The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018648	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1607 chromosome, complete genome	4688972	173870	189985	4688972	lysis,integrase,holin,tail	Salmonella_phage(30.77%)	16	170500:170529	190121:190150
170500:170529	attL	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_072100756.1|173870_174734_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.9	9.0e-48
WP_001152416.1|177374_178070_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000877926.1|178159_178693_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001541990.1|179587_180067_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|180084_180537_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|180520_180850_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001574215.1|181125_181812_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_000798708.1|182172_182622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001574213.1|182995_183520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097218.1|183616_184306_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_000784710.1|184435_184663_-	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_000940753.1|184659_185259_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000972675.1|185322_185628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001237395.1|186259_188239_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_001575998.1|188652_188931_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_000087636.1|188905_189985_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
190121:190150	attR	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 2
NZ_CP018648	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1607 chromosome, complete genome	4688972	362376	403074	4688972	protease,tail	Salmonella_phage(28.57%)	40	NA	NA
WP_000938186.1|362376_363057_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	2.2e-81
WP_000374046.1|363675_364335_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904449.1|364421_364751_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|364747_365029_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548080.1|365077_365857_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|365882_366431_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140478.1|366645_367857_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|367914_368232_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975204.1|368276_368693_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|368863_369526_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|369620_370079_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|370114_372169_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|372292_372739_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950876.1|372757_374911_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|374897_375503_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288733.1|375719_376229_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|376585_377638_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|377709_378162_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156448.1|378347_380108_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|380176_380695_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|380794_380962_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|381217_381781_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|381777_383418_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333139.1|383422_384676_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|384690_386598_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|386610_388719_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224079.1|388817_389927_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001574119.1|389923_390466_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|390631_391642_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193790.1|391849_394462_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_000497441.1|394888_395080_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|395350_396037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|396396_397023_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001674638.1|397670_398639_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_072100753.1|398864_399113_+|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
WP_000143167.1|399116_399698_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_000583382.1|399697_401407_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
WP_000729406.1|401403_402030_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_000274547.1|402013_402643_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
WP_001676370.1|402663_403074_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	100.0	5.0e-33
>prophage 3
NZ_CP018648	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1607 chromosome, complete genome	4688972	474353	481666	4688972	integrase,protease	Ralstonia_phage(16.67%)	7	469150:469164	480402:480416
469150:469164	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_001539594.1|474353_474731_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
WP_001117984.1|474892_475090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|475302_477579_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|477609_477930_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|478253_478475_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125875.1|478604_480551_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
480402:480416	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
WP_001201751.1|480547_481666_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 4
NZ_CP018648	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1607 chromosome, complete genome	4688972	1105071	1202452	4688972	terminase,tail,head,capsid,tRNA,plate,transposase,lysis,integrase,portal	Salmonella_phage(81.13%)	89	1120876:1120890	1201357:1201371
WP_001128274.1|1105071_1105815_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000367631.1|1105825_1106881_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_001670675.1|1107413_1108145_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	6.4e-39
WP_000917872.1|1108208_1108676_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	4.7e-51
WP_000801238.1|1108672_1109395_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052774.1|1109429_1110185_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644706.1|1110256_1111624_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	33.0	1.4e-10
WP_000207239.1|1111679_1112450_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230970.1|1112527_1113328_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_001127530.1|1113459_1114635_-	MFS transporter	NA	NA	NA	NA	NA
WP_000648524.1|1114739_1115654_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000154868.1|1115674_1116478_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.4	1.6e-38
1120876:1120890	attL	TTTGAGTTCCCGGCC	NA	NA	NA	NA
WP_001235093.1|1122482_1125056_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.0e-127
WP_000992636.1|1125185_1125917_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079130.1|1125913_1126894_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197660.1|1127025_1127763_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|1128034_1128373_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010989056.1|1128476_1128524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200077.1|1128623_1129784_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000210984.1|1129744_1130653_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225188.1|1130710_1131832_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|1131841_1132912_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212379.1|1133351_1133870_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030985.1|1133862_1135083_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_000065257.1|1135239_1135587_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469804.1|1135627_1136395_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|1136439_1136988_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|1137006_1137255_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|1137507_1138869_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|1139034_1139826_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|1139845_1141132_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001287926.1|1141252_1141858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|1141892_1142483_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059151.1|1142606_1143485_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|1143570_1145232_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|1145380_1145719_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|1145884_1146175_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|1146164_1146641_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|1146790_1147273_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237693.1|1147887_1159362_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533863.1|1159426_1160836_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196151.1|1160832_1163013_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_012543392.1|1163020_1164184_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000980500.1|1164735_1164954_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	100.0	2.1e-38
WP_001102269.1|1165022_1166123_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	100.0	2.6e-201
WP_000980411.1|1166119_1166605_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	100.0	6.7e-77
WP_001282768.1|1166601_1169409_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.9	0.0e+00
WP_000763316.1|1169401_1169521_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001280963.1|1169535_1169838_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	100.0	1.5e-45
WP_001207651.1|1169892_1170408_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	100.0	9.3e-93
WP_000046108.1|1170417_1171590_-|tail	phage tail sheath protein	tail	E5G6P7	Salmonella_phage	100.0	8.9e-224
WP_000974843.1|1171692_1171917_-	helix-turn-helix domain-containing protein	NA	E5G6P5	Salmonella_phage	100.0	1.5e-34
WP_000143187.1|1172786_1173362_-|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	100.0	4.3e-107
WP_001274649.1|1173361_1175215_-|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	100.0	0.0e+00
WP_001086804.1|1175211_1175817_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	100.0	1.3e-117
WP_000268332.1|1175809_1176718_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	100.0	5.4e-160
WP_000189373.1|1176704_1177064_-|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	100.0	1.1e-60
WP_001672413.1|1177060_1177639_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	100.0	1.4e-108
WP_000958562.1|1177716_1178568_+	hypothetical protein	NA	E5G6N5	Salmonella_phage	100.0	2.8e-163
WP_000343949.1|1178569_1179016_-	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	99.3	2.3e-71
WP_001039958.1|1179008_1179440_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	100.0	1.7e-76
WP_000196199.1|1179535_1179964_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	100.0	2.3e-68
WP_001069923.1|1179960_1180476_-	lysozyme	NA	E5G6N1	Salmonella_phage	100.0	5.3e-96
WP_000171565.1|1180456_1180672_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_000868184.1|1180675_1180879_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000673537.1|1180878_1181343_-|head	head completion/stabilization protein	head	E5G6M8	Salmonella_phage	100.0	9.9e-86
WP_000059173.1|1181436_1182087_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	100.0	4.9e-115
WP_000730759.1|1182090_1183152_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	100.0	2.1e-195
WP_000216276.1|1183168_1184002_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_001098395.1|1184144_1185911_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.1	0.0e+00
WP_001542203.1|1185910_1186951_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	100.0	5.5e-201
WP_001284991.1|1187054_1188719_-	AIPR family protein	NA	E5G6M2	Salmonella_phage	100.0	0.0e+00
WP_001673609.1|1189032_1189710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217571.1|1189823_1190057_-	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	1.8e-35
WP_001154433.1|1190067_1190256_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_000017507.1|1190408_1192823_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	100.0	0.0e+00
WP_000104187.1|1192819_1193677_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	100.0	6.8e-165
WP_000752613.1|1193673_1193901_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244219.1|1193900_1194134_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	100.0	1.7e-33
WP_000963474.1|1194201_1194543_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	100.0	1.2e-56
WP_000956190.1|1194506_1194707_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	100.0	2.4e-33
WP_000460848.1|1194714_1195224_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	100.0	1.5e-87
WP_000102105.1|1195257_1195500_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_000932273.1|1195621_1196254_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	51.4	6.3e-59
WP_000218402.1|1196256_1197273_+|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	100.0	5.0e-199
WP_000360326.1|1197825_1198488_+	hypothetical protein	NA	E5G6K9	Salmonella_phage	100.0	3.4e-124
WP_001142974.1|1198749_1199343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000445376.1|1199741_1200545_+	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	44.7	1.2e-62
WP_089113803.1|1201340_1202452_-|transposase	IS3-like element IS1351 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.6	7.6e-07
1201357:1201371	attR	TTTGAGTTCCCGGCC	NA	NA	NA	NA
>prophage 5
NZ_CP018648	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1607 chromosome, complete genome	4688972	3879126	3888297	4688972	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569168.1|3879126_3880074_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
WP_000824854.1|3880057_3880789_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|3880769_3880877_-	protein YohO	NA	NA	NA	NA	NA
WP_001240421.1|3880936_3881668_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	1.7e-100
WP_000272845.1|3881890_3883576_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|3883572_3884292_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950414.1|3884338_3884806_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_001197951.1|3884862_3885393_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703145.1|3885564_3886023_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_000195340.1|3886263_3888297_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 6
NZ_CP018648	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1607 chromosome, complete genome	4688972	3955494	3966001	4688972		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001144948.1|3955494_3956898_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
WP_000981469.1|3957075_3957969_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697848.1|3958345_3959431_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023658.1|3959430_3960330_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857535.1|3960377_3961256_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|3961256_3961808_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000018223.1|3961813_3962788_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|3962803_3963577_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565913.1|3963581_3964661_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|3964687_3966001_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 7
NZ_CP018648	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1607 chromosome, complete genome	4688972	4622705	4638649	4688972	tRNA,holin	Escherichia_phage(62.5%)	21	NA	NA
WP_001082296.1|4622705_4623140_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
WP_000159240.1|4623189_4623528_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000802786.1|4624373_4624919_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	83.4	2.3e-89
WP_000445513.1|4624915_4625197_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.4	1.3e-16
WP_001688615.1|4625186_4625375_-	hypothetical protein	NA	Q8W636	Enterobacteria_phage	57.4	9.4e-11
WP_000900605.1|4625296_4625692_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	88.9	4.7e-44
WP_000640113.1|4627862_4628399_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
WP_000774470.1|4628395_4628686_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000940751.1|4628685_4629285_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000882662.1|4629808_4630021_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000556389.1|4630390_4631323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001033796.1|4631319_4631874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676916.1|4632035_4632365_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001227859.1|4632637_4633105_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_085981757.1|4633489_4633645_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_000004762.1|4633752_4634274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560208.1|4634711_4634933_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000800272.1|4635017_4635335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676915.1|4635362_4635980_+	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_001156217.1|4636296_4637232_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_000123686.1|4637275_4638649_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
>prophage 1
NZ_CP018649	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1607 plasmid pSE81-1607-1, complete sequence	54541	4956	15420	54541	transposase	Salmonella_phage(50.0%)	6	NA	NA
WP_001138014.1|4956_7923_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_001161490.1|7926_8487_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001323889.1|8796_10374_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
WP_000027057.1|10650_11511_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|11693_12251_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001143760.1|12414_15420_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
>prophage 1
NZ_CP018650	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1607 plasmid pSE81-1607-2, complete sequence	59372	0	1063	59372		Stx_converting_phage(100.0%)	2	NA	NA
WP_015059604.1|462_624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000751876.1|676_1063_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	46.9	3.0e-27
>prophage 2
NZ_CP018650	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1607 plasmid pSE81-1607-2, complete sequence	59372	10631	11189	59372		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000725064.1|10631_11189_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	37.4	5.8e-24
>prophage 3
NZ_CP018650	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1607 plasmid pSE81-1607-2, complete sequence	59372	28373	35281	59372	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_000925628.1|28373_28796_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.4	2.0e-29
WP_000457542.1|28795_30070_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.9e-156
WP_077681951.1|30151_31129_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.5	6.7e-84
WP_000427676.1|31125_32331_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000728919.1|32745_33687_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.7	4.7e-74
WP_000176303.1|33683_34289_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001527010.1|34345_34681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541564.1|34864_35281_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
>prophage 4
NZ_CP018650	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1607 plasmid pSE81-1607-2, complete sequence	59372	38829	39390	59372		Ralstonia_phage(100.0%)	1	NA	NA
WP_001240330.1|38829_39390_+	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	43.2	1.5e-32
>prophage 5
NZ_CP018650	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1607 plasmid pSE81-1607-2, complete sequence	59372	44896	45061	59372		Salmonella_phage(100.0%)	1	NA	NA
WP_001576629.1|44896_45061_+	glycoside hydrolase family protein	NA	A0A0M4R365	Salmonella_phage	63.0	3.3e-12
>prophage 6
NZ_CP018650	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1607 plasmid pSE81-1607-2, complete sequence	59372	50003	50836	59372	transposase	Helicobacter_phage(50.0%)	2	NA	NA
WP_000064919.1|50003_50429_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	50.4	3.4e-24
WP_001541541.1|50485_50836_+	helix-turn-helix domain-containing protein	NA	A0A077SLN2	Escherichia_phage	80.5	1.9e-44
>prophage 7
NZ_CP018650	Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1607 plasmid pSE81-1607-2, complete sequence	59372	53896	54679	59372	integrase	Macacine_betaherpesvirus(100.0%)	1	50171:50182	56879:56890
50171:50182	attL	TATTTACCATCA	NA	NA	NA	NA
WP_000082169.1|53896_54679_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
WP_000082169.1|53896_54679_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
56879:56890	attR	TGATGGTAAATA	NA	NA	NA	NA
