA	A0A2I7RNK1	Vibrio_phage	41.3	1.9e-40
WP_099776109.1|4876722_4877277_-	DNA-binding protein	NA	A0A0U4J942	Pseudomonas_phage	61.0	1.5e-51
WP_099776111.1|4877273_4878197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099776113.1|4878193_4878766_-	hypothetical protein	NA	A0A0U4JEJ6	Pseudomonas_phage	33.2	5.1e-15
WP_099776115.1|4878777_4880376_-|tail	phage tail protein	tail	A0A0U4K5K2	Pseudomonas_phage	58.9	1.9e-104
WP_099776116.1|4880385_4880910_-|tail	phage tail protein	tail	A0A0U4JVX3	Pseudomonas_phage	79.9	2.0e-79
WP_099776118.1|4880902_4882078_-|plate	baseplate J/gp47 family protein	plate	A0A0U4JJ14	Pseudomonas_phage	75.0	1.2e-164
WP_099776120.1|4882074_4882392_-	DUF2590 family protein	NA	A0A0U4B0N5	Pseudomonas_phage	79.4	5.8e-37
WP_099776122.1|4882388_4884497_-|tail	phage tail tape measure protein	tail	A0A0U4IJ81	Pseudomonas_phage	42.8	1.6e-130
WP_177442428.1|4884503_4884644_-	hypothetical protein	NA	A0A0U4B0S4	Pseudomonas_phage	67.4	5.7e-13
WP_099776123.1|4884667_4884958_-	hypothetical protein	NA	A0A0U4B0P2	Pseudomonas_phage	62.1	3.7e-22
WP_099776125.1|4884954_4885212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099776127.1|4885213_4885576_-	DUF1353 domain-containing protein	NA	M1PQ58	Synechococcus_phage	50.0	6.6e-29
WP_099776129.1|4885565_4885796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099776131.1|4885796_4886189_-	peptidase M15	NA	A0A218MM71	uncultured_virus	41.6	3.8e-22
WP_099776133.1|4886185_4886398_-	TraR/DksA C4-type zinc finger protein	NA	A0A0U4IIN4	Pseudomonas_phage	58.0	1.2e-14
WP_099776135.1|4886397_4886850_-	DUF2597 family protein	NA	A0A0U3TH58	Pseudomonas_phage	70.1	2.3e-55
WP_099776137.1|4886856_4887972_-	DUF2586 family protein	NA	A0A0U4KLE6	Pseudomonas_phage	69.5	1.8e-141
WP_099776138.1|4887982_4888663_-	phage virion morphogenesis protein	NA	A0A0U4ISN1	Pseudomonas_phage	61.7	2.3e-62
WP_099776140.1|4888652_4889096_-|tail	phage tail protein	tail	A0A0U4IBS7	Pseudomonas_phage	67.6	1.2e-51
WP_099776142.1|4889092_4889557_-|head	head completion/stabilization protein	head	A0A0U4J933	Pseudomonas_phage	57.0	1.1e-39
WP_099776144.1|4889656_4890472_-|terminase	terminase	terminase	A0A0U4JEJ1	Pseudomonas_phage	67.4	2.7e-78
WP_099776146.1|4890471_4891488_-|capsid	phage major capsid protein, P2 family	capsid	A0A0U4K5I9	Pseudomonas_phage	64.6	5.3e-116
WP_099776148.1|4891489_4892413_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0U4JVV6	Pseudomonas_phage	46.5	1.3e-60
WP_099776150.1|4892573_4894643_+|terminase	terminase	terminase	A0A0U4JIZ9	Pseudomonas_phage	70.4	4.8e-249
WP_099776151.1|4894563_4895439_+|portal	phage portal protein	portal	A0A0U4B0L9	Pseudomonas_phage	80.2	6.8e-104
WP_004576330.1|4895500_4895758_+	ogr/Delta-like zinc finger family protein	NA	R9TNQ2	Vibrio_phage	40.7	1.4e-12
WP_099776803.1|4896076_4896412_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	46.7	1.0e-15
WP_099776155.1|4896496_4896697_+	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	49.2	7.2e-09
WP_099776156.1|4896726_4897206_+	hypothetical protein	NA	Q9ZXJ2	Pseudomonas_virus	51.3	1.2e-33
WP_099776158.1|4897202_4897442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099776160.1|4897510_4897744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099776805.1|4897752_4900455_+	toprim domain-containing protein	NA	A0A2H4J936	uncultured_Caudovirales_phage	53.3	2.6e-279
WP_099776162.1|4900460_4900739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099776163.1|4900835_4901114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099776165.1|4901358_4901772_+	DUF2528 family protein	NA	NA	NA	NA	NA
WP_099776167.1|4901768_4902020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099776169.1|4902012_4902231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099776171.1|4902244_4902466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099776173.1|4902458_4902704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099776175.1|4903001_4904174_+|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	40.3	1.1e-75
4904270:4904320	attR	TGACTTGTAATCAGTAGGTCCCGGGTTCGATTCCTGGTGCCGGCACCATAC	NA	NA	NA	NA
>prophage 7
NZ_CP024478	Pseudomonas sp. HLS-6 chromosome, complete genome	5276694	5204362	5241840	5276694	transposase	Bacillus_phage(20.0%)	32	NA	NA
WP_099773594.1|5204362_5205793_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_099776438.1|5206108_5207758_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	35.2	3.6e-21
WP_099776440.1|5207750_5209436_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	23.2	2.2e-13
WP_099776442.1|5209419_5210421_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_099776444.1|5210422_5211823_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_099773211.1|5212126_5213662_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	46.7	5.9e-119
WP_145991801.1|5213723_5214050_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_079761861.1|5214055_5214373_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_099776446.1|5214561_5215119_+	DUF3365 domain-containing protein	NA	NA	NA	NA	NA
WP_065760708.1|5215111_5215381_+	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_099776448.1|5215422_5216838_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_099776450.1|5216936_5217581_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_099776453.1|5217866_5218406_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_099776455.1|5218429_5218810_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_099776457.1|5218820_5220587_-	sulfate permease	NA	A0A2H4J153	uncultured_Caudovirales_phage	22.3	9.2e-15
WP_099776459.1|5220583_5222326_-	TIGR01244 family phosphatase	NA	NA	NA	NA	NA
WP_099776461.1|5222336_5223200_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_099776463.1|5223788_5224397_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099776465.1|5224393_5225545_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_099776466.1|5225541_5226744_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_048607673.1|5226748_5227459_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	1.1e-32
WP_077566290.1|5227751_5229182_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_099776468.1|5229487_5230405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099776470.1|5230379_5231276_+	diguanylate cyclase	NA	G3MA91	Bacillus_virus	36.3	6.7e-22
WP_099776472.1|5231455_5232745_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.7	5.7e-14
WP_177442430.1|5232753_5235582_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_099775771.1|5235616_5236636_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.5	7.6e-46
WP_099776476.1|5236948_5237785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099776478.1|5237781_5238861_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	1.4e-45
WP_099776480.1|5238939_5239515_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_099773209.1|5239544_5240348_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	36.2	5.2e-34
WP_157767169.1|5240340_5241840_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
