The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018633	Salmonella enterica subsp. enterica serovar Enteritidis strain 49-2444 chromosome, complete genome	4661885	2503295	2510608	4661885	integrase,protease	Dickeya_phage(16.67%)	7	2492032:2492047	2510826:2510841
2492032:2492047	attL	TAGCCTGCGAGGAGAC	NA	NA	NA	NA
WP_001201751.1|2503295_2504414_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125875.1|2504410_2506357_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|2506486_2506708_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|2507031_2507352_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934064.1|2507382_2509659_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_001117984.1|2509871_2510069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001539594.1|2510230_2510608_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
2510826:2510841	attR	GTCTCCTCGCAGGCTA	NA	NA	NA	NA
>prophage 2
NZ_CP018633	Salmonella enterica subsp. enterica serovar Enteritidis strain 49-2444 chromosome, complete genome	4661885	2561019	2622536	4661885	tRNA,tail,protease	Salmonella_phage(23.53%)	54	NA	NA
WP_001154025.1|2561019_2561823_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288833.1|2561815_2563138_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|2563118_2563823_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572746.1|2563822_2568289_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925870.1|2568633_2570484_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|2570743_2571292_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|2571319_2571967_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|2572028_2573219_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977709.1|2573403_2574495_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
WP_000117867.1|2575088_2576489_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.8	4.5e-81
WP_000762342.1|2576689_2577151_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544855.1|2577468_2578683_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893200.1|2578928_2580365_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191404.1|2580442_2581645_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001676370.1|2581839_2582250_-	enterohemolysin	NA	H6WRX0	Salmonella_phage	100.0	5.0e-33
WP_000274547.1|2582270_2582900_+	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
WP_000729406.1|2582883_2583510_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_000583383.1|2583506_2585216_+|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
WP_000143166.1|2585215_2585797_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.0	1.2e-93
WP_072100753.1|2585800_2586049_-|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
WP_001674638.1|2586274_2587243_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000334547.1|2587890_2588517_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001525490.1|2588876_2589563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|2589833_2590025_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193790.1|2590451_2593064_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_000291718.1|2593271_2594282_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001574119.1|2594447_2594990_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224079.1|2594986_2596096_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|2596194_2598303_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|2598315_2600223_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333138.1|2600237_2601491_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|2601495_2603136_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|2603132_2603696_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|2603950_2604118_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|2604217_2604736_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_080177874.1|2604804_2606565_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|2606750_2607203_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|2607274_2608327_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288733.1|2608683_2609193_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202372.1|2609409_2610015_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950873.1|2610001_2612155_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|2612173_2612620_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|2612743_2614798_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|2614833_2615292_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|2615386_2616049_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000975204.1|2616219_2616636_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|2616680_2616998_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140478.1|2617055_2618267_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859416.1|2618481_2619030_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548080.1|2619055_2619835_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000072880.1|2619883_2620165_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904449.1|2620161_2620491_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374046.1|2620577_2621237_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000938185.1|2621855_2622536_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	1.1e-80
>prophage 3
NZ_CP018633	Salmonella enterica subsp. enterica serovar Enteritidis strain 49-2444 chromosome, complete genome	4661885	2794928	2807539	4661885	holin,integrase,tail,lysis	Salmonella_phage(27.27%)	14	2794764:2794793	2814378:2814407
2794764:2794793	attL	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
WP_000087636.1|2794928_2796008_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
WP_001696937.1|2795982_2796261_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	38.6	1.6e-11
WP_001237394.1|2796674_2798654_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_000972676.1|2799285_2799591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000940753.1|2799654_2800254_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000784710.1|2800250_2800478_+	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_001097218.1|2800607_2801297_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_001574213.1|2801393_2801918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798708.1|2802291_2802741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001574215.1|2803101_2803788_-	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_001574216.1|2804063_2804393_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001541990.1|2804846_2805326_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000877926.1|2806220_2806754_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152416.1|2806843_2807539_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
2814378:2814407	attR	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
>prophage 4
NZ_CP018633	Salmonella enterica subsp. enterica serovar Enteritidis strain 49-2444 chromosome, complete genome	4661885	3764544	3773715	4661885	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195340.1|3764544_3766578_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
WP_000703145.1|3766818_3767277_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_001197951.1|3767448_3767979_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950417.1|3768035_3768503_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.0	1.3e-72
WP_000598637.1|3768549_3769269_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|3769265_3770951_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240421.1|3771173_3771905_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	1.7e-100
WP_001261696.1|3771964_3772072_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|3772052_3772784_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569168.1|3772767_3773715_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
>prophage 5
NZ_CP018633	Salmonella enterica subsp. enterica serovar Enteritidis strain 49-2444 chromosome, complete genome	4661885	4245603	4346208	4661885	portal,head,integrase,terminase,lysis,plate,transposase,tRNA,tail,capsid	Salmonella_phage(68.97%)	96	4330527:4330543	4354921:4354937
WP_000083345.1|4245603_4246341_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219180.1|4246470_4247805_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001675040.1|4247822_4248722_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188410.1|4248824_4249412_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|4249473_4249857_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|4250175_4250865_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|4250980_4252018_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098733.1|4252221_4252641_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	39.0	5.9e-13
WP_000183642.1|4252713_4253394_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082648.1|4253447_4256108_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949286.1|4256222_4257578_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001264471.1|4257622_4257946_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000807806.1|4257942_4259244_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	5.3e-44
WP_000985655.1|4259347_4259803_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	49.3	3.9e-34
WP_001235088.1|4265580_4268154_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	1.7e-126
WP_000992636.1|4268283_4269015_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079130.1|4269011_4269992_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197660.1|4270123_4270861_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_099800795.1|4271132_4271471_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010989056.1|4271574_4271622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200084.1|4271721_4272882_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000210984.1|4272842_4273751_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225188.1|4273808_4274930_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|4274939_4276010_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212379.1|4276449_4276968_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030985.1|4276960_4278181_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_000065257.1|4278337_4278685_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469804.1|4278725_4279493_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|4279537_4280086_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|4280104_4280353_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|4280605_4281967_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|4282132_4282924_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|4282943_4284230_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001287925.1|4284350_4284956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|4284990_4285581_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059151.1|4285704_4286583_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|4286668_4288330_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|4288478_4288817_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|4288982_4289273_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|4289262_4289739_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|4289888_4290371_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237695.1|4290985_4302451_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533863.1|4302515_4303925_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196154.1|4303921_4306102_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_012543392.1|4306109_4307273_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000980498.1|4307824_4308043_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
WP_001010545.1|4308111_4309212_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	97.5	3.8e-192
WP_000980418.1|4309208_4309694_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	98.5	2.4e-66
WP_099800796.1|4309690_4312498_-|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	99.5	0.0e+00
WP_000763317.1|4312490_4312610_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	8.8e-15
WP_001280962.1|4312624_4312927_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	100.0	2.5e-45
WP_001207653.1|4312981_4313497_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
WP_000046104.1|4313506_4314679_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	1.3e-222
WP_023972199.1|4314781_4315339_-	serine-type DNA invertase Fin	NA	A0A1S6L009	Salmonella_phage	98.4	3.6e-98
WP_001117078.1|4315367_4316387_+	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	92.9	1.1e-182
WP_001287104.1|4316393_4316801_+|tail	tail assembly protein	tail	A0A1B0V844	Salmonella_phage	85.2	6.7e-62
WP_077906433.1|4316804_4317422_-|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	84.6	3.1e-95
WP_080177824.1|4317391_4318966_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	60.7	4.8e-156
WP_001086803.1|4318962_4319568_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	99.0	2.2e-117
WP_000268329.1|4319560_4320469_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	98.7	5.0e-158
WP_000177404.1|4320455_4320815_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	95.8	9.8e-57
WP_000993749.1|4320811_4321390_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
WP_000343950.1|4321458_4321905_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	89.0	1.9e-65
WP_001039964.1|4321897_4322329_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	95.1	4.0e-73
WP_001648763.1|4322424_4322853_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	95.0	2.6e-64
WP_000871620.1|4322849_4323224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069920.1|4323228_4323738_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	98.8	6.4e-94
WP_000171565.1|4323718_4323934_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_000868184.1|4323937_4324141_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000673535.1|4324140_4324605_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	4.2e-84
WP_000059170.1|4324698_4325349_-|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	99.1	4.9e-115
WP_000742418.1|4325352_4326432_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	90.8	2.2e-181
WP_000216230.1|4326448_4327282_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	94.2	1.2e-126
WP_001697092.1|4327424_4329191_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	96.6	0.0e+00
WP_001697093.1|4329190_4329916_+	hypothetical protein	NA	E5FFI8	Burkholderia_phage	32.6	4.2e-22
WP_000044286.1|4329912_4330950_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.8	5.2e-175
4330527:4330543	attL	CAGCCATGCTGGCTTCA	NA	NA	NA	NA
WP_000109088.1|4331000_4332743_-	AIPR family protein	NA	NA	NA	NA	NA
WP_023134870.1|4333018_4333696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|4333809_4334043_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154433.1|4334053_4334242_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_001697094.1|4334394_4336824_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	91.8	0.0e+00
WP_000207698.1|4336814_4337672_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	80.7	1.2e-129
WP_000178747.1|4337668_4337965_-	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	45.5	1.5e-10
WP_000785511.1|4337961_4338189_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	89.3	7.3e-34
WP_001244235.1|4338188_4338422_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	97.4	1.4e-32
WP_000359661.1|4338524_4338674_-	DUF3927 domain-containing protein	NA	A0A0A0YRI9	Escherichia_phage	61.7	2.2e-07
WP_000863719.1|4338673_4339102_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	87.4	3.6e-58
WP_000963467.1|4339156_4339507_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	65.2	8.7e-34
WP_000956169.1|4339470_4339671_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	90.8	1.8e-28
WP_000460953.1|4339678_4340188_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	92.9	1.7e-83
WP_023222899.1|4340223_4340469_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	67.9	8.2e-23
WP_001256628.1|4340585_4341218_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	69.0	2.6e-81
WP_001697097.1|4341220_4342246_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	97.1	6.2e-197
WP_001142974.1|4342505_4343099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000445378.1|4343497_4344301_+	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	44.7	1.2e-62
WP_089113803.1|4345096_4346208_-|transposase	IS3-like element IS1351 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.6	7.6e-07
4354921:4354937	attR	CAGCCATGCTGGCTTCA	NA	NA	NA	NA
>prophage 1
NZ_CP018634	Salmonella enterica subsp. enterica serovar Enteritidis strain 49-2444 plasmid pSE49-2444, complete sequence	92831	9455	16363	92831	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_000925628.1|9455_9878_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.4	2.0e-29
WP_000457542.1|9877_11152_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.9e-156
WP_077681951.1|11233_12211_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.5	6.7e-84
WP_000427676.1|12207_13413_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000728919.1|13827_14769_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.7	4.7e-74
WP_000176303.1|14765_15371_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_099800803.1|15427_15763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541564.1|15946_16363_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
