The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021018	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6167 chromosome, complete genome	5179780	173636	225779	5179780	transposase,protease	Tupanvirus(13.33%)	50	NA	NA
WP_011345585.1|173636_174863_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_022559760.1|175042_175309_-	DksA/TraR family C4-type zinc finger protein	NA	A0A193GYU8	Escherichia_phage	55.7	3.5e-19
WP_022559761.1|175482_175737_+	DUF2789 domain-containing protein	NA	NA	NA	NA	NA
WP_003489471.1|175899_176073_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_007967352.1|176351_176981_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_080720778.1|177203_177338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005924809.1|177494_178595_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_022559762.1|178656_181497_-|protease	autotransporter serine protease	protease	A0A1V0SBG2	Catovirus	24.3	3.9e-07
WP_022559763.1|181653_182829_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_003489455.1|182951_183293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022559764.1|183521_183848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022559765.1|183955_185665_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.5	9.5e-17
WP_022559766.1|185903_186461_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_003489443.1|186457_186823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007967364.1|187061_188084_+	ligase-associated DNA damage response exonuclease	NA	NA	NA	NA	NA
WP_022559767.1|188080_188314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022559768.1|188310_189915_+	ATP-dependent DNA ligase	NA	A0A2H4JD86	uncultured_Caudovirales_phage	29.0	2.4e-09
WP_022559769.1|189911_192413_+	ligase-associated DNA damage response DEXH box helicase	NA	NA	NA	NA	NA
WP_022559770.1|192402_193047_+	ligase-associated DNA damage response endonuclease PdeM	NA	NA	NA	NA	NA
WP_039731582.1|193074_194346_-	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_003488188.1|194441_194648_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	70.1	9.3e-20
WP_003488190.1|194735_195488_-	S-methyl-5'-thioinosine phosphorylase	NA	NA	NA	NA	NA
WP_003488192.1|195570_196125_-	hypoxanthine-guanine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_022559772.1|196124_197129_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_022559773.1|197246_198824_-	cryptochrome/photolyase family protein	NA	E3T4R9	Cafeteria_roenbergensis_virus	28.0	6.9e-46
WP_033481246.1|199004_200039_-	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_033481244.1|200055_200739_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_022559776.1|200955_201453_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_033481243.1|201635_202970_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	27.2	5.0e-29
WP_022559778.1|203129_203852_+	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_022559779.1|204249_204972_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_022559780.1|205204_206104_-	GTPase Era	NA	NA	NA	NA	NA
WP_022559781.1|206100_206781_-	ribonuclease III	NA	A0A2K9L8W0	Tupanvirus	29.5	1.7e-17
WP_016850781.1|206770_207178_-	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_007970507.1|207178_207979_-	signal peptidase I	NA	NA	NA	NA	NA
WP_007967401.1|208076_209882_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.2	1.6e-22
WP_022559782.1|210049_211627_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.9	1.6e-26
WP_022559783.1|211736_212630_-	sigma-E factor negative regulatory protein	NA	NA	NA	NA	NA
WP_022559784.1|212626_213247_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_022559785.1|213482_215564_+	fatty acid oxidation complex, subunit alpha fadj protein	NA	NA	NA	NA	NA
WP_145958383.1|215689_215830_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_123766548.1|215839_216193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007975311.1|216309_217290_+|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_022558664.1|217545_217941_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_080720975.1|218042_219200_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003490678.1|219369_220047_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
WP_033481811.1|220072_220549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022558661.1|220735_221623_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	32.4	2.7e-31
WP_007962333.1|222119_224252_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_022557821.1|224795_225779_-|transposase	IS5-like element ISXfu1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
>prophage 2
NZ_CP021018	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6167 chromosome, complete genome	5179780	230384	295475	5179780	integrase,transposase	uncultured_virus(66.67%)	54	228271:228288	295543:295560
228271:228288	attL	TGGAGCGGGCGATGGGAA	NA	NA	NA	NA
WP_011345585.1|230384_231611_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_099868294.1|231904_235879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046735532.1|235912_236554_-	DUF1629 domain-containing protein	NA	NA	NA	NA	NA
WP_007975311.1|236721_237702_+|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_039732105.1|237983_238703_-	DUF1629 domain-containing protein	NA	NA	NA	NA	NA
WP_007975311.1|239372_240353_+|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_158526406.1|240538_240685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046831597.1|240681_241779_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_099868296.1|242995_244222_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_039732257.1|244460_246077_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_039732256.1|246413_247049_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_046831597.1|248279_249377_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_158526406.1|249373_249520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127459519.1|249516_250062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127459521.1|250242_250449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158526406.1|250840_250987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046831597.1|250983_252081_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_007975311.1|252210_253191_+|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_046735791.1|253280_253718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039732138.1|253858_254059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039732136.1|254128_254608_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_039732135.1|255003_255228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039732237.1|255514_256012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080954374.1|256048_256882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011345585.1|258302_259529_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_039731989.1|259588_262852_-	DNA helicase	NA	NA	NA	NA	NA
WP_099868299.1|262933_264031_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_158526406.1|264027_264174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040964980.1|265335_266883_+	histidine kinase	NA	NA	NA	NA	NA
WP_011038242.1|268040_268553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039731922.1|268584_269718_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_080954328.1|269735_270272_+	DUF4189 domain-containing protein	NA	NA	NA	NA	NA
WP_039731923.1|270634_271165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039731924.1|271161_271821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011345585.1|273138_274365_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_158526406.1|274432_274579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046831597.1|274575_275673_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_040965689.1|275972_276899_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_040965691.1|276891_277650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080954379.1|277875_278256_+	DUF3742 family protein	NA	NA	NA	NA	NA
WP_080954380.1|278275_279799_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_011345585.1|280506_281733_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_127459523.1|281895_282981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011345585.1|284452_285679_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_099868300.1|286654_287206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099868301.1|287228_288272_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_131701146.1|288278_289319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087942778.1|289497_289788_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046735771.1|289931_290684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046735770.1|290740_291055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046735773.1|291072_291429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099868302.1|291807_292026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080954370.1|292016_293732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046735768.1|293921_295475_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
295543:295560	attR	TGGAGCGGGCGATGGGAA	NA	NA	NA	NA
>prophage 3
NZ_CP021018	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6167 chromosome, complete genome	5179780	665571	677333	5179780		Enterobacteria_phage(37.5%)	11	NA	NA
WP_005913455.1|665571_666918_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	27.1	7.5e-33
WP_022559974.1|666964_668368_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.0	1.1e-47
WP_022559975.1|668642_669809_-	nucleotide sugar dehydrogenase	NA	M1HZB2	Paramecium_bursaria_Chlorella_virus	58.6	2.5e-117
WP_007962671.1|670149_671049_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.2	4.1e-27
WP_016851441.1|671045_671603_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.9	6.6e-44
WP_022559976.1|671599_672487_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	57.5	1.5e-93
WP_005913448.1|672538_673594_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.1	1.4e-82
WP_022559977.1|673813_674560_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_022559978.1|674559_675504_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_005920793.1|675667_676396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005913435.1|676376_677333_+	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	27.1	1.8e-25
>prophage 4
NZ_CP021018	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6167 chromosome, complete genome	5179780	1500536	1555237	5179780	transposase,tail	uncultured_virus(33.33%)	36	NA	NA
WP_011345585.1|1500536_1501763_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_022560433.1|1502479_1503181_-	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_039731347.1|1503167_1504637_-	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
WP_003489347.1|1504656_1505259_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	49.0	3.1e-47
WP_007964968.1|1505389_1505842_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016850515.1|1505930_1506149_+	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_080720931.1|1506133_1507078_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_039731353.1|1507074_1508535_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_022560436.1|1508531_1510850_+	FUSC family protein	NA	NA	NA	NA	NA
WP_007964975.1|1511100_1512462_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.1	1.9e-31
WP_007964977.1|1513214_1514117_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022560437.1|1514217_1515051_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_080720933.1|1515922_1517140_+	cardiolipin synthase B	NA	NA	NA	NA	NA
WP_007964984.1|1517163_1517691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022560440.1|1517961_1518168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022560441.1|1518154_1519261_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011345585.1|1519491_1520718_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_022560442.1|1521226_1522846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022560443.1|1522949_1523348_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_046121223.1|1524111_1524804_-	DUF2306 domain-containing protein	NA	NA	NA	NA	NA
WP_022560447.1|1524834_1525737_-	ribosomal large subunit pseudouridine synthase	NA	NA	NA	NA	NA
WP_022560449.1|1526069_1527647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080949419.1|1528123_1528963_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_046831597.1|1529004_1530102_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_158526406.1|1530098_1530245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022557821.1|1530658_1531642_+|transposase	IS5-like element ISXfu1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
WP_033481960.1|1532084_1532351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011345585.1|1533484_1534711_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_039731936.1|1534983_1536909_+	M61 family metallopeptidase	NA	NA	NA	NA	NA
WP_005912356.1|1537057_1537156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022560457.1|1537257_1538652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022560458.1|1539223_1541662_-	AAA family ATPase	NA	A0A0N9S864	Staphylococcus_phage	43.6	8.0e-09
WP_022560459.1|1541864_1545887_-	exodeoxyribonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	21.5	7.0e-10
WP_033481432.1|1545883_1549288_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_022560461.1|1549637_1554425_-	autotransporter domain-containing protein	NA	F5B3Z3	Synechococcus_phage	45.8	3.4e-19
WP_007968272.1|1554685_1555237_+|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 5
NZ_CP021018	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6167 chromosome, complete genome	5179780	1702011	1765448	5179780	transposase	uncultured_virus(37.5%)	49	NA	NA
WP_022557821.1|1702011_1702995_+|transposase	IS5-like element ISXfu1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
WP_046735561.1|1703554_1704190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033481371.1|1704385_1708093_+	indolepyruvate ferredoxin oxidoreductase family protein	NA	NA	NA	NA	NA
WP_033481376.1|1708190_1708460_-	DUF3253 domain-containing protein	NA	NA	NA	NA	NA
WP_022557825.1|1708475_1709462_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_022557826.1|1709458_1710748_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_007968110.1|1710813_1711995_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_022557827.1|1712256_1713729_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_022557828.1|1713725_1714463_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.6	5.2e-20
WP_033481377.1|1714511_1714859_-	calcium-dependent protein kinase 21	NA	NA	NA	NA	NA
WP_022557830.1|1714896_1716102_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_007974777.1|1716248_1717094_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.5	4.1e-05
WP_007968120.1|1717290_1718298_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_033481373.1|1718724_1719762_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_022557832.1|1720168_1722367_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_033481374.1|1722658_1723141_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_007968125.1|1723268_1724159_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_007968126.1|1724299_1724944_+	DUF4375 domain-containing protein	NA	NA	NA	NA	NA
WP_022557834.1|1725173_1726286_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003490465.1|1726834_1727491_-	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_007968128.1|1727654_1728410_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	NA	NA	NA	NA
WP_007968129.1|1728598_1729453_-	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_080720861.1|1730423_1731491_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_022557836.1|1731627_1733211_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_005912129.1|1733406_1734690_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_080720865.1|1734689_1735103_-	TRAP transporter small permease subunit	NA	NA	NA	NA	NA
WP_022557837.1|1735221_1736220_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_007968138.1|1736257_1737079_-	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_022557838.1|1737218_1738298_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_022557839.1|1738294_1739917_+	carboxylesterase/lipase family protein	NA	M1PNU1	Moumouvirus	32.5	8.7e-20
WP_022557840.1|1739961_1741110_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_022557841.1|1741177_1741672_-	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_039730948.1|1741859_1744043_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_022557843.1|1744054_1747405_-	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
WP_022557844.1|1747401_1750518_-	DUF3416 domain-containing protein	NA	NA	NA	NA	NA
WP_157768215.1|1750730_1750880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022557845.1|1751385_1751880_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_040965136.1|1751887_1752745_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_080720862.1|1752917_1753394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022557847.1|1753742_1754063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022557821.1|1754621_1755605_+|transposase	IS5-like element ISXfu1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
WP_080720993.1|1756194_1756578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099800727.1|1757992_1758346_-	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_011345585.1|1759100_1760327_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_145982140.1|1760289_1761081_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_022557849.1|1761124_1762351_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_046831597.1|1762910_1764008_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_158526406.1|1764004_1764151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011345585.1|1764221_1765448_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
>prophage 6
NZ_CP021018	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6167 chromosome, complete genome	5179780	1974088	2019097	5179780	transposase	Bacillus_phage(50.0%)	40	NA	NA
WP_046831597.1|1974088_1975186_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_080720684.1|1976367_1977045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022557975.1|1977306_1978194_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022557976.1|1978209_1979571_+	MFS transporter	NA	NA	NA	NA	NA
WP_007968372.1|1979590_1980019_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022557978.1|1980107_1981043_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_022557979.1|1981296_1982178_+	NAD-dependent protein deacetylase	NA	A0A068EPD4	Bacillus_phage	22.5	1.5e-13
WP_080720685.1|1982258_1983356_+	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_022557981.1|1983390_1984269_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_007968381.1|1984483_1984876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089096489.1|1985095_1985965_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_007968384.1|1986094_1986778_-	response regulator	NA	W8CYM9	Bacillus_phage	34.4	4.9e-33
WP_007968386.1|1986774_1988154_-	sensor histidine kinase efflux regulator BaeS	NA	W8CYF6	Bacillus_phage	27.4	3.7e-27
WP_022557983.1|1988314_1989538_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_022557984.1|1989547_1992697_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_040964425.1|1992696_1994136_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_022557986.1|1994348_1996307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033481087.1|1996730_1997624_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_046735699.1|1997732_1998398_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_007968399.1|1998397_1999312_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007975067.1|1999501_2000089_+	FMN reductase	NA	NA	NA	NA	NA
WP_022557989.1|2000251_2001235_+	DUF1852 domain-containing protein	NA	NA	NA	NA	NA
WP_033481088.1|2001263_2002292_+	methionine synthase	NA	NA	NA	NA	NA
WP_022557991.1|2002496_2003453_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_007968404.1|2003606_2005064_-	porin	NA	NA	NA	NA	NA
WP_022557992.1|2005894_2006773_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005920016.1|2006909_2007341_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_123766537.1|2007550_2007817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033481090.1|2007895_2008426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022557995.1|2008483_2008771_-	barnase inhibitor	NA	NA	NA	NA	NA
WP_007975311.1|2009135_2010116_-|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_022557996.1|2010354_2010786_-	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_158526406.1|2010816_2010963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046831597.1|2010959_2012057_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_022557997.1|2012538_2012922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011345585.1|2013363_2014590_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_033481992.1|2016004_2016334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158526406.1|2016746_2016893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046831597.1|2016889_2017987_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_007975311.1|2018116_2019097_+|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
>prophage 7
NZ_CP021018	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6167 chromosome, complete genome	5179780	2868970	2942300	5179780	transposase,protease	uncultured_virus(27.27%)	54	NA	NA
WP_011345585.1|2868970_2870197_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_158526406.1|2870581_2870728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046831597.1|2870724_2871822_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_127459439.1|2871829_2872267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011345585.1|2872622_2873849_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_007968992.1|2875110_2877180_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	41.0	1.8e-46
WP_005913896.1|2877186_2877507_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003483843.1|2877605_2878199_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_007968993.1|2878292_2878643_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_046735562.1|2878762_2879296_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_022558466.1|2879292_2881245_-	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_007968996.1|2881237_2882194_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_022558467.1|2882199_2883153_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_022558468.1|2883190_2885032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046121147.1|2885040_2886036_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_022558470.1|2886035_2887868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033481534.1|2888156_2888732_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_007969004.1|2888842_2889352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010368401.1|2889450_2889645_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_007969005.1|2889735_2890713_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_007969006.1|2890954_2891395_+	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
WP_022558472.1|2891673_2892618_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_007969008.1|2892700_2893444_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.5	9.9e-11
WP_002814322.1|2893648_2893888_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	5.9e-10
WP_022558473.1|2894029_2895265_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_022558474.1|2895430_2896786_+	aminodeoxychorismate synthase component I	NA	NA	NA	NA	NA
WP_033481536.1|2896846_2897920_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_022558476.1|2897916_2898876_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_003483889.1|2898872_2899226_+	type IV fimbriae assembly protein	NA	NA	NA	NA	NA
WP_039732060.1|2899856_2900183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033481538.1|2900415_2902017_-	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
WP_007970235.1|2902161_2903058_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_022558479.1|2903133_2904288_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_033481539.1|2904445_2907040_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_022558481.1|2907049_2907607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022558482.1|2907720_2908920_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_040964873.1|2909134_2911351_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_046121148.1|2911428_2912427_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_033481614.1|2913130_2918053_+	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_022559926.1|2918275_2921263_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_007962234.1|2921410_2922358_+	glycerophosphodiester phosphodiesterase family protein	NA	A0A0S2MYI4	Enterococcus_phage	36.0	3.8e-07
WP_033481616.1|2922762_2925183_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_003483923.1|2925530_2926091_-	bacterioferritin	NA	NA	NA	NA	NA
WP_003483924.1|2926133_2926616_-	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	38.3	7.0e-26
WP_022559923.1|2926778_2927255_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_003483926.1|2927666_2928566_+	DnaJ domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	28.0	7.0e-19
WP_005996155.1|2929062_2929449_+	response regulator	NA	W8CYM9	Bacillus_phage	31.8	5.6e-10
WP_007972198.1|2930147_2931275_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_007962453.1|2931274_2932138_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_022559922.1|2932360_2932825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005913957.1|2933387_2934680_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	38.4	5.8e-75
WP_007962497.1|2938441_2939155_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_022559919.1|2939225_2939816_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011345585.1|2941073_2942300_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
>prophage 8
NZ_CP021018	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6167 chromosome, complete genome	5179780	3079130	3161399	5179780	tRNA,transposase	uncultured_virus(27.27%)	58	NA	NA
WP_011345585.1|3079130_3080357_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_040965918.1|3081536_3081914_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_022559843.1|3082393_3083185_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_022559842.1|3084016_3085447_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_080720625.1|3085554_3087525_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	22.3	1.9e-16
WP_046735876.1|3087549_3089874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007967499.1|3090538_3091381_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_003484273.1|3091382_3091745_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_007967498.1|3091741_3092137_+	anti-sigma regulatory factor	NA	NA	NA	NA	NA
WP_080720624.1|3092139_3093138_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_007971628.1|3093134_3094007_+	histidine kinase	NA	A0A2K9L0Z8	Tupanvirus	29.1	1.4e-24
WP_022559837.1|3093996_3095946_+	response regulator	NA	NA	NA	NA	NA
WP_033480938.1|3098002_3100372_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_007967488.1|3100478_3100925_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	37.0	2.1e-08
WP_022559835.1|3101098_3101464_-	DUF1428 domain-containing protein	NA	NA	NA	NA	NA
WP_007967486.1|3101830_3102961_-	hybrid sensor histidine kinase/response regulator	NA	W8CYM9	Bacillus_phage	32.0	9.7e-10
WP_022559834.1|3102957_3103542_-	chemotaxis protein CheB	NA	NA	NA	NA	NA
WP_022559833.1|3103538_3104363_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_022559832.1|3104359_3107533_-	response regulator	NA	A0A1V0SGX0	Hokovirus	41.3	1.0e-32
WP_007971643.1|3107693_3108857_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_007967477.1|3108849_3109218_+	response regulator	NA	NA	NA	NA	NA
WP_011345585.1|3110203_3111430_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_007975311.1|3111904_3112885_-|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_039731183.1|3116879_3119501_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.7	7.5e-29
WP_007967453.1|3119778_3120393_+	DUF937 domain-containing protein	NA	NA	NA	NA	NA
WP_046735814.1|3120855_3123102_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_007967457.1|3123225_3123633_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_007967459.1|3123861_3124518_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_022559822.1|3124576_3125272_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_080720623.1|3125338_3125596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007971118.1|3125653_3127138_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_003484215.1|3127394_3127802_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_022559824.1|3127946_3128705_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_022559825.1|3128768_3129281_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003484223.1|3129324_3129582_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_022559826.1|3129679_3130477_-	aminotransferase class IV family protein	NA	NA	NA	NA	NA
WP_033480936.1|3130467_3131538_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_022559828.1|3132273_3133650_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_022559829.1|3134010_3134802_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_022559830.1|3135008_3136058_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_039732041.1|3136295_3137879_+	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
WP_011345585.1|3138909_3140136_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_033481713.1|3140242_3140509_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_022559798.1|3141048_3142977_+	alpha-L-fucosidase	NA	NA	NA	NA	NA
WP_033481711.1|3143144_3143498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022559797.1|3143735_3146300_-	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	27.3	1.1e-29
WP_022559796.1|3146296_3147508_-	arabinogalactan endo-1,4-beta-galactosidase	NA	NA	NA	NA	NA
WP_022559795.1|3147697_3150391_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_033481709.1|3150910_3152296_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_022559793.1|3152433_3153939_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_022559792.1|3153949_3155131_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_022559791.1|3155127_3155925_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_022559790.1|3155924_3157112_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_022559789.1|3157282_3158170_+	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_022559788.1|3158389_3159355_+	cation transporter	NA	NA	NA	NA	NA
WP_022559787.1|3159495_3159699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158526406.1|3160158_3160305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046831597.1|3160301_3161399_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP021018	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6167 chromosome, complete genome	5179780	3685310	3745861	5179780	tRNA,transposase,protease	Ralstonia_phage(20.0%)	46	NA	NA
WP_011345585.1|3685310_3686537_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_022558965.1|3686717_3687164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040091884.1|3687912_3689163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022558968.1|3689576_3690026_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_022558969.1|3690354_3691212_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	42.9	3.5e-12
WP_007962219.1|3691417_3692035_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_022558970.1|3692102_3694745_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	40.4	2.6e-175
WP_022558971.1|3695321_3695966_+	LPS transport and assembly outer membrane component LptE	NA	NA	NA	NA	NA
WP_007972617.1|3695988_3697017_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_022558972.1|3697013_3697883_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_022558973.1|3697939_3698353_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_022558974.1|3698509_3700045_-	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_003486825.1|3700166_3700637_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_022558975.1|3700713_3701391_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_099868325.1|3701701_3704812_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_007975311.1|3704988_3705969_-|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_022558977.1|3706319_3707054_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_022558978.1|3707192_3707765_+	Maf-like protein	NA	NA	NA	NA	NA
WP_040963676.1|3707765_3709265_+	ribonuclease G	NA	NA	NA	NA	NA
WP_039730929.1|3709405_3713326_+	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_033481058.1|3713341_3714094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022558981.1|3714191_3715637_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_022558982.1|3715893_3716472_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_007964779.1|3716619_3717987_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_033481068.1|3718087_3718555_+	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_022558984.1|3718624_3719713_-	secreted metallopeptidase	NA	NA	NA	NA	NA
WP_007970765.1|3720168_3721044_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_003486852.1|3721045_3721306_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_022558985.1|3721337_3722639_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_022558986.1|3723008_3724715_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_033481059.1|3724857_3726198_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_007964767.1|3726207_3727044_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_022558987.1|3727278_3727770_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_022558988.1|3727971_3728721_-	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
WP_022558989.1|3728830_3729373_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.2	1.6e-18
WP_007964764.1|3729482_3729962_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_022558990.1|3730193_3731438_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_022558991.1|3731445_3732696_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_039730924.1|3732692_3734063_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.0	1.4e-39
WP_033481069.1|3734649_3734946_+	cysteine methyltransferase	NA	NA	NA	NA	NA
WP_003486879.1|3734986_3735682_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_022558994.1|3735866_3737882_-	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_022558995.1|3738065_3740165_-	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	30.7	6.7e-73
WP_080949335.1|3740549_3742691_-	peptidase	NA	A0A1V0SHG2	Klosneuvirus	27.7	2.6e-72
WP_052756697.1|3743003_3744764_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_022557821.1|3744877_3745861_+|transposase	IS5-like element ISXfu1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
>prophage 10
NZ_CP021018	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6167 chromosome, complete genome	5179780	3841048	3897792	5179780	tRNA,transposase	uncultured_Mediterranean_phage(50.0%)	49	NA	NA
WP_046831597.1|3841048_3842146_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011345585.1|3842645_3843872_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_007962222.1|3844142_3846164_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_022559483.1|3847033_3847276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022559482.1|3847312_3848986_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_005914237.1|3849319_3849730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080720960.1|3849839_3850886_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_022559480.1|3850882_3851650_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_022559479.1|3851646_3852816_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_008571005.1|3852812_3853871_+	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
WP_096035591.1|3853921_3854764_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_011051714.1|3854820_3855231_+	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_005920266.1|3855223_3855535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022559476.1|3855636_3858090_+	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
WP_033481754.1|3858196_3858919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022559474.1|3859019_3860099_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_080720986.1|3860101_3860590_+	DUF4189 domain-containing protein	NA	NA	NA	NA	NA
WP_033481898.1|3860859_3861486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022559472.1|3861591_3862896_+	carboxypeptidase	NA	K4I3B7	Acinetobacter_phage	46.6	1.3e-18
WP_046121213.1|3863033_3863894_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_080949337.1|3863916_3864408_+	DUF4189 domain-containing protein	NA	NA	NA	NA	NA
WP_127459464.1|3864494_3864776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011345585.1|3864818_3866045_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_046831597.1|3866202_3867300_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_158526406.1|3867296_3867443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022559410.1|3867703_3869608_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.7	4.6e-113
WP_007970851.1|3869847_3870471_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_005917071.1|3870467_3870974_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	6.2e-25
WP_003489798.1|3871032_3871518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003489796.1|3871750_3872035_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.1e-18
WP_022559409.1|3872031_3873810_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_022559408.1|3874099_3875860_+	cellulase precursor	NA	NA	NA	NA	NA
WP_005931906.1|3876161_3876794_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_080720939.1|3876987_3879504_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_096035810.1|3879503_3880622_+	phytase	NA	NA	NA	NA	NA
WP_022559405.1|3880618_3881998_+	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_022559404.1|3882371_3883079_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_022559403.1|3883430_3884927_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_022559402.1|3885049_3885481_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_022559401.1|3885636_3886707_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_022559400.1|3886788_3887934_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.6	1.4e-85
WP_003489768.1|3888065_3888419_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_080954341.1|3888585_3890454_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_003489762.1|3890513_3891482_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	29.5	2.0e-27
WP_022559396.1|3892908_3893466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099868307.1|3893703_3894930_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_080954361.1|3894920_3895118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039731874.1|3895208_3895970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011345585.1|3896565_3897792_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
>prophage 11
NZ_CP021018	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6167 chromosome, complete genome	5179780	4275506	4287932	5179780		Xanthomonas_phage(92.31%)	17	NA	NA
WP_080949315.1|4275506_4276544_+	inovirus-type Gp2 protein	NA	A0A1D6ZIT9	Xanthomonas_phage	89.0	1.8e-183
WP_046735804.1|4276540_4276837_+	DNA-binding protein	NA	A0A1W6DXU2	Xanthomonas_phage	92.9	3.7e-46
WP_046735805.1|4277075_4277315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158526411.1|4277462_4278878_+	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	42.1	1.1e-53
WP_033483148.1|4278879_4279200_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_099800737.1|4279196_4280381_+	zonular occludens toxin family protein	NA	A0A1W6DXR3	Xanthomonas_phage	37.8	4.2e-56
WP_099868328.1|4280377_4281058_+	conjugal transfer protein	NA	A0A1W6DY89	Xanthomonas_phage	59.6	5.2e-67
WP_046832559.1|4281073_4281466_+	DUF4124 domain-containing protein	NA	A0A077JCA3	Xanthomonas_phage	60.0	7.2e-37
WP_046832560.1|4281502_4281841_-	phage-like protein	NA	Q38057	Xanthomonas_phage	77.7	7.3e-46
WP_046832561.1|4282023_4282350_+	hypothetical protein	NA	S0F2N2	Stenotrophomonas_phage	40.9	1.2e-16
WP_046735808.1|4282386_4283061_-	conjugal transfer protein	NA	A0A1W6DY89	Xanthomonas_phage	57.7	1.1e-66
WP_046735807.1|4283057_4284242_-	zonular occludens toxin family protein	NA	A0A1W6DXR3	Xanthomonas_phage	37.8	4.2e-56
WP_033483148.1|4284238_4284559_-	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_158526411.1|4284560_4285976_-	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	42.1	1.1e-53
WP_046735805.1|4286123_4286363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046735804.1|4286601_4286898_-	DNA-binding protein	NA	A0A1W6DXU2	Xanthomonas_phage	92.9	3.7e-46
WP_080949315.1|4286894_4287932_-	inovirus-type Gp2 protein	NA	A0A1D6ZIT9	Xanthomonas_phage	89.0	1.8e-183
>prophage 12
NZ_CP021018	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6167 chromosome, complete genome	5179780	4481815	4537796	5179780	tRNA,integrase,transposase	Ralstonia_phage(28.57%)	45	4481754:4481813	4535184:4536343
4481754:4481813	attL	GGAAGGTCTGATCAACTCACCACAGATGCGCGACACTACCGTCTCATGTAGAGGACTCAT	NA	NA	NA	NA
WP_007975311.1|4481815_4482796_+|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_022559447.1|4483027_4483216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046735358.1|4483223_4483874_+|integrase	site-specific integrase	integrase	K4PAZ9	Burkholderia_phage	52.0	8.0e-41
WP_007965965.1|4484142_4484679_+	lipocalin family protein	NA	A0A2I2L3Z7	Orpheovirus	33.1	9.0e-14
WP_007974695.1|4484790_4485267_+	LEA type 2 family protein	NA	NA	NA	NA	NA
WP_007965969.1|4485305_4487099_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_022559449.1|4487351_4488008_+	HNH endonuclease	NA	F5B475	Synechococcus_phage	40.2	3.0e-11
WP_033481506.1|4488441_4490358_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_022559451.1|4490393_4491650_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_007974702.1|4491639_4492251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022559453.1|4492228_4493383_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_022559454.1|4493373_4494333_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_022559455.1|4494329_4495178_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_033481497.1|4495177_4496176_-	3-oxoacyl-ACP synthase	NA	NA	NA	NA	NA
WP_007965982.1|4497483_4497945_-	cupin domain-containing protein	NA	A0A291AU44	Pandoravirus	41.5	1.8e-18
WP_080949397.1|4497979_4498771_-	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_007965984.1|4498778_4499573_-	polysaccharide pyruvyl transferase family protein	NA	A0A1V0SAR6	Catovirus	36.5	7.0e-23
WP_022559458.1|4499610_4500807_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_033481496.1|4500870_4502361_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_022559460.1|4502378_4503428_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_005920309.1|4503424_4504567_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_099770784.1|4504634_4505693_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_040964020.1|4505736_4506828_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_007965996.1|4506824_4508126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005920304.1|4508208_4509663_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_087945331.1|4509905_4511345_-	GumC family protein	NA	NA	NA	NA	NA
WP_011051691.1|4511326_4511968_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_005995911.1|4512633_4512990_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002811076.1|4512970_4513270_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	4.7e-12
WP_046735785.1|4513291_4515670_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_007974727.1|4515784_4516780_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	35.6	3.0e-31
WP_003484828.1|4517030_4517390_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_002811096.1|4517400_4517598_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_077708941.1|4517844_4518387_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	35.2	1.5e-13
WP_033481495.1|4518435_4520340_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.3	3.6e-126
WP_022559467.1|4520652_4521783_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.7	2.2e-14
WP_080954372.1|4521866_4523645_-	cyclomaltodextrin glucanotransferase	NA	NA	NA	NA	NA
WP_022559469.1|4523539_4525018_-	MFS transporter	NA	NA	NA	NA	NA
WP_022559470.1|4525014_4527201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040091930.1|4529837_4532612_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_099770788.1|4532707_4533689_+|transposase	IS5-like element ISXfu1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.2	9.7e-99
WP_022557821.1|4534082_4535066_+|transposase	IS5-like element ISXfu1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
WP_007975311.1|4535245_4536226_+|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_158526406.1|4536555_4536702_-	hypothetical protein	NA	NA	NA	NA	NA
4535184:4536343	attR	GGAAGGTCTGATCAACTCACCACAGATGCGCGACACTACCGTCTCATGTAGAGGACTCATCCATGCAGCTGACGTTCGGTGACGCTGAGGGCCTGGGCAAGCGTAAGCAGACCCGGCGCGAGATATTTCTGGCCGAGATGGAGCAGGTCGTTCCGTGGCAGCAACTGCTCGGGCTGATCGCGTTGCACTATCCTACGTCGGGGCGGCCAGGTCGGCAGCCGTACGCACTGGCGACGATGTTGCGGATTCATTTGCTGCAGCAATGGTATGCGTTGAGTGATCCGGCGATGGAAGAGGCATTGCACGAGATCCCGACCCTGCGGCGTTTTGCCCAGCTCGGCGGCTTGGACAACGTTCCAGACGAGACGACGATTCTCAACTTTCGCCGTCTGCTGGAAACCCACGGTATTGCCGCGCGGATGCTGGAAGCGGTCAACGCCCATTTGTCGCGCAAGGGTCAGAGCTTGCGGTCGGGCACGATCGTCGATGCGACGTTGATCGCTGCGCCCAGCTCAACCAAGAACGCCGATCGTGCGCGCGACCCTGAGATGCATCAGACCAAGAAAGGCAACCAGTGGTACTTCGGGATGAAGGCGCACATCGGGGTGGATGAGTTTTCCGGGCTGGTACACCACGTGCAGTGCACCGCAGCCAACGTGGCCGATGTCACGGTGACGCACGCATTGCTGCACGGGAAGGAAGGCAGCGTGTTCGGCGACAGCGGCTACACCGGTGCGGAAAAGCGCGACGAGCTACAGCGCTGCGAGGCTGCATTTTTCATTGCCGCCAAGCGCTCCACGATTCAGGCCATAGGCAACAAGCGCGAGCGTGCTGGGGCAGAACGTTGGGAACACTTCAAGGCCAGCGTGCGCGCAAAGGTGGAGCATCCATTCCGGGTGATCAAGCACCAGTTTGGCTACACCAAGGTCCGCTATCGCGGCTTGGCCAAGAACACCGCGCAGGTGCTGACGTTGTTTGCGCTGTCCAACCTGTGGATGAAGCGAAAGCAGTTACTGTCCGCTGCGGGGAGCGTGCGCCTGTGATCGGGAGATGATGTCCGGATCGCGCCGAAAATGGTGCAAATTCCGACTATTCAAACGCAGCTCCTTGGAGAAATGCACCTCCCGCGTCCTCAGCTCTCATTAATCAGACCATCCCTA	NA	NA	NA	NA
WP_046831597.1|4536698_4537796_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP021018	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6167 chromosome, complete genome	5179780	4541853	4618003	5179780	transposase	Ralstonia_phage(57.14%)	50	NA	NA
WP_099868296.1|4541853_4543080_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_046831597.1|4544296_4545394_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_158526406.1|4545390_4545537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123766566.1|4550012_4550519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039732259.1|4552677_4553082_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_022559416.1|4553278_4555654_-	glycoside hydrolase family 127 protein	NA	NA	NA	NA	NA
WP_096035582.1|4559189_4561535_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_022559419.1|4561850_4563437_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_022559420.1|4563433_4567792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033481662.1|4568190_4571007_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	26.2	5.0e-47
WP_123766567.1|4571264_4571465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022559422.1|4571478_4573836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022559423.1|4574300_4575872_+	S8/S53 family peptidase	NA	A0A1V0SLL0	Klosneuvirus	38.7	8.1e-71
WP_080720940.1|4577698_4577965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022559424.1|4577875_4578172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033481652.1|4578264_4579905_-	DUF5597 domain-containg protein	NA	NA	NA	NA	NA
WP_039731248.1|4579901_4582241_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_022559427.1|4582230_4583817_-	APC family permease	NA	NA	NA	NA	NA
WP_022559428.1|4583880_4585746_-	DUF885 family protein	NA	NA	NA	NA	NA
WP_022559429.1|4585742_4587560_-	DUF885 family protein	NA	NA	NA	NA	NA
WP_099868329.1|4587677_4588877_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_022559431.1|4588873_4590490_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_022559432.1|4590700_4591609_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_080720942.1|4591605_4592940_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_022559434.1|4592911_4593157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022559435.1|4593153_4594431_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_040964841.1|4594430_4595369_-	hydroxyproline-2-epimerase	NA	NA	NA	NA	NA
WP_080949360.1|4595529_4596246_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_033481654.1|4596451_4598062_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_022559439.1|4598408_4599482_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_008571381.1|4599505_4599781_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_007965960.1|4600156_4601779_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_022559440.1|4602110_4602569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005914053.1|4603001_4603202_+	general stress protein	NA	NA	NA	NA	NA
WP_005914051.1|4604446_4604722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046831597.1|4604856_4605954_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_158526406.1|4605950_4606097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033481656.1|4606619_4606883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007975311.1|4607110_4608091_-|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_022559443.1|4608226_4608784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127459505.1|4609348_4609882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131701847.1|4609996_4610191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007975311.1|4610267_4611248_+|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_099770788.1|4611430_4612412_+|transposase	IS5-like element ISXfu1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.2	9.7e-99
WP_131701139.1|4612709_4613075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046831597.1|4613722_4614820_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_158526406.1|4614816_4614963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007975311.1|4615025_4616006_+|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_158526406.1|4616762_4616909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046831597.1|4616905_4618003_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP021018	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6167 chromosome, complete genome	5179780	4780254	4863789	5179780	tRNA,transposase	uncultured_virus(25.0%)	52	NA	NA
WP_022559048.1|4780254_4781667_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	28.4	4.6e-41
WP_022559047.1|4781774_4782536_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_022559046.1|4782621_4783365_-	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_022559045.1|4783465_4784770_-	threonine synthase	NA	NA	NA	NA	NA
WP_046735556.1|4784931_4785246_+	EthD family reductase	NA	NA	NA	NA	NA
WP_046121197.1|4785320_4786295_-	homoserine kinase	NA	NA	NA	NA	NA
WP_022559042.1|4786336_4788844_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_022559040.1|4789530_4790031_-	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_011345585.1|4790802_4792029_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_046735824.1|4792019_4792310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046831597.1|4793016_4794114_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_046831597.1|4797392_4798490_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_022559037.1|4800666_4801017_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_123766554.1|4801385_4801772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123766553.1|4801948_4802356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127459511.1|4802352_4802850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011345585.1|4803879_4805106_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_158526406.1|4805395_4805542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033481602.1|4819259_4820960_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_033481600.1|4821691_4823650_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_022559032.1|4823631_4825530_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_022559031.1|4825533_4826787_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_022559030.1|4826783_4827230_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_022559029.1|4827814_4829347_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_033481610.1|4829927_4830212_+	DUF4190 domain-containing protein	NA	NA	NA	NA	NA
WP_022559026.1|4830208_4830982_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_007965740.1|4830987_4832043_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_022559025.1|4832039_4833092_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_099770954.1|4833127_4833997_+	DMT family transporter	NA	NA	NA	NA	NA
WP_022559023.1|4834140_4834845_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_022559022.1|4837166_4838432_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_080720948.1|4838634_4839864_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003481988.1|4839860_4840427_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_158526406.1|4840506_4840653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046831597.1|4840649_4841747_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_022559020.1|4841913_4842900_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_022559019.1|4843348_4845205_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_022559018.1|4845403_4846966_-	sodium/solute symporter	NA	A0A240F465	Aeromonas_phage	41.0	3.6e-87
WP_022559017.1|4847223_4849836_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_022559016.1|4850270_4852226_+	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_007965756.1|4852437_4853061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022559014.1|4853064_4853409_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_022559013.1|4853565_4855080_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_022559012.1|4855076_4855457_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_007965764.1|4855624_4856467_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_022559011.1|4856463_4857279_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	34.6	4.2e-31
WP_007965767.1|4857314_4857800_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_007965770.1|4857803_4859171_-	polynucleotide adenylyltransferase PcnB	NA	A0A1B1IVF3	uncultured_Mediterranean_phage	38.4	1.2e-25
WP_022559009.1|4859780_4860698_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_022559008.1|4860734_4861883_-	N-acetylmuramoyl-L-alanine amidase	NA	M1IEI0	Bacillus_phage	40.6	1.4e-08
WP_080720949.1|4862102_4862321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007975311.1|4862808_4863789_+|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
>prophage 15
NZ_CP021018	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6167 chromosome, complete genome	5179780	4909314	4920082	5179780	tRNA	uncultured_Caudovirales_phage(16.67%)	7	NA	NA
WP_033481262.1|4909314_4911273_-	PAS domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.0	1.6e-12
WP_003481884.1|4912581_4912794_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_022559538.1|4912933_4915582_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	40.0	1.7e-84
WP_007966764.1|4915683_4916172_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_003481871.1|4916469_4917504_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.3	5.1e-114
WP_007966767.1|4917676_4918318_-	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_022559539.1|4918405_4920082_-	2-polyprenylphenol 6-hydroxylase	NA	G8DDN0	Micromonas_pusilla_virus	29.7	1.1e-41
