The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018642	Salmonella enterica subsp. enterica serovar Enteritidis strain 74-1357 chromosome, complete genome	4698044	233269	239883	4698044	tRNA	Escherichia_phage(57.14%)	9	NA	NA
WP_001676916.1|233269_233599_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001227859.1|233871_234339_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_085981757.1|234723_234879_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_069057667.1|234986_235508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560208.1|235945_236167_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000800272.1|236251_236569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676915.1|236596_237214_+	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_001156217.1|237530_238466_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_000123686.1|238509_239883_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
>prophage 2
NZ_CP018642	Salmonella enterica subsp. enterica serovar Enteritidis strain 74-1357 chromosome, complete genome	4698044	431180	478998	4698044	tail,lysis,integrase,protease,holin	Enterobacteria_phage(30.0%)	45	459513:459542	479134:479163
WP_000984498.1|431180_432062_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001091237.1|432256_434305_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
WP_000431401.1|434324_435011_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_000145727.1|435108_435693_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207294.1|435734_437018_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_157762879.1|436986_439620_+	PqiB family protein	NA	NA	NA	NA	NA
WP_001531515.1|439697_441137_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_000978525.1|441251_441491_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000457838.1|441601_441793_+	YebW family protein	NA	NA	NA	NA	NA
WP_000986173.1|441811_442462_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.9	7.2e-58
WP_001134856.1|442685_442850_-	membrane protein	NA	NA	NA	NA	NA
WP_000182071.1|443134_443857_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_000422882.1|444540_444936_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	9.2e-16
WP_000030934.1|445265_445742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001025515.1|446114_446534_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001576019.1|446906_447176_+	hypothetical protein	NA	B6SCX2	Bacteriophage	47.9	3.1e-07
WP_001576018.1|447341_447482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001233445.1|450619_451534_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000480735.1|451666_451825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848072.1|451834_452449_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_000457876.1|453583_453709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012543349.1|454277_454478_+	phage encoded PagK	NA	NA	NA	NA	NA
WP_000348541.1|457179_457671_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
WP_001576014.1|457725_457914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|457978_458146_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050883.1|458402_458936_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_074440854.1|459002_459386_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	37.4	2.7e-12
459513:459542	attL	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_001536069.1|460330_461131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099825807.1|461610_462333_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_072100756.1|462883_463747_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.9	9.0e-48
WP_001152416.1|466387_467083_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000877926.1|467172_467706_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001541990.1|468600_469080_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|469097_469550_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|469533_469863_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001574215.1|470138_470825_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_000798708.1|471185_471635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001574213.1|472008_472533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097218.1|472629_473319_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_000784710.1|473448_473676_-	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_000940753.1|473672_474272_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000972675.1|474335_474641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001237395.1|475272_477252_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_001575998.1|477665_477944_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_000087636.1|477918_478998_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
479134:479163	attR	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 3
NZ_CP018642	Salmonella enterica subsp. enterica serovar Enteritidis strain 74-1357 chromosome, complete genome	4698044	651391	692083	4698044	protease,tail	Salmonella_phage(28.57%)	40	NA	NA
WP_000938186.1|651391_652072_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	2.2e-81
WP_000374046.1|652690_653350_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904449.1|653436_653766_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|653762_654044_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548080.1|654092_654872_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|654897_655446_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140478.1|655660_656872_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|656929_657247_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975204.1|657291_657708_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|657878_658541_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|658635_659094_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|659129_661184_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|661307_661754_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_069057544.1|661772_663926_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|663912_664518_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288733.1|664734_665244_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|665600_666653_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|666724_667177_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156448.1|667362_669123_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|669191_669710_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|669809_669977_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|670232_670796_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|670792_672433_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333139.1|672437_673691_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|673705_675613_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|675625_677734_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224079.1|677832_678942_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001574119.1|678938_679481_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|679646_680657_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193790.1|680864_683477_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_000497441.1|683903_684095_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_031603423.1|685037_685337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|685405_686032_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001674638.1|686679_687648_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_072100753.1|687873_688122_+|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
WP_000143167.1|688125_688707_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_000583382.1|688706_690416_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
WP_099825831.1|690412_691039_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.2	1.6e-91
WP_000274547.1|691022_691652_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
WP_001676370.1|691672_692083_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	100.0	5.0e-33
>prophage 4
NZ_CP018642	Salmonella enterica subsp. enterica serovar Enteritidis strain 74-1357 chromosome, complete genome	4698044	763355	770668	4698044	protease,integrase	Ralstonia_phage(16.67%)	7	758152:758166	769404:769418
758152:758166	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_001539594.1|763355_763733_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
WP_001117984.1|763894_764092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|764304_766581_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|766611_766932_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|767255_767477_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125875.1|767606_769553_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
769404:769418	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
WP_001201751.1|769549_770668_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 5
NZ_CP018642	Salmonella enterica subsp. enterica serovar Enteritidis strain 74-1357 chromosome, complete genome	4698044	3616967	3669356	4698044	tail,tRNA,lysis,protease,holin	Salmonella_phage(34.78%)	50	NA	NA
WP_000469804.1|3616967_3617735_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|3617775_3618123_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030985.1|3618279_3619500_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_001212379.1|3619492_3620011_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|3620450_3621521_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_000225188.1|3621530_3622652_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000210984.1|3622709_3623618_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200077.1|3623578_3624739_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|3624838_3624886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178449.1|3624989_3625328_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197660.1|3625599_3626337_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|3626468_3627449_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992636.1|3627445_3628177_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235093.1|3628306_3630880_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.0e-127
WP_000985655.1|3636659_3637115_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	49.3	3.9e-34
WP_000807815.1|3637218_3638520_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.6	1.8e-44
WP_001264473.1|3638516_3638840_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949286.1|3638884_3640240_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082648.1|3640354_3643015_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000183642.1|3643068_3643749_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098733.1|3643821_3644241_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	39.0	5.9e-13
WP_000997368.1|3644444_3645482_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|3645597_3646287_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|3646605_3646989_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188410.1|3647050_3647638_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001675040.1|3647740_3648640_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|3648657_3649992_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083345.1|3650121_3650859_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989184.1|3650843_3652466_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_122038272.1|3652730_3652895_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|3652891_3653467_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|3653498_3654149_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|3654148_3655105_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589049.1|3655101_3655581_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000929791.1|3656543_3657146_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_001096550.1|3657354_3657966_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_099826037.1|3657962_3658103_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	9.4e-08
WP_001097241.1|3658099_3658777_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000211410.1|3659049_3659613_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_000657897.1|3660119_3660308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110783.1|3660522_3661209_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_001574216.1|3661484_3661814_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984581.1|3661797_3662250_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001533543.1|3662267_3662720_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|3662955_3663357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000447369.1|3664240_3664570_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_099826038.1|3664579_3665305_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	75.7	9.4e-91
WP_080094348.1|3665295_3665850_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.2	2.1e-74
WP_000593433.1|3667963_3668788_+|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|3668777_3669356_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
>prophage 6
NZ_CP018642	Salmonella enterica subsp. enterica serovar Enteritidis strain 74-1357 chromosome, complete genome	4698044	3897491	3903544	4698044		Salmonella_virus(50.0%)	6	NA	NA
WP_105789229.1|3897491_3897659_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	63.5	1.3e-11
WP_105789228.1|3897674_3897818_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
WP_099826056.1|3898807_3900730_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.2	8.1e-299
WP_000703599.1|3900747_3901002_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_001576268.1|3900970_3901360_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
WP_000377779.1|3902602_3903544_-	membrane protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
>prophage 7
NZ_CP018642	Salmonella enterica subsp. enterica serovar Enteritidis strain 74-1357 chromosome, complete genome	4698044	4139981	4149152	4698044	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569168.1|4139981_4140929_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
WP_000824854.1|4140912_4141644_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|4141624_4141732_-	protein YohO	NA	NA	NA	NA	NA
WP_001240421.1|4141791_4142523_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	1.7e-100
WP_000272845.1|4142745_4144431_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|4144427_4145147_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950414.1|4145193_4145661_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_069057571.1|4145717_4146248_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703145.1|4146419_4146878_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_000195340.1|4147118_4149152_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 8
NZ_CP018642	Salmonella enterica subsp. enterica serovar Enteritidis strain 74-1357 chromosome, complete genome	4698044	4216349	4226856	4698044		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001144951.1|4216349_4217753_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
WP_000981469.1|4217930_4218824_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|4219200_4220286_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023658.1|4220285_4221185_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857535.1|4221232_4222111_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|4222111_4222663_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000018223.1|4222668_4223643_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|4223658_4224432_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565913.1|4224436_4225516_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|4225542_4226856_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 9
NZ_CP018642	Salmonella enterica subsp. enterica serovar Enteritidis strain 74-1357 chromosome, complete genome	4698044	4448606	4466193	4698044	tRNA,capsid,plate,integrase,tail	Salmonella_phage(64.29%)	21	4452073:4452086	4460085:4460098
WP_000004540.1|4448606_4449713_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476069.1|4449766_4450228_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000825951.1|4450239_4450569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001249412.1|4450565_4451231_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444507.1|4451402_4452653_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.1e-19
4452073:4452086	attL	CCGTCACGCTGGTA	NA	NA	NA	NA
WP_069057638.1|4452753_4453896_-|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	79.7	4.5e-172
WP_000089141.1|4453885_4454122_-	excisionase	NA	NA	NA	NA	NA
WP_069057640.1|4454376_4455450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000765639.1|4455462_4456035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024134813.1|4456123_4456513_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	71.8	8.1e-41
WP_074440850.1|4456620_4458144_+|capsid	phage major capsid protein	capsid	A0A192Y5U9	Salmonella_phage	97.7	2.5e-234
WP_099826090.1|4458140_4459199_+|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	99.1	7.3e-201
WP_099826092.1|4459198_4459732_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	98.3	1.6e-95
WP_071646069.1|4459736_4460150_+	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	94.2	3.6e-71
4460085:4460098	attR	TACCAGCGTGACGG	NA	NA	NA	NA
WP_079972649.1|4460142_4461222_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	96.9	2.2e-200
WP_079972650.1|4461224_4461812_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	99.5	1.9e-113
WP_099826094.1|4461798_4462893_+|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	97.3	1.1e-55
WP_069057641.1|4462899_4463301_+|tail	phage tail protein	tail	A0A1B0V844	Salmonella_phage	83.3	3.4e-58
WP_079840644.1|4463583_4464591_-	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	89.6	1.7e-178
WP_069057643.1|4465055_4465727_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	4.5e-79
WP_001521673.1|4465980_4466193_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.5e-20
>prophage 1
NZ_CP018643	Salmonella enterica subsp. enterica serovar Enteritidis strain 74-1357 plasmid pSE74-1357, complete sequence	118824	67005	105699	118824	transposase	Salmonella_phage(38.46%)	38	NA	NA
WP_000959884.1|67005_67968_+	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
WP_001365718.1|67970_68321_+	protein stbB	NA	NA	NA	NA	NA
WP_001254203.1|68433_68727_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	95.5	1.7e-43
WP_001311056.1|68869_69352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113741.1|69468_70044_-	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	39.6	5.3e-28
WP_001138082.1|70087_72973_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.9	1.1e-190
WP_000904897.1|73098_73722_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
WP_085959879.1|73752_74881_+|transposase	IS3-like element IS1133 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.1	1.6e-52
WP_001082319.1|75013_75817_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|75816_76653_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001452736.1|76778_77090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000734776.1|77125_77440_-	IncN plasmid KikA protein	NA	NA	NA	NA	NA
WP_000504251.1|77402_77780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024129965.1|77795_78146_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_000033783.1|78209_78944_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_000440698.1|78952_79234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000209137.1|79243_79537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000496058.1|79586_79904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001200711.1|79903_82504_+	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
WP_000749362.1|82521_83235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734973.1|83242_83470_+	IncN-type entry exclusion lipoprotein EexN	NA	NA	NA	NA	NA
WP_000886022.1|83485_84526_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_000646594.1|84744_85443_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_001162874.1|85516_86338_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_000101711.1|86337_87498_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_000128596.1|87539_88535_+	Flp pilus assembly complex ATPase component	NA	NA	NA	NA	NA
WP_000731968.1|88534_89068_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	34.5	2.0e-21
WP_001351729.1|91502_91895_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|92032_92917_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|92948_94148_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_099826143.1|94226_94904_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|94935_95178_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001138014.1|95235_98202_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_001161490.1|98205_98766_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001323889.1|99075_100653_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
WP_000027057.1|100929_101790_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|101972_102530_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001143760.1|102693_105699_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
