The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018661	Salmonella enterica subsp. enterica serovar Enteritidis strain 95-0621 chromosome, complete genome	4679622	67144	83088	4679622	tRNA,holin	Escherichia_phage(62.5%)	21	NA	NA
WP_001082296.1|67144_67579_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
WP_000159240.1|67628_67967_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000802786.1|68812_69358_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	83.4	2.3e-89
WP_000445513.1|69354_69636_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.4	1.3e-16
WP_001688615.1|69625_69814_-	hypothetical protein	NA	Q8W636	Enterobacteria_phage	57.4	9.4e-11
WP_000900605.1|69735_70131_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	88.9	4.7e-44
WP_000640113.1|72301_72838_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
WP_000774470.1|72834_73125_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000940751.1|73124_73724_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000882662.1|74247_74460_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000556389.1|74829_75762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001033796.1|75758_76313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676916.1|76474_76804_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001227859.1|77076_77544_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_085981757.1|77928_78084_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_000004762.1|78191_78713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560208.1|79150_79372_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000800272.1|79456_79774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676915.1|79801_80419_+	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_001156217.1|80735_81671_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_000123686.1|81714_83088_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
>prophage 2
NZ_CP018661	Salmonella enterica subsp. enterica serovar Enteritidis strain 95-0621 chromosome, complete genome	4679622	307520	323634	4679622	lysis,integrase,holin,tail	Salmonella_phage(30.77%)	16	304150:304179	323770:323799
304150:304179	attL	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_072100756.1|307520_308384_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.9	9.0e-48
WP_001152416.1|311023_311719_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000877926.1|311808_312342_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001541990.1|313236_313716_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|313733_314186_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|314169_314499_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001574215.1|314774_315461_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_000798708.1|315821_316271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001574213.1|316644_317169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097218.1|317265_317955_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_000784710.1|318084_318312_-	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_000940753.1|318308_318908_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000972675.1|318971_319277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001237395.1|319908_321888_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_001575998.1|322301_322580_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_000087636.1|322554_323634_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
323770:323799	attR	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 3
NZ_CP018661	Salmonella enterica subsp. enterica serovar Enteritidis strain 95-0621 chromosome, complete genome	4679622	496023	536720	4679622	tail,protease	Salmonella_phage(28.57%)	39	NA	NA
WP_000938186.1|496023_496704_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	2.2e-81
WP_000374046.1|497322_497982_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904449.1|498068_498398_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|498394_498676_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548080.1|498724_499504_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|499529_500078_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140478.1|500292_501504_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|501561_501879_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975204.1|501923_502340_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|502510_503173_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|503267_503726_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|503761_505816_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|505939_506386_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950876.1|506404_508558_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_000288733.1|509365_509875_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|510231_511284_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|511355_511808_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156448.1|511993_513754_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|513822_514341_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|514440_514608_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|514863_515427_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|515423_517064_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333139.1|517068_518322_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|518336_520244_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|520256_522365_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224079.1|522463_523573_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001574119.1|523569_524112_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|524277_525288_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193790.1|525495_528108_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_000497441.1|528534_528726_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|528996_529683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|530042_530669_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001674638.1|531316_532285_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_072100753.1|532510_532759_+|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
WP_000143167.1|532762_533344_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_000583382.1|533343_535053_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
WP_000729406.1|535049_535676_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_000274547.1|535659_536289_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
WP_001676370.1|536309_536720_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	100.0	5.0e-33
>prophage 4
NZ_CP018661	Salmonella enterica subsp. enterica serovar Enteritidis strain 95-0621 chromosome, complete genome	4679622	607997	615310	4679622	integrase,protease	Ralstonia_phage(16.67%)	7	602796:602810	614046:614060
602796:602810	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_001539594.1|607997_608375_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
WP_001117984.1|608536_608734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|608946_611223_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|611253_611574_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|611897_612119_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125875.1|612248_614195_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
614046:614060	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
WP_001201751.1|614191_615310_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 5
NZ_CP018661	Salmonella enterica subsp. enterica serovar Enteritidis strain 95-0621 chromosome, complete genome	4679622	3436056	3502881	4679622	transposase,terminase,lysis,portal,integrase,capsid,plate,tRNA,head,tail	Salmonella_phage(91.3%)	64	3436340:3436354	3472304:3472318
WP_089113803.1|3436056_3437167_+|transposase	IS3-like element IS1351 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.6	7.6e-07
3436340:3436354	attL	TGAGCTGGTCACTCA	NA	NA	NA	NA
WP_000445376.1|3437963_3438767_-	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	44.7	1.2e-62
WP_001142974.1|3439165_3439759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000360326.1|3440020_3440683_-	hypothetical protein	NA	E5G6K9	Salmonella_phage	100.0	3.4e-124
WP_000218402.1|3441235_3442252_-|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	100.0	5.0e-199
WP_000932273.1|3442254_3442887_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	51.4	6.3e-59
WP_000102105.1|3443008_3443251_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_000460848.1|3443284_3443794_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	100.0	1.5e-87
WP_000956190.1|3443801_3444002_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	100.0	2.4e-33
WP_000963474.1|3443965_3444307_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	100.0	1.2e-56
WP_001244219.1|3444374_3444608_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	100.0	1.7e-33
WP_000752613.1|3444607_3444835_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000104187.1|3444831_3445689_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	100.0	6.8e-165
WP_000017507.1|3445685_3448100_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	100.0	0.0e+00
WP_001154433.1|3448252_3448441_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_001217571.1|3448451_3448685_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	1.8e-35
WP_001673609.1|3448798_3449476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284991.1|3449789_3451454_+	AIPR family protein	NA	E5G6M2	Salmonella_phage	100.0	0.0e+00
WP_001542203.1|3451557_3452598_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	100.0	5.5e-201
WP_001098395.1|3452597_3454364_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.1	0.0e+00
WP_000216276.1|3454506_3455340_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_000730759.1|3455356_3456418_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	100.0	2.1e-195
WP_000059173.1|3456421_3457072_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	100.0	4.9e-115
WP_000673537.1|3457165_3457630_+|head	head completion/stabilization protein	head	E5G6M8	Salmonella_phage	100.0	9.9e-86
WP_000868184.1|3457629_3457833_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171565.1|3457836_3458052_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_001069923.1|3458032_3458548_+	lysozyme	NA	E5G6N1	Salmonella_phage	100.0	5.3e-96
WP_000196199.1|3458544_3458973_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	100.0	2.3e-68
WP_001039958.1|3459068_3459500_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	100.0	1.7e-76
WP_000343949.1|3459492_3459939_+	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	99.3	2.3e-71
WP_000958562.1|3459940_3460792_-	hypothetical protein	NA	E5G6N5	Salmonella_phage	100.0	2.8e-163
WP_001672413.1|3460869_3461448_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	100.0	1.4e-108
WP_000189373.1|3461444_3461804_+|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	100.0	1.1e-60
WP_000268332.1|3461790_3462699_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	100.0	5.4e-160
WP_001086804.1|3462691_3463297_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	100.0	1.3e-117
WP_001274649.1|3463293_3465147_+|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	100.0	0.0e+00
WP_000143187.1|3465146_3465722_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	100.0	4.3e-107
WP_000974843.1|3466591_3466816_+	helix-turn-helix domain-containing protein	NA	E5G6P5	Salmonella_phage	100.0	1.5e-34
WP_000046108.1|3466918_3468091_+|tail	phage tail sheath protein	tail	E5G6P7	Salmonella_phage	100.0	8.9e-224
WP_001207651.1|3468100_3468616_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	100.0	9.3e-93
WP_001280963.1|3468670_3468973_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	100.0	1.5e-45
WP_000763316.1|3468987_3469107_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001282768.1|3469099_3471907_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.9	0.0e+00
WP_000980411.1|3471903_3472389_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	100.0	6.7e-77
3472304:3472318	attR	TGAGTGACCAGCTCA	NA	NA	NA	NA
WP_001102269.1|3472385_3473486_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	100.0	2.6e-201
WP_000980500.1|3473554_3473773_+	hypothetical protein	NA	E5G6Q4	Salmonella_phage	100.0	2.1e-38
WP_012543392.1|3474324_3475488_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000196151.1|3475495_3477676_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_000533863.1|3477672_3479082_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_001237694.1|3479146_3490621_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|3491235_3491718_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|3491867_3492344_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|3492333_3492624_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|3492789_3493128_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|3493276_3494938_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059151.1|3495023_3495902_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|3496025_3496616_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287926.1|3496650_3497256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|3497376_3498663_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|3498682_3499474_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|3499639_3501001_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|3501253_3501502_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|3501520_3502069_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469804.1|3502113_3502881_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP018661	Salmonella enterica subsp. enterica serovar Enteritidis strain 95-0621 chromosome, complete genome	4679622	4007882	4017053	4679622	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569168.1|4007882_4008830_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
WP_000824854.1|4008813_4009545_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|4009525_4009633_-	protein YohO	NA	NA	NA	NA	NA
WP_001240421.1|4009692_4010424_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	1.7e-100
WP_000272845.1|4010646_4012332_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|4012328_4013048_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950414.1|4013094_4013562_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_001197951.1|4013618_4014149_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703145.1|4014320_4014779_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_000195340.1|4015019_4017053_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 7
NZ_CP018661	Salmonella enterica subsp. enterica serovar Enteritidis strain 95-0621 chromosome, complete genome	4679622	4084246	4094753	4679622		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001144948.1|4084246_4085650_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
WP_000981469.1|4085827_4086721_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697848.1|4087097_4088183_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023658.1|4088182_4089082_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857535.1|4089129_4090008_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|4090008_4090560_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000018223.1|4090565_4091540_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|4091555_4092329_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565913.1|4092333_4093413_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|4093439_4094753_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
