The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018640	Salmonella enterica subsp. enterica serovar Enteritidis strain 70-1605, complete sequence	4679538	328741	337912	4679538	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569168.1|328741_329689_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
WP_000824854.1|329672_330404_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|330384_330492_-	protein YohO	NA	NA	NA	NA	NA
WP_001240421.1|330551_331283_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	1.7e-100
WP_000272845.1|331505_333191_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|333187_333907_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950414.1|333953_334421_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_001197951.1|334477_335008_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703145.1|335179_335638_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_000195340.1|335878_337912_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 2
NZ_CP018640	Salmonella enterica subsp. enterica serovar Enteritidis strain 70-1605, complete sequence	4679538	405109	415616	4679538		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001144948.1|405109_406513_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
WP_000981469.1|406690_407584_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697848.1|407960_409046_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023658.1|409045_409945_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857535.1|409992_410871_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|410871_411423_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000018223.1|411428_412403_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|412418_413192_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565913.1|413196_414276_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|414302_415616_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 3
NZ_CP018640	Salmonella enterica subsp. enterica serovar Enteritidis strain 70-1605, complete sequence	4679538	1067622	1083566	4679538	holin,tRNA	Escherichia_phage(62.5%)	21	NA	NA
WP_001082296.1|1067622_1068057_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
WP_000159240.1|1068106_1068445_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000802786.1|1069290_1069836_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	83.4	2.3e-89
WP_000445513.1|1069832_1070114_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.4	1.3e-16
WP_001688615.1|1070103_1070292_-	hypothetical protein	NA	Q8W636	Enterobacteria_phage	57.4	9.4e-11
WP_000900605.1|1070213_1070609_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	88.9	4.7e-44
WP_000640113.1|1072779_1073316_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
WP_000774470.1|1073312_1073603_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000940751.1|1073602_1074202_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000882662.1|1074725_1074938_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000556389.1|1075307_1076240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001033796.1|1076236_1076791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676916.1|1076952_1077282_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001227859.1|1077554_1078022_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_085981757.1|1078406_1078562_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_000004762.1|1078669_1079191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560208.1|1079628_1079850_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000800272.1|1079934_1080252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676915.1|1080279_1080897_+	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_001156217.1|1081213_1082149_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_000123686.1|1082192_1083566_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
>prophage 4
NZ_CP018640	Salmonella enterica subsp. enterica serovar Enteritidis strain 70-1605, complete sequence	4679538	1307998	1324113	4679538	lysis,holin,tail,integrase	Salmonella_phage(30.77%)	16	1304628:1304657	1324249:1324278
1304628:1304657	attL	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_072100756.1|1307998_1308862_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.9	9.0e-48
WP_001152416.1|1311502_1312198_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000877926.1|1312287_1312821_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001541990.1|1313715_1314195_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|1314212_1314665_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|1314648_1314978_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001574215.1|1315253_1315940_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_000798708.1|1316300_1316750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001574213.1|1317123_1317648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097218.1|1317744_1318434_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_000784710.1|1318563_1318791_-	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_000940753.1|1318787_1319387_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000972675.1|1319450_1319756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001237395.1|1320387_1322367_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_001575998.1|1322780_1323059_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_000087636.1|1323033_1324113_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
1324249:1324278	attR	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 5
NZ_CP018640	Salmonella enterica subsp. enterica serovar Enteritidis strain 70-1605, complete sequence	4679538	1496505	1537203	4679538	protease,tail	Salmonella_phage(28.57%)	40	NA	NA
WP_000938186.1|1496505_1497186_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	2.2e-81
WP_000374046.1|1497804_1498464_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904449.1|1498550_1498880_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|1498876_1499158_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548080.1|1499206_1499986_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|1500011_1500560_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140478.1|1500774_1501986_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|1502043_1502361_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975204.1|1502405_1502822_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|1502992_1503655_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|1503749_1504208_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|1504243_1506298_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|1506421_1506868_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950876.1|1506886_1509040_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|1509026_1509632_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288733.1|1509848_1510358_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|1510714_1511767_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|1511838_1512291_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156448.1|1512476_1514237_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|1514305_1514824_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|1514923_1515091_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|1515346_1515910_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|1515906_1517547_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333139.1|1517551_1518805_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|1518819_1520727_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|1520739_1522848_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224079.1|1522946_1524056_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001574119.1|1524052_1524595_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|1524760_1525771_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193790.1|1525978_1528591_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_000497441.1|1529017_1529209_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|1529479_1530166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|1530525_1531152_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001674638.1|1531799_1532768_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_072100753.1|1532993_1533242_+|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
WP_000143167.1|1533245_1533827_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_000583382.1|1533826_1535536_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
WP_000729406.1|1535532_1536159_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_000274547.1|1536142_1536772_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
WP_001676370.1|1536792_1537203_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	100.0	5.0e-33
>prophage 6
NZ_CP018640	Salmonella enterica subsp. enterica serovar Enteritidis strain 70-1605, complete sequence	4679538	1608482	1615795	4679538	protease,integrase	Ralstonia_phage(16.67%)	7	1603279:1603293	1614531:1614545
1603279:1603293	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_001539594.1|1608482_1608860_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
WP_001117984.1|1609021_1609219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|1609431_1611708_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|1611738_1612059_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|1612382_1612604_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125875.1|1612733_1614680_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
1614531:1614545	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
WP_001201751.1|1614676_1615795_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 7
NZ_CP018640	Salmonella enterica subsp. enterica serovar Enteritidis strain 70-1605, complete sequence	4679538	4436449	4503274	4679538	terminase,lysis,transposase,tRNA,plate,head,portal,integrase,capsid,tail	Salmonella_phage(91.3%)	64	4436733:4436747	4472697:4472711
WP_089113803.1|4436449_4437560_+|transposase	IS3-like element IS1351 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.6	7.6e-07
4436733:4436747	attL	TGAGCTGGTCACTCA	NA	NA	NA	NA
WP_000445376.1|4438356_4439160_-	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	44.7	1.2e-62
WP_001142974.1|4439558_4440152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000360326.1|4440413_4441076_-	hypothetical protein	NA	E5G6K9	Salmonella_phage	100.0	3.4e-124
WP_000218402.1|4441628_4442645_-|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	100.0	5.0e-199
WP_000932273.1|4442647_4443280_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	51.4	6.3e-59
WP_000102105.1|4443401_4443644_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_000460848.1|4443677_4444187_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	100.0	1.5e-87
WP_000956190.1|4444194_4444395_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	100.0	2.4e-33
WP_000963474.1|4444358_4444700_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	100.0	1.2e-56
WP_001244219.1|4444767_4445001_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	100.0	1.7e-33
WP_000752613.1|4445000_4445228_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000104187.1|4445224_4446082_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	100.0	6.8e-165
WP_000017507.1|4446078_4448493_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	100.0	0.0e+00
WP_001154433.1|4448645_4448834_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_001217571.1|4448844_4449078_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	1.8e-35
WP_001673609.1|4449191_4449869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284991.1|4450182_4451847_+	AIPR family protein	NA	E5G6M2	Salmonella_phage	100.0	0.0e+00
WP_001542203.1|4451950_4452991_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	100.0	5.5e-201
WP_001098395.1|4452990_4454757_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.1	0.0e+00
WP_000216276.1|4454899_4455733_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_000730759.1|4455749_4456811_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	100.0	2.1e-195
WP_000059173.1|4456814_4457465_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	100.0	4.9e-115
WP_000673537.1|4457558_4458023_+|head	head completion/stabilization protein	head	E5G6M8	Salmonella_phage	100.0	9.9e-86
WP_000868184.1|4458022_4458226_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171565.1|4458229_4458445_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_001069923.1|4458425_4458941_+	lysozyme	NA	E5G6N1	Salmonella_phage	100.0	5.3e-96
WP_000196199.1|4458937_4459366_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	100.0	2.3e-68
WP_001039958.1|4459461_4459893_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	100.0	1.7e-76
WP_000343949.1|4459885_4460332_+	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	99.3	2.3e-71
WP_000958562.1|4460333_4461185_-	hypothetical protein	NA	E5G6N5	Salmonella_phage	100.0	2.8e-163
WP_001672413.1|4461262_4461841_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	100.0	1.4e-108
WP_000189373.1|4461837_4462197_+|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	100.0	1.1e-60
WP_000268332.1|4462183_4463092_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	100.0	5.4e-160
WP_001086804.1|4463084_4463690_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	100.0	1.3e-117
WP_001274649.1|4463686_4465540_+|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	100.0	0.0e+00
WP_000143187.1|4465539_4466115_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	100.0	4.3e-107
WP_000974843.1|4466984_4467209_+	helix-turn-helix domain-containing protein	NA	E5G6P5	Salmonella_phage	100.0	1.5e-34
WP_000046108.1|4467311_4468484_+|tail	phage tail sheath protein	tail	E5G6P7	Salmonella_phage	100.0	8.9e-224
WP_001207651.1|4468493_4469009_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	100.0	9.3e-93
WP_001280963.1|4469063_4469366_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	100.0	1.5e-45
WP_000763316.1|4469380_4469500_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001282768.1|4469492_4472300_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.9	0.0e+00
WP_000980411.1|4472296_4472782_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	100.0	6.7e-77
4472697:4472711	attR	TGAGTGACCAGCTCA	NA	NA	NA	NA
WP_001102269.1|4472778_4473879_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	100.0	2.6e-201
WP_000980500.1|4473947_4474166_+	hypothetical protein	NA	E5G6Q4	Salmonella_phage	100.0	2.1e-38
WP_012543392.1|4474717_4475881_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000196151.1|4475888_4478069_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_000533863.1|4478065_4479475_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_001237694.1|4479539_4491014_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|4491628_4492111_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|4492260_4492737_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|4492726_4493017_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|4493182_4493521_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|4493669_4495331_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059151.1|4495416_4496295_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|4496418_4497009_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287926.1|4497043_4497649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|4497769_4499056_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|4499075_4499867_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|4500032_4501394_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|4501646_4501895_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|4501913_4502462_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469804.1|4502506_4503274_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 1
NZ_CP018641	Salmonella enterica subsp. enterica serovar Enteritidis strain 70-1605 plasmid pSE70-1605, complete sequence	59371	40257	47165	59371	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_001541564.1|40257_40674_+	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
WP_001527010.1|40857_41193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176303.1|41249_41855_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000728919.1|41851_42793_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.7	4.7e-74
WP_000427676.1|43207_44413_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_077681951.1|44409_45387_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.5	6.7e-84
WP_000457542.1|45468_46743_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.9e-156
WP_000925628.1|46742_47165_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.4	2.0e-29
