The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018644	Salmonella enterica subsp. enterica serovar Enteritidis strain 77-2980, complete genome	4686089	666449	675857	4686089	transposase	Salmonella_phage(50.0%)	6	NA	NA
WP_001157751.1|666449_667169_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001253818.1|667165_668518_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	22.9	9.5e-12
WP_001138014.1|668697_671664_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_001161490.1|671667_672228_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001323889.1|672537_674115_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
WP_099844361.1|674267_675857_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.4	2.4e-139
>prophage 2
NZ_CP018644	Salmonella enterica subsp. enterica serovar Enteritidis strain 77-2980, complete genome	4686089	1413278	1480103	4686089	terminase,transposase,plate,portal,tRNA,integrase,lysis,head,tail,capsid	Salmonella_phage(91.3%)	64	1413562:1413576	1449526:1449540
WP_089113803.1|1413278_1414389_+|transposase	IS3-like element IS1351 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.6	7.6e-07
1413562:1413576	attL	TGAGCTGGTCACTCA	NA	NA	NA	NA
WP_000445376.1|1415185_1415989_-	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	44.7	1.2e-62
WP_001142974.1|1416387_1416981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000360326.1|1417242_1417905_-	hypothetical protein	NA	E5G6K9	Salmonella_phage	100.0	3.4e-124
WP_000218402.1|1418457_1419474_-|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	100.0	5.0e-199
WP_000932273.1|1419476_1420109_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	51.4	6.3e-59
WP_000102105.1|1420230_1420473_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_000460848.1|1420506_1421016_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	100.0	1.5e-87
WP_000956190.1|1421023_1421224_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	100.0	2.4e-33
WP_000963474.1|1421187_1421529_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	100.0	1.2e-56
WP_001244219.1|1421596_1421830_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	100.0	1.7e-33
WP_000752613.1|1421829_1422057_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000104187.1|1422053_1422911_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	100.0	6.8e-165
WP_000017507.1|1422907_1425322_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	100.0	0.0e+00
WP_001154433.1|1425474_1425663_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_001217571.1|1425673_1425907_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	1.8e-35
WP_001673609.1|1426020_1426698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284991.1|1427011_1428676_+	AIPR family protein	NA	E5G6M2	Salmonella_phage	100.0	0.0e+00
WP_001542203.1|1428779_1429820_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	100.0	5.5e-201
WP_001098395.1|1429819_1431586_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.1	0.0e+00
WP_000216276.1|1431728_1432562_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_000730759.1|1432578_1433640_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	100.0	2.1e-195
WP_000059173.1|1433643_1434294_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	100.0	4.9e-115
WP_000673537.1|1434387_1434852_+|head	head completion/stabilization protein	head	E5G6M8	Salmonella_phage	100.0	9.9e-86
WP_000868184.1|1434851_1435055_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171565.1|1435058_1435274_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_001069923.1|1435254_1435770_+	lysozyme	NA	E5G6N1	Salmonella_phage	100.0	5.3e-96
WP_000196199.1|1435766_1436195_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	100.0	2.3e-68
WP_001039958.1|1436290_1436722_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	100.0	1.7e-76
WP_000343949.1|1436714_1437161_+	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	99.3	2.3e-71
WP_000958562.1|1437162_1438014_-	hypothetical protein	NA	E5G6N5	Salmonella_phage	100.0	2.8e-163
WP_001672413.1|1438091_1438670_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	100.0	1.4e-108
WP_000189373.1|1438666_1439026_+|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	100.0	1.1e-60
WP_000268332.1|1439012_1439921_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	100.0	5.4e-160
WP_001086804.1|1439913_1440519_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	100.0	1.3e-117
WP_001274649.1|1440515_1442369_+|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	100.0	0.0e+00
WP_000143187.1|1442368_1442944_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	100.0	4.3e-107
WP_000974843.1|1443813_1444038_+	helix-turn-helix domain-containing protein	NA	E5G6P5	Salmonella_phage	100.0	1.5e-34
WP_000046108.1|1444140_1445313_+|tail	phage tail sheath protein	tail	E5G6P7	Salmonella_phage	100.0	8.9e-224
WP_001207651.1|1445322_1445838_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	100.0	9.3e-93
WP_001280963.1|1445892_1446195_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	100.0	1.5e-45
WP_000763316.1|1446209_1446329_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001282768.1|1446321_1449129_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.9	0.0e+00
WP_000980411.1|1449125_1449611_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	100.0	6.7e-77
1449526:1449540	attR	TGAGTGACCAGCTCA	NA	NA	NA	NA
WP_001102269.1|1449607_1450708_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	100.0	2.6e-201
WP_000980500.1|1450776_1450995_+	hypothetical protein	NA	E5G6Q4	Salmonella_phage	100.0	2.1e-38
WP_012543392.1|1451546_1452710_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000196151.1|1452717_1454898_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_000533863.1|1454894_1456304_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_001237694.1|1456368_1467843_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1468457_1468940_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1469089_1469566_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1469555_1469846_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1470011_1470350_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|1470498_1472160_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059151.1|1472245_1473124_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1473247_1473838_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287926.1|1473872_1474478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1474598_1475885_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1475904_1476696_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1476861_1478223_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1478475_1478724_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1478742_1479291_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469804.1|1479335_1480103_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP018644	Salmonella enterica subsp. enterica serovar Enteritidis strain 77-2980, complete genome	4686089	1985088	1994259	4686089	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569168.1|1985088_1986036_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
WP_000824854.1|1986019_1986751_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1986731_1986839_-	protein YohO	NA	NA	NA	NA	NA
WP_001240421.1|1986898_1987630_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	1.7e-100
WP_000272845.1|1987852_1989538_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1989534_1990254_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950414.1|1990300_1990768_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_001197951.1|1990824_1991355_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703145.1|1991526_1991985_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_000195340.1|1992225_1994259_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 4
NZ_CP018644	Salmonella enterica subsp. enterica serovar Enteritidis strain 77-2980, complete genome	4686089	2061451	2071957	4686089		Enterobacteria_phage(37.5%)	9	NA	NA
WP_001144948.1|2061451_2062855_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
WP_000981469.1|2063032_2063926_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697848.1|2064302_2065388_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023658.1|2065387_2066287_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857535.1|2066334_2067213_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|2067213_2067765_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000648783.1|2068759_2069533_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565913.1|2069537_2070617_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|2070643_2071957_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 5
NZ_CP018644	Salmonella enterica subsp. enterica serovar Enteritidis strain 77-2980, complete genome	4686089	2726498	2742441	4686089	holin,tRNA	Escherichia_phage(62.5%)	21	NA	NA
WP_001082296.1|2726498_2726933_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
WP_000159240.1|2726982_2727321_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000802786.1|2728166_2728712_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	83.4	2.3e-89
WP_000445513.1|2728708_2728990_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.4	1.3e-16
WP_001688615.1|2728979_2729168_-	hypothetical protein	NA	Q8W636	Enterobacteria_phage	57.4	9.4e-11
WP_000900605.1|2729089_2729485_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	88.9	4.7e-44
WP_000640113.1|2731654_2732191_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
WP_000774470.1|2732187_2732478_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000940751.1|2732477_2733077_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000882662.1|2733600_2733813_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000556389.1|2734182_2735115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001033796.1|2735111_2735666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676916.1|2735827_2736157_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001227859.1|2736429_2736897_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_085981757.1|2737281_2737437_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_000004762.1|2737544_2738066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560208.1|2738503_2738725_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000800272.1|2738809_2739127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676915.1|2739154_2739772_+	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_001156217.1|2740088_2741024_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_000123686.1|2741067_2742441_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
>prophage 6
NZ_CP018644	Salmonella enterica subsp. enterica serovar Enteritidis strain 77-2980, complete genome	4686089	2966872	2982985	4686089	lysis,tail,integrase,holin	Salmonella_phage(30.77%)	15	2963502:2963531	2983121:2983150
2963502:2963531	attL	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_072100756.1|2966872_2967736_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.9	9.0e-48
WP_001152416.1|2970375_2971071_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000877926.1|2971160_2971694_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001541990.1|2972588_2973068_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|2973085_2973538_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|2973521_2973851_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001574215.1|2974126_2974813_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_001574213.1|2975995_2976520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097218.1|2976616_2977306_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_000784710.1|2977435_2977663_-	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_000940753.1|2977659_2978259_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000972675.1|2978322_2978628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001237395.1|2979259_2981239_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_001575998.1|2981652_2981931_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_000087636.1|2981905_2982985_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
2983121:2983150	attR	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 7
NZ_CP018644	Salmonella enterica subsp. enterica serovar Enteritidis strain 77-2980, complete genome	4686089	3155363	3196057	4686089	tail,protease	Salmonella_phage(28.57%)	40	NA	NA
WP_000938186.1|3155363_3156044_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	2.2e-81
WP_000374046.1|3156662_3157322_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904449.1|3157408_3157738_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|3157734_3158016_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548080.1|3158064_3158844_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|3158869_3159418_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140478.1|3159632_3160844_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|3160901_3161219_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975204.1|3161263_3161680_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|3161850_3162513_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|3162607_3163066_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|3163101_3165156_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|3165279_3165726_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950876.1|3165744_3167898_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_000288733.1|3168705_3169215_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|3169571_3170624_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|3170695_3171148_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156448.1|3171332_3173093_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|3173161_3173680_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|3173779_3173947_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|3174202_3174766_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|3174762_3176403_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333139.1|3176407_3177661_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|3177675_3179583_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|3179595_3181704_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224079.1|3181802_3182912_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001574119.1|3182908_3183451_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|3183616_3184627_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193790.1|3184834_3187447_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_000497441.1|3187873_3188065_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|3188335_3189022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031610511.1|3189006_3189312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|3189380_3190007_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_016748023.1|3190654_3191533_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.3	2.4e-173
WP_072100753.1|3191847_3192096_+|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
WP_000143167.1|3192099_3192681_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_000583382.1|3192680_3194390_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
WP_000729406.1|3194386_3195013_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_000274547.1|3194996_3195626_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
WP_001676370.1|3195646_3196057_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	100.0	5.0e-33
>prophage 8
NZ_CP018644	Salmonella enterica subsp. enterica serovar Enteritidis strain 77-2980, complete genome	4686089	3267333	3274646	4686089	integrase,protease	Ralstonia_phage(16.67%)	7	3262130:3262144	3273382:3273396
3262130:3262144	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_001539594.1|3267333_3267711_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
WP_001117984.1|3267872_3268070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|3268282_3270559_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3270589_3270910_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3271233_3271455_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125875.1|3271584_3273531_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
3273382:3273396	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
WP_001201751.1|3273527_3274646_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
