The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018659	Salmonella enterica subsp. enterica serovar Enteritidis strain 93-0639 chromosome, complete genome	4679309	118643	134758	4679309	lysis,integrase,holin,tail	Salmonella_phage(30.77%)	16	118479:118508	138100:138129
118479:118508	attL	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
WP_000087636.1|118643_119723_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
WP_001575998.1|119697_119976_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_001237395.1|120389_122369_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_000972675.1|123000_123306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000940753.1|123369_123969_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000784710.1|123965_124193_+	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_001097218.1|124322_125012_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_001574213.1|125108_125633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798708.1|126006_126456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001574215.1|126816_127503_-	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_001574216.1|127778_128108_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|128091_128544_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|128561_129041_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000877926.1|129935_130469_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152416.1|130558_131254_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_072100756.1|133894_134758_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.9	9.0e-48
138100:138129	attR	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
>prophage 2
NZ_CP018659	Salmonella enterica subsp. enterica serovar Enteritidis strain 93-0639 chromosome, complete genome	4679309	358729	374672	4679309	tRNA,holin	Escherichia_phage(60.0%)	20	NA	NA
WP_000123686.1|358729_360103_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
WP_001156217.1|360146_361082_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_001676915.1|361398_362016_-	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_000800272.1|362043_362361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560208.1|362445_362667_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000004762.1|363104_363626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085981757.1|363733_363889_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_001227859.1|364273_364741_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_001033796.1|365503_366058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000556389.1|366054_366987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000882662.1|367356_367569_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000940751.1|368092_368692_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000774470.1|368691_368982_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000640113.1|368978_369515_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
WP_000900605.1|371685_372081_+	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	88.9	4.7e-44
WP_001688615.1|372002_372191_+	hypothetical protein	NA	Q8W636	Enterobacteria_phage	57.4	9.4e-11
WP_000445513.1|372180_372462_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.4	1.3e-16
WP_000802786.1|372458_373004_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	83.4	2.3e-89
WP_000159240.1|373849_374188_+	EamA family transporter	NA	NA	NA	NA	NA
WP_001082296.1|374237_374672_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
>prophage 3
NZ_CP018659	Salmonella enterica subsp. enterica serovar Enteritidis strain 93-0639 chromosome, complete genome	4679309	1026667	1037174	4679309		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|1026667_1027981_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565913.1|1028007_1029087_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000648783.1|1029091_1029865_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018223.1|1029880_1030855_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973709.1|1030860_1031412_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000857535.1|1031412_1032291_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_001023658.1|1032338_1033238_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000697848.1|1033237_1034323_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_000981469.1|1034699_1035593_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001144948.1|1035770_1037174_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
>prophage 4
NZ_CP018659	Salmonella enterica subsp. enterica serovar Enteritidis strain 93-0639 chromosome, complete genome	4679309	1104369	1113540	4679309	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195340.1|1104369_1106403_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
WP_000703145.1|1106643_1107102_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_001197951.1|1107273_1107804_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950414.1|1107860_1108328_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_000598637.1|1108374_1109094_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|1109090_1110776_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240421.1|1110998_1111730_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	1.7e-100
WP_001261696.1|1111789_1111897_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|1111877_1112609_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569168.1|1112592_1113540_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
>prophage 5
NZ_CP018659	Salmonella enterica subsp. enterica serovar Enteritidis strain 93-0639 chromosome, complete genome	4679309	1349967	1356027	4679309		Salmonella_virus(50.0%)	6	NA	NA
WP_000377779.1|1349967_1350909_+	membrane protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
WP_001576268.1|1352151_1352541_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
WP_000703599.1|1352509_1352764_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_000400616.1|1352781_1354704_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.3	5.6e-300
WP_105789228.1|1355693_1355837_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
WP_108630384.1|1355775_1356027_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	68.6	7.6e-08
>prophage 6
NZ_CP018659	Salmonella enterica subsp. enterica serovar Enteritidis strain 93-0639 chromosome, complete genome	4679309	1585411	1685354	4679309	tRNA,lysis,tail,capsid,head,integrase,transposase,terminase,plate,portal	Salmonella_phage(75.93%)	90	1603780:1603794	1684259:1684273
WP_000083345.1|1585411_1586149_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|1586278_1587613_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001675040.1|1587630_1588530_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188410.1|1588632_1589220_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|1589281_1589665_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|1589983_1590673_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|1590788_1591826_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098733.1|1592029_1592449_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	39.0	5.9e-13
WP_000183642.1|1592521_1593202_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082648.1|1593255_1595916_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949286.1|1596030_1597386_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001264473.1|1597430_1597754_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000807815.1|1597750_1599052_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.6	1.8e-44
WP_000985655.1|1599155_1599611_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	49.3	3.9e-34
1603780:1603794	attL	TTTGAGTTCCCGGCC	NA	NA	NA	NA
WP_001235093.1|1605386_1607960_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.0e-127
WP_000992636.1|1608089_1608821_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079130.1|1608817_1609798_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197660.1|1609929_1610667_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|1610938_1611277_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010989056.1|1611380_1611428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200077.1|1611527_1612688_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000210984.1|1612648_1613557_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225188.1|1613614_1614736_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|1614745_1615816_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212379.1|1616255_1616774_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030985.1|1616766_1617987_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_000065257.1|1618143_1618491_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469804.1|1618530_1619298_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|1619342_1619891_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|1619909_1620158_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|1620410_1621772_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|1621937_1622729_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|1622748_1624035_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001287926.1|1624155_1624761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|1624795_1625386_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059151.1|1625509_1626388_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|1626473_1628135_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|1628283_1628622_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|1628787_1629078_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|1629067_1629544_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|1629693_1630176_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237694.1|1630790_1642265_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533863.1|1642329_1643739_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196151.1|1643735_1645916_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_012543392.1|1645923_1647087_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000980500.1|1647638_1647857_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	100.0	2.1e-38
WP_001102269.1|1647925_1649026_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	100.0	2.6e-201
WP_000980411.1|1649022_1649508_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	100.0	6.7e-77
WP_001282768.1|1649504_1652312_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.9	0.0e+00
WP_000763316.1|1652304_1652424_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001280963.1|1652438_1652741_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	100.0	1.5e-45
WP_001207651.1|1652795_1653311_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	100.0	9.3e-93
WP_000046107.1|1653320_1654493_-|tail	phage tail sheath protein	tail	E5G6P7	Salmonella_phage	99.7	5.7e-223
WP_000974843.1|1654595_1654820_-	helix-turn-helix domain-containing protein	NA	E5G6P5	Salmonella_phage	100.0	1.5e-34
WP_000143187.1|1655689_1656265_-|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	100.0	4.3e-107
WP_001274649.1|1656264_1658118_-|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	100.0	0.0e+00
WP_001086804.1|1658114_1658720_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	100.0	1.3e-117
WP_000268332.1|1658712_1659621_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	100.0	5.4e-160
WP_000189373.1|1659607_1659967_-|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	100.0	1.1e-60
WP_001672413.1|1659963_1660542_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	100.0	1.4e-108
WP_000958562.1|1660619_1661471_+	hypothetical protein	NA	E5G6N5	Salmonella_phage	100.0	2.8e-163
WP_000343949.1|1661472_1661919_-	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	99.3	2.3e-71
WP_001039958.1|1661911_1662343_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	100.0	1.7e-76
WP_000196199.1|1662438_1662867_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	100.0	2.3e-68
WP_001069923.1|1662863_1663379_-	lysozyme	NA	E5G6N1	Salmonella_phage	100.0	5.3e-96
WP_000868184.1|1663577_1663781_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000673537.1|1663780_1664245_-|head	head completion/stabilization protein	head	E5G6M8	Salmonella_phage	100.0	9.9e-86
WP_000059173.1|1664338_1664989_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	100.0	4.9e-115
WP_000730760.1|1664992_1666054_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	99.7	6.0e-195
WP_000216276.1|1666070_1666904_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_001098395.1|1667046_1668813_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.1	0.0e+00
WP_001542203.1|1668812_1669853_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	100.0	5.5e-201
WP_001284991.1|1669956_1671621_-	AIPR family protein	NA	E5G6M2	Salmonella_phage	100.0	0.0e+00
WP_001673609.1|1671934_1672612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217571.1|1672725_1672959_-	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	1.8e-35
WP_001154433.1|1672969_1673158_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_000017507.1|1673310_1675725_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	100.0	0.0e+00
WP_000104187.1|1675721_1676579_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	100.0	6.8e-165
WP_000752613.1|1676575_1676803_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244219.1|1676802_1677036_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	100.0	1.7e-33
WP_000963474.1|1677103_1677445_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	100.0	1.2e-56
WP_000956190.1|1677408_1677609_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	100.0	2.4e-33
WP_000460848.1|1677616_1678126_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	100.0	1.5e-87
WP_000102105.1|1678159_1678402_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_000932273.1|1678523_1679156_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	51.4	6.3e-59
WP_000218402.1|1679158_1680175_+|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	100.0	5.0e-199
WP_000360326.1|1680727_1681390_+	hypothetical protein	NA	E5G6K9	Salmonella_phage	100.0	3.4e-124
WP_001142974.1|1681651_1682245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000445376.1|1682643_1683447_+	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	44.7	1.2e-62
WP_089113803.1|1684242_1685354_-|transposase	IS3-like element IS1351 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.6	7.6e-07
1684259:1684273	attR	TTTGAGTTCCCGGCC	NA	NA	NA	NA
>prophage 7
NZ_CP018659	Salmonella enterica subsp. enterica serovar Enteritidis strain 93-0639 chromosome, complete genome	4679309	4506277	4513590	4679309	protease,integrase	Dickeya_phage(16.67%)	7	4495015:4495029	4513808:4513822
4495015:4495029	attL	AGCCTGCGAGGAGAC	NA	NA	NA	NA
WP_001201751.1|4506277_4507396_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125875.1|4507392_4509339_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|4509468_4509690_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|4510013_4510334_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934059.1|4510364_4512641_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	1.4e-164
WP_001117984.1|4512853_4513051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001539594.1|4513212_4513590_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
4513808:4513822	attR	GTCTCCTCGCAGGCT	NA	NA	NA	NA
>prophage 8
NZ_CP018659	Salmonella enterica subsp. enterica serovar Enteritidis strain 93-0639 chromosome, complete genome	4679309	4564049	4625565	4679309	protease,tRNA,tail	Salmonella_phage(23.53%)	55	NA	NA
WP_001154025.1|4564049_4564853_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|4564845_4566168_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|4566148_4566853_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572746.1|4566852_4571319_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925870.1|4571663_4573514_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|4573773_4574322_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|4574349_4574997_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|4575058_4576249_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977709.1|4576433_4577525_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
WP_000117867.1|4578118_4579519_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.8	4.5e-81
WP_000762342.1|4579719_4580181_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544855.1|4580498_4581713_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893200.1|4581958_4583395_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191404.1|4583472_4584675_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001676370.1|4584869_4585280_-	enterohemolysin	NA	H6WRX0	Salmonella_phage	100.0	5.0e-33
WP_000274547.1|4585300_4585930_+	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
WP_000729406.1|4585913_4586540_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_000583382.1|4586536_4588246_+|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
WP_000143167.1|4588245_4588827_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_072100753.1|4588830_4589079_-|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
WP_016748023.1|4589393_4590272_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.3	2.4e-173
WP_000334547.1|4590919_4591546_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_031610511.1|4591614_4591920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|4591904_4592591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|4592861_4593053_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193790.1|4593479_4596092_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_000291723.1|4596299_4597310_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001574119.1|4597475_4598018_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224079.1|4598014_4599124_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|4599222_4601331_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|4601343_4603251_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333139.1|4603265_4604519_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|4604523_4606164_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|4606160_4606724_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|4606979_4607147_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|4607246_4607765_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156448.1|4607833_4609594_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|4609779_4610232_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|4610303_4611356_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288733.1|4611712_4612222_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|4612438_4613044_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950876.1|4613030_4615184_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|4615202_4615649_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|4615772_4617827_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|4617862_4618321_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|4618415_4619078_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000975204.1|4619248_4619665_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|4619709_4620027_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140478.1|4620084_4621296_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859416.1|4621510_4622059_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548080.1|4622084_4622864_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|4622912_4623194_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904449.1|4623190_4623520_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374046.1|4623606_4624266_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000938186.1|4624884_4625565_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	2.2e-81
>prophage 1
NZ_CP018660	Salmonella enterica subsp. enterica serovar Enteritidis strain 93-0639 plasmid pSE93-0639, complete sequence	59370	50136	57044	59370	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_001541564.1|50136_50553_+	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
WP_001527010.1|50736_51072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176303.1|51128_51734_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000728919.1|51730_52672_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.7	4.7e-74
WP_000427676.1|53086_54292_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_077681951.1|54288_55266_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.5	6.7e-84
WP_000457542.1|55347_56622_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.9e-156
WP_000925628.1|56621_57044_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.4	2.0e-29
