The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024635	Lactobacillus brevis strain BDGP6 chromosome, complete genome	2785111	149542	241199	2785111	portal,terminase,protease,capsid,integrase,head,tail,tRNA	Lactobacillus_phage(52.17%)	115	164125:164142	206062:206079
WP_024526780.1|149542_150799_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.9	4.4e-136
WP_011668057.1|150979_151573_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_011668056.1|151575_151875_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A1S7FYY8	Listeria_phage	53.1	3.1e-24
WP_011668055.1|151915_152104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024526781.1|152261_154079_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_011668053.1|154166_155462_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_011668052.1|155508_156264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024526782.1|156278_156554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011668050.1|156726_157680_+	ribonuclease Z	NA	NA	NA	NA	NA
WP_021741138.1|157676_158066_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_024526784.1|158130_160452_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.7	1.8e-74
WP_015473849.1|160469_160988_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	42.1	1.7e-25
WP_011668046.1|161051_161507_-	universal stress protein	NA	NA	NA	NA	NA
WP_011668045.1|161544_161757_-	CsbD family protein	NA	NA	NA	NA	NA
WP_024526785.1|162106_162496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024526786.1|162492_163383_-	diacylglycerol kinase family lipid kinase	NA	NA	NA	NA	NA
WP_021741142.1|163601_164000_+	TIR domain-containing protein	NA	A0A2H4J496	uncultured_Caudovirales_phage	26.0	7.9e-07
164125:164142	attL	AAATCCTGTACTCTCCTT	NA	NA	NA	NA
WP_024525096.1|164381_165545_-|integrase	site-specific integrase	integrase	A0A0P0IXL3	Lactobacillus_phage	34.4	1.1e-56
WP_024525097.1|165711_166725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024525098.1|166784_167264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024525099.1|167267_167678_-	helix-turn-helix transcriptional regulator	NA	A0A0M4QX29	Bacillus_phage	36.4	4.0e-06
WP_024525100.1|167933_168209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024525101.1|168213_168435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035465645.1|168522_168714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024525103.1|168726_169479_+	antA/AntB antirepressor family protein	NA	A0A2D1GPQ2	Lactobacillus_phage	54.8	9.5e-70
WP_024525104.1|169491_169689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_191978615.1|169701_169857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_191978616.1|169853_170021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024525105.1|170080_170344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157771891.1|170403_170562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024525106.1|170558_171155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024525107.1|171172_171376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024525108.1|171485_171734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024525109.1|171736_172243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024525110.1|172256_172940_+	ERF family protein	NA	Q9G0C9	Lactococcus_phage	37.7	6.3e-20
WP_099962998.1|172932_173364_+	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	62.1	3.0e-44
WP_099962999.1|173379_174090_+	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	71.6	4.3e-96
WP_024525112.1|174064_174784_+	conserved phage C-terminal domain-containing protein	NA	Q8SDH3	Lactococcus_phage	42.4	1.3e-47
WP_024525113.1|174785_175556_+	ATP-binding protein	NA	E9LUN6	Lactobacillus_phage	53.3	2.4e-68
WP_024525114.1|175725_176106_+	hypothetical protein	NA	D6PSU8	Lactobacillus_phage	75.0	4.5e-28
WP_024525115.1|176544_177033_+	hypothetical protein	NA	A0A060ABA9	Staphylococcus_phage	35.5	1.2e-12
WP_024525116.1|177032_177443_+	hypothetical protein	NA	D6PSV5	Lactobacillus_phage	55.5	2.3e-33
WP_076025955.1|177438_177846_+	DUF1642 domain-containing protein	NA	A0A291I9M4	Lactobacillus_phage	49.3	1.8e-30
WP_024525118.1|177826_178018_+	hypothetical protein	NA	D6PSV7	Lactobacillus_phage	91.9	7.3e-27
WP_024525119.1|178048_178441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024525120.1|178473_178767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024525121.1|178785_179001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024525122.1|179136_179562_+	DUF722 domain-containing protein	NA	E9LUP5	Lactobacillus_phage	63.1	1.5e-48
WP_024525123.1|179875_180169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157771892.1|180514_180682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099963000.1|180662_181019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_191982949.1|181063_181534_+	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	81.4	8.3e-72
WP_099963002.1|181539_181851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099963003.1|182011_182470_+|terminase	phage terminase small subunit P27 family	terminase	E9LUP8	Lactobacillus_phage	94.1	8.9e-79
WP_024525129.1|182472_184371_+|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	92.4	0.0e+00
WP_024525130.1|184360_184558_+	DUF1056 family protein	NA	E9LUQ0	Lactobacillus_phage	63.1	2.7e-16
WP_099963004.1|184560_185715_+|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	78.5	5.5e-178
WP_099963150.1|185692_186418_+|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	68.7	1.6e-85
WP_099963005.1|186417_187641_+|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	82.3	1.5e-186
WP_024525134.1|187759_188233_+	fibronectin type III domain-containing protein	NA	A0A1I9KKT0	Lactobacillus_phage	58.7	1.8e-34
WP_024525135.1|188244_188571_+|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	56.5	4.2e-22
WP_024525136.1|188554_188911_+|head	phage head closure protein	head	E9LUQ5	Lactobacillus_phage	51.3	7.7e-30
WP_024525137.1|188903_189323_+	hypothetical protein	NA	A0A2P0ZLE6	Lactobacillus_phage	36.2	5.7e-16
WP_051345706.1|189309_189705_+	DUF806 family protein	NA	NA	NA	NA	NA
WP_099963006.1|189705_190323_+|tail	phage tail protein	tail	A0A0M7RF39	Lactobacillus_phage	50.0	1.9e-47
WP_024526694.1|190447_190816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024526695.1|190815_191028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099963007.1|191043_196059_+|tail	phage tail tape measure protein	tail	Q9AZS0	Lactococcus_phage	35.5	1.2e-104
WP_080662449.1|196045_198037_+|tail	phage tail family protein	tail	A0A1I9KK52	Lactobacillus_phage	27.3	1.6e-55
WP_024525143.1|198053_200660_+|tail	phage tail protein	tail	A0A2P0ZLF8	Lactobacillus_phage	30.5	2.7e-87
WP_024525144.1|200656_201727_+|tail	tail fiber domain-containing protein	tail	NA	NA	NA	NA
WP_024525145.1|201723_201963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099963151.1|202192_203605_+	collagen-like protein	NA	A0A0K1YA73	Cronobacter_phage	46.8	1.4e-05
WP_024525147.1|203619_203979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099963008.1|203980_204154_+	XkdX family protein	NA	NA	NA	NA	NA
WP_099963009.1|204211_204640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099963010.1|204632_205451_+	autolysin	NA	NA	NA	NA	NA
WP_024525151.1|205450_205723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024525152.1|206462_206900_+	hypothetical protein	NA	NA	NA	NA	NA
206062:206079	attR	AAATCCTGTACTCTCCTT	NA	NA	NA	NA
WP_011668040.1|207095_207302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024525153.1|207382_207847_-	nucleoside-diphosphate kinase	NA	L7Y4C4	Megavirus	46.3	3.5e-22
WP_015473842.1|207989_208172_-	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_024525154.1|208184_208847_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	31.3	5.5e-05
WP_024525155.1|209007_209889_+	polyphosphate kinase 2 family protein	NA	NA	NA	NA	NA
WP_099963011.1|210034_211204_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_024525157.1|211238_211829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021741150.1|212055_212496_+	nucleoside 2-deoxyribosyltransferase	NA	A0A1D3SPR3	Enterococcus_phage	37.9	5.8e-19
WP_024525158.1|212535_213165_-	transcriptional repressor LexA	NA	A0A0N9RTK0	Paenibacillus_phage	34.1	1.1e-07
WP_011668032.1|213348_213597_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_011668031.1|213696_213921_+	YneF family protein	NA	NA	NA	NA	NA
WP_024525159.1|214051_215812_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.2	1.7e-48
WP_024525160.1|215801_217595_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.4	8.7e-45
WP_099963012.1|217656_218298_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_024525161.1|218384_219140_+	methyltransferase	NA	NA	NA	NA	NA
WP_021741158.1|219126_219396_+	GIY-YIG nuclease family protein	NA	A0A0C5AS36	Spodoptera_frugiperda_granulovirus	37.1	8.5e-05
WP_024525162.1|219479_220478_+	D-2-hydroxyacid dehydrogenase	NA	M1H214	Paramecium_bursaria_Chlorella_virus	35.3	3.3e-46
WP_024525163.1|220599_221319_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011668024.1|221556_222360_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_011668023.1|222509_223394_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_011668022.1|223540_224263_+	UMP kinase	NA	NA	NA	NA	NA
WP_024525164.1|224259_224823_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_011668021.1|224849_225272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024525165.1|225374_226163_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.0	7.7e-22
WP_021741164.1|226184_226976_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_024525166.1|227071_228349_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_024525167.1|228384_230094_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_024525168.1|230186_234524_+	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	37.6	1.0e-19
WP_011668015.1|234724_235000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011668014.1|235126_235600_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_024525169.1|235623_236829_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_011668012.1|236855_237152_+	YlxR family protein	NA	NA	NA	NA	NA
WP_011668011.1|237144_237447_+	ribosomal L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_021741171.1|237494_239837_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.4	5.1e-21
WP_011668009.1|239856_240207_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_024525170.1|240287_241199_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP024635	Lactobacillus brevis strain BDGP6 chromosome, complete genome	2785111	254144	295651	2785111	portal,terminase,transposase,capsid,integrase,tail	Lactobacillus_phage(61.11%)	55	253849:253864	296791:296806
253849:253864	attL	TTAAGGCTTATCGTAA	NA	NA	NA	NA
WP_047021616.1|254144_255407_-|integrase	site-specific integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	43.1	4.2e-94
WP_024855609.1|255648_256512_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_024855610.1|256478_257534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024855612.1|258032_258392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099963015.1|258617_259607_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	40.2	3.4e-59
WP_024855614.1|259980_260202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024855615.1|260512_260767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021742306.1|260836_261658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024855617.1|261751_262165_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_024855618.1|262176_262545_-	helix-turn-helix transcriptional regulator	NA	A8ATX5	Listeria_phage	38.4	1.7e-08
WP_021742303.1|262711_262960_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024855619.1|263092_263278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024855620.1|263326_263551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099963016.1|263611_264166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024855622.1|264150_264414_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155249622.1|264426_264603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024855623.1|264712_265006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015474119.1|264996_265212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099963017.1|265212_266271_+	recombinase RecT	NA	D7RWF9	Brochothrix_phage	50.0	1.2e-57
WP_081277049.1|266197_267061_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	49.7	6.0e-76
WP_065201459.1|267072_268014_+	DUF4373 domain-containing protein	NA	D6PSU3	Lactobacillus_phage	78.9	1.6e-13
WP_099963018.1|268010_268709_+	antA/AntB antirepressor family protein	NA	U5U413	Lactobacillus_phage	43.7	1.4e-30
WP_099963019.1|268711_269128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099963020.1|269120_269591_+	DUF1642 domain-containing protein	NA	A0A2K9VD68	Lactobacillus_phage	44.5	6.2e-27
WP_191976637.1|269690_269855_+	hypothetical protein	NA	E9LUP2	Lactobacillus_phage	53.7	7.2e-07
WP_099963152.1|269871_270402_+	RusA family crossover junction endodeoxyribonuclease	NA	D6PSU4	Lactobacillus_phage	91.6	1.9e-64
WP_099963021.1|270517_270946_+	hypothetical protein	NA	D6PSU8	Lactobacillus_phage	62.2	8.4e-23
WP_099963022.1|271155_271638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099963023.1|271898_272465_+	hypothetical protein	NA	A8ASQ2	Listeria_phage	32.9	1.8e-17
WP_099963024.1|273542_274400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099963025.1|274383_274878_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_043022761.1|274953_275400_-	universal stress protein	NA	NA	NA	NA	NA
WP_157771893.1|275555_276029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099963026.1|276436_276697_+	hypothetical protein	NA	D6PSW7	Lactobacillus_phage	88.2	4.6e-32
WP_099963027.1|276709_277021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024855636.1|277049_277295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024855637.1|277306_277864_+	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_024855638.1|277948_278779_+	hypothetical protein	NA	D2J000	Enterococcus_phage	39.3	3.2e-34
WP_065201450.1|278775_280284_+|terminase	phage terminase large subunit	terminase	A5GYP8	Lactococcus_phage	51.7	3.3e-130
WP_024855640.1|280301_281933_+|portal	phage portal protein	portal	A0A0A1ER87	Lactobacillus_phage	30.9	2.8e-42
WP_024855641.1|281932_282862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099963028.1|282874_283378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065201449.1|283389_283770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065201448.1|283782_284940_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_024855645.1|285022_285526_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_024855646.1|285541_285721_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_065201447.1|285732_286071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139588298.1|286196_286682_+	hypothetical protein	NA	D6PSY0	Lactobacillus_phage	45.2	6.8e-29
WP_099963029.1|286674_287064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065201446.1|287050_287539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024855651.1|287522_288668_+	DUF3383 family protein	NA	NA	NA	NA	NA
WP_024855652.1|288683_289097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099963030.1|289142_289574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157771894.1|289623_289782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024855654.1|289774_295651_+|tail	phage tail tape measure protein	tail	D6PSZ2	Lactobacillus_phage	64.1	1.5e-61
296791:296806	attR	TTAAGGCTTATCGTAA	NA	NA	NA	NA
>prophage 3
NZ_CP024635	Lactobacillus brevis strain BDGP6 chromosome, complete genome	2785111	375413	384668	2785111	tRNA	Staphylococcus_phage(42.86%)	9	NA	NA
WP_011667553.1|375413_375689_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	68.5	3.1e-26
WP_024525208.1|375794_377054_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_042254316.1|377171_378068_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	38.8	1.6e-52
WP_021741844.1|378243_379437_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	G3MAR3	Bacillus_virus	39.3	2.1e-34
WP_021741845.1|379465_381358_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	29.5	1.2e-49
WP_021741846.1|381369_382320_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	62.1	2.0e-117
WP_011667559.1|382335_382827_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	37.2	5.7e-23
WP_011667560.1|383006_383648_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_021741848.1|383816_384668_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	33.6	5.8e-15
>prophage 4
NZ_CP024635	Lactobacillus brevis strain BDGP6 chromosome, complete genome	2785111	656513	707357	2785111	portal,plate,terminase,capsid,integrase,tail,tRNA	Lactobacillus_phage(38.1%)	56	665180:665193	712673:712686
WP_021742344.1|656513_657152_-|tRNA	DUF4479 and tRNA-binding domain-containing protein	tRNA	NA	NA	NA	NA
WP_011667813.1|657175_657508_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_011667814.1|657686_658013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021742343.1|658117_659476_-	amino acid permease	NA	NA	NA	NA	NA
WP_024525377.1|659511_660621_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_011667817.1|660832_661339_-	universal stress protein	NA	NA	NA	NA	NA
WP_021742340.1|661376_662777_-	dipeptidase PepV	NA	NA	NA	NA	NA
WP_024525378.1|662918_663752_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_024525379.1|663798_664488_-	16S rRNA pseudouridylate synthase	NA	NA	NA	NA	NA
WP_011667821.1|664499_666134_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
665180:665193	attL	GAACGACCGTAACT	NA	NA	NA	NA
WP_011667822.1|666355_666676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024525380.1|666781_667546_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_024525381.1|667610_668285_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_021741725.1|668298_669054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024525382.1|669304_671734_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	68.7	0.0e+00
WP_024525383.1|672173_672815_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_024525384.1|672811_673378_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	46.0	6.1e-37
WP_021741728.1|673434_673629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021741729.1|673707_675030_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_024525385.1|675038_675548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024525386.1|675549_676356_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_024525388.1|678366_679419_-	lysozyme M1 (1,4-beta-N-acetylmuramidase)	NA	D6PSS2	Lactobacillus_phage	95.0	4.9e-173
WP_024525389.1|679418_679937_-	hypothetical protein	NA	D6PSS1	Lactobacillus_phage	95.3	2.6e-82
WP_024525390.1|679948_680311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035465732.1|680300_680654_-	hypothetical protein	NA	D6PSR9	Lactobacillus_phage	68.1	7.6e-38
WP_143447253.1|680757_680925_-	XkdX family protein	NA	NA	NA	NA	NA
WP_024525392.1|680936_681365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024525393.1|681379_682396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024525394.1|682397_683339_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_024525395.1|683342_684020_-	hypothetical protein	NA	D6PT00	Lactobacillus_phage	43.6	7.8e-23
WP_024525396.1|684009_685173_-|plate	baseplate J/gp47 family protein	plate	A0A2H4J8D2	uncultured_Caudovirales_phage	36.6	2.9e-65
WP_024525397.1|685169_685544_-	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
WP_024525398.1|685540_685915_-	hypothetical protein	NA	A8ATI0	Listeria_phage	36.0	1.1e-05
WP_024525399.1|685911_686871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024525400.1|686863_687250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024525401.1|687263_688565_-	LysM peptidoglycan-binding domain-containing protein	NA	A8ATH7	Listeria_phage	30.7	4.0e-07
WP_024525402.1|688576_694174_-|tail	phage tail tape measure protein	tail	D6PSZ2	Lactobacillus_phage	62.8	3.5e-60
WP_024525403.1|694411_695038_-	hypothetical protein	NA	D6PSY5	Lactobacillus_phage	43.2	1.0e-13
WP_011667853.1|695168_695651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024525404.1|695668_696820_-	DUF3383 family protein	NA	NA	NA	NA	NA
WP_011667855.1|696837_697326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024525405.1|697309_697693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024525406.1|697707_698007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024525407.1|698021_698534_-	hypothetical protein	NA	L7TME2	Rhizobium_phage	34.1	1.1e-08
WP_024525408.1|698530_698881_-	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_099963046.1|699053_699767_-|capsid	major capsid protein	capsid	S5MNB6	Brevibacillus_phage	33.0	2.6e-24
WP_099963047.1|699770_700169_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_024525410.1|700186_700588_-	hypothetical protein	NA	A0A0K2CNR0	Brevibacillus_phage	33.6	1.3e-09
WP_024525411.1|700599_701259_-	DUF4355 domain-containing protein	NA	A0A0P0ID10	Lactobacillus_phage	48.1	3.0e-27
WP_099963048.1|701478_702387_-	hypothetical protein	NA	A0A2P1JTW9	Anoxybacillus_phage	23.6	8.9e-14
WP_024525413.1|702337_703831_-|portal	phage portal protein	portal	A0A0P0IJV3	Lactobacillus_phage	37.1	2.2e-73
WP_024525414.1|703842_705159_-|terminase	PBSX family phage terminase large subunit	terminase	V5UQR5	Oenococcus_phage	62.1	4.1e-161
WP_076025959.1|705234_705408_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_024525415.1|705444_705852_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A090DBV2	Clostridium_phage	36.0	2.6e-13
WP_024525416.1|706004_706592_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	34.1	3.4e-22
WP_024525417.1|706598_707357_-|terminase	terminase small subunit	terminase	V5URT8	Oenococcus_phage	50.2	1.5e-59
712673:712686	attR	AGTTACGGTCGTTC	NA	NA	NA	NA
>prophage 5
NZ_CP024635	Lactobacillus brevis strain BDGP6 chromosome, complete genome	2785111	710541	726126	2785111		Lactobacillus_phage(80.0%)	33	NA	NA
WP_024525420.1|710541_710997_-	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	58.2	8.9e-47
WP_024525421.1|711090_711414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024525422.1|711406_711658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024525423.1|711688_711880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155278302.1|711876_712044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024525424.1|712076_712460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024525425.1|712493_712769_-	DUF3850 domain-containing protein	NA	U5U430	Lactobacillus_phage	61.8	2.3e-18
WP_155278303.1|712779_712953_-	hypothetical protein	NA	K4HZV9	Lactobacillus_phage	60.8	2.1e-12
WP_024525426.1|712949_713195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024525427.1|713191_713635_-	DUF1642 domain-containing protein	NA	A0A2P0ZLB8	Lactobacillus_phage	33.8	8.4e-18
WP_024525428.1|713645_713993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024525429.1|713993_714248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024525430.1|714248_714500_-	hypothetical protein	NA	A0A0P0IJX1	Lactobacillus_phage	69.2	1.3e-20
WP_024525431.1|714514_714712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024525432.1|714725_715187_-	DUF1064 domain-containing protein	NA	A0A2P0ZKV6	Lactobacillus_phage	46.9	6.7e-26
WP_024525433.1|715183_715564_-	hypothetical protein	NA	A0A1B1SDX7	Weissella_phage	57.4	2.3e-32
WP_024525434.1|715563_716337_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_024525435.1|716333_716717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024525436.1|716738_717182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024525437.1|717184_717874_-	hypothetical protein	NA	A0A2D1GP81	Lactobacillus_phage	43.1	2.6e-37
WP_024525438.1|717874_718288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024525439.1|718280_719525_-	hypothetical protein	NA	A0A2D1GP91	Lactobacillus_phage	35.0	7.6e-56
WP_024525440.1|719525_720269_-	conserved phage C-terminal domain-containing protein	NA	A0A2D1GPH5	Lactobacillus_phage	38.2	7.8e-32
WP_024525441.1|720282_720864_-	DUF669 domain-containing protein	NA	D2KRE3	Lactobacillus_phage	43.9	2.7e-32
WP_024525442.1|720860_721559_-	AAA family ATPase	NA	E9LUU1	Lactobacillus_phage	73.4	4.2e-88
WP_024525443.1|721559_722453_-	DUF1351 domain-containing protein	NA	A0A0P0IV40	Lactobacillus_phage	31.1	5.9e-26
WP_024525444.1|722445_722625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011667895.1|722951_723230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024525445.1|723318_723573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143447255.1|723801_723990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024525447.1|723990_724479_-	hypothetical protein	NA	D2XQ14	Bacillus_virus	35.5	1.2e-12
WP_024525448.1|724478_725327_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_024525449.1|725316_726126_-	DUF3102 domain-containing protein	NA	A0A2H4JAH5	uncultured_Caudovirales_phage	59.0	2.9e-32
>prophage 6
NZ_CP024635	Lactobacillus brevis strain BDGP6 chromosome, complete genome	2785111	831267	885978	2785111	portal,terminase,capsid,head,tail,tRNA	Bacillus_phage(30.77%)	59	NA	NA
WP_024525511.1|831267_832485_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_024525512.1|832505_833651_-	cysteine desulfurase	NA	NA	NA	NA	NA
WP_035465797.1|833802_835533_-	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_011668127.1|835722_836190_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_021742864.1|836389_836995_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_024525514.1|837263_837599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024525515.1|837641_838241_-	DUF1054 family protein	NA	NA	NA	NA	NA
WP_021742862.1|838317_838773_+	YueI family protein	NA	NA	NA	NA	NA
WP_035465827.1|838816_840067_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	49.1	5.8e-96
WP_011668133.1|840446_840734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011668134.1|840830_841310_+	universal stress protein	NA	NA	NA	NA	NA
WP_015473520.1|841403_842288_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_051345717.1|842616_844233_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_024525518.1|844242_845385_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_024525519.1|845459_846431_-	DUF2785 domain-containing protein	NA	NA	NA	NA	NA
WP_024525520.1|846461_847307_-	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_011668140.1|847430_847733_-	glycine cleavage system protein H	NA	NA	NA	NA	NA
WP_011668141.1|847746_848952_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_024525521.1|849047_849272_-	DUF2969 domain-containing protein	NA	NA	NA	NA	NA
WP_011668143.1|849284_849584_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	52.5	9.7e-18
WP_021742853.1|849609_850617_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_024525522.1|850745_852053_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_011668146.1|852079_852310_-	DUF1146 domain-containing protein	NA	NA	NA	NA	NA
WP_021742851.1|852518_852938_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_024525523.1|852951_854367_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_011668149.1|854389_855289_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_011668150.1|855319_856861_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_011668151.1|856891_857434_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_021742847.1|857423_857939_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_011668153.1|857989_858202_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_011668154.1|858237_858957_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_021742844.1|859304_859934_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_024525524.1|860026_861268_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.1	2.2e-95
WP_011668157.1|861348_862365_-	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	41.7	2.6e-54
WP_024525525.1|862382_863234_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_021742840.1|863226_864312_-	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_011668160.1|864332_864917_-	thymidine kinase	NA	E0YIP8	Lactococcus_phage	49.5	2.8e-45
WP_024525526.1|865122_866472_+	Mur ligase family protein	NA	NA	NA	NA	NA
WP_024525527.1|866468_867173_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_024525528.1|867228_868248_-	serine hydrolase	NA	NA	NA	NA	NA
WP_024525529.1|868366_870208_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	33.2	4.3e-55
WP_011667976.1|870200_871934_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.8	1.7e-42
WP_011667977.1|872102_872432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011667978.1|872478_872685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024525530.1|872764_873889_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.9	2.1e-17
WP_024525531.1|874121_874784_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_024525532.1|874853_875957_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024525533.1|876095_877061_-	VIP2 family actin-ADP-ribosylating toxin	NA	NA	NA	NA	NA
WP_024525534.1|877501_878017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024525535.1|878019_878487_-	SocA family protein	NA	I6R0L8	Salmonella_phage	33.1	1.9e-15
WP_024525536.1|878545_878905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024525537.1|879062_879329_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_024525538.1|879453_881028_-|capsid	phage major capsid protein	capsid	A0A1J0MFW8	Staphylococcus_phage	35.0	1.1e-40
WP_024525539.1|881017_882124_-|portal	phage portal protein	portal	H9A113	Staphylococcus_phage	34.0	2.3e-48
WP_024525540.1|882120_882318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024525541.1|882277_883975_-|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	41.1	1.3e-122
WP_024525542.1|883971_884445_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_024525543.1|885213_885624_-	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	44.0	4.1e-19
WP_024525544.1|885681_885978_-|head	phage head closure protein	head	NA	NA	NA	NA
>prophage 7
NZ_CP024635	Lactobacillus brevis strain BDGP6 chromosome, complete genome	2785111	2443833	2518618	2785111	portal,plate,terminase,transposase,integrase	Lactobacillus_phage(42.11%)	92	2446977:2446997	2493238:2493258
WP_024526517.1|2443833_2444757_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	33.9	2.2e-28
WP_035466125.1|2444763_2445348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172757523.1|2445456_2446998_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.1	1.4e-14
2446977:2446997	attL	TTCGACTATTGAGTGGGAATA	NA	NA	NA	NA
WP_099963099.1|2447174_2448356_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5SA16	Streptococcus_phage	28.0	4.5e-34
WP_069360046.1|2448540_2449173_-	DUF805 domain-containing protein	NA	D6PSS5	Lactobacillus_phage	97.2	1.5e-89
WP_157771899.1|2449185_2449779_-	zinc-ribbon domain-containing protein	NA	D6PSS6	Lactobacillus_phage	94.4	9.1e-92
WP_099963101.1|2449851_2451327_-	DUF4041 domain-containing protein	NA	A0A1B0Y697	Lactobacillus_phage	47.4	6.0e-68
WP_099963102.1|2451339_2451747_-	hypothetical protein	NA	A0A0S2MYA6	Enterococcus_phage	38.5	5.8e-05
WP_099963157.1|2451753_2452092_-	helix-turn-helix transcriptional regulator	NA	A8ATX5	Listeria_phage	46.0	7.9e-16
WP_099963103.1|2452280_2452532_+	helix-turn-helix transcriptional regulator	NA	A8ATX6	Listeria_phage	41.9	2.1e-10
WP_042254721.1|2452531_2452729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042254720.1|2452725_2453106_-	DUF2513 domain-containing protein	NA	A0A0H4TJ44	Erysipelothrix_phage	37.5	4.1e-13
WP_157771900.1|2453265_2453439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099963104.1|2453505_2454027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099963105.1|2454031_2454325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157771901.1|2454336_2454513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128491761.1|2454622_2454916_+	hypothetical protein	NA	D6PST8	Lactobacillus_phage	54.7	2.4e-21
WP_039107749.1|2454906_2455122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021742294.1|2455122_2455992_+	recombinase RecT	NA	A0A1B0YA63	Lactobacillus_phage	51.7	8.1e-65
WP_157771902.1|2455915_2456830_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	E9LUM4	Lactobacillus_phage	34.6	2.7e-42
WP_099963108.1|2456841_2457750_+	DnaD domain protein	NA	D6PSU3	Lactobacillus_phage	69.1	1.6e-18
WP_099963109.1|2457746_2458436_+	Rha family transcriptional regulator	NA	D2IYT0	Enterococcus_phage	48.1	4.8e-52
WP_099963019.1|2458438_2458855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099963020.1|2458847_2459318_+	DUF1642 domain-containing protein	NA	A0A2K9VD68	Lactobacillus_phage	44.5	6.2e-27
WP_191976637.1|2459417_2459582_+	hypothetical protein	NA	E9LUP2	Lactobacillus_phage	53.7	7.2e-07
WP_099963152.1|2459598_2460129_+	RusA family crossover junction endodeoxyribonuclease	NA	D6PSU4	Lactobacillus_phage	91.6	1.9e-64
WP_099963021.1|2460244_2460673_+	hypothetical protein	NA	D6PSU8	Lactobacillus_phage	62.2	8.4e-23
WP_099963022.1|2460882_2461365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099963023.1|2461625_2462192_+	hypothetical protein	NA	A8ASQ2	Listeria_phage	32.9	1.8e-17
WP_157771903.1|2463020_2463191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099963110.1|2463174_2463390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099963111.1|2463392_2463671_+	DUF2829 domain-containing protein	NA	A0A1X9HVT2	Ruegeria_phage	47.9	8.2e-19
WP_099963112.1|2463667_2463949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099963113.1|2463941_2464325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099963114.1|2464336_2464930_+	helix-turn-helix domain-containing protein	NA	A0A1S5SAK3	Streptococcus_phage	57.4	5.6e-57
WP_099963115.1|2464922_2466374_+|terminase	phage terminase large subunit	terminase	A0A090EUA8	Clostridium_phage	64.0	2.2e-171
WP_099963116.1|2466370_2466574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099963117.1|2466584_2466881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099963118.1|2466880_2467150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099963119.1|2467133_2468858_+|portal	phage portal protein	portal	A7J292	Streptococcus_phage	33.2	3.2e-60
WP_099963120.1|2468781_2469729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_191982948.1|2469715_2469871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157771904.1|2469963_2470617_+	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_099963122.1|2470634_2471666_+	replication protein	NA	O03966	Lactobacillus_phage	45.6	4.6e-75
WP_099963123.1|2471677_2472028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099963124.1|2472037_2472637_+	hypothetical protein	NA	E5DV55	Deep-sea_thermophilic_phage	34.0	4.7e-11
WP_099963125.1|2472640_2472925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099963126.1|2472917_2473379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157771905.1|2473290_2473776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099963127.1|2473779_2474895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039107249.1|2474908_2475385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039107251.1|2475460_2476075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039107253.1|2476166_2476352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157771906.1|2476366_2481172_+	peptidoglycan DD-metalloendopeptidase family protein	NA	O03937	Lactobacillus_phage	54.0	2.0e-112
WP_099963128.1|2481171_2482431_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_097545807.1|2482444_2482795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099963129.1|2482784_2483729_+	hypothetical protein	NA	A8ATH9	Listeria_phage	29.5	6.2e-18
WP_052256208.1|2483725_2484085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099963130.1|2484077_2484464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157771907.1|2484450_2485686_+|plate	baseplate J/gp47 family protein	plate	A0A2H4J8D2	uncultured_Caudovirales_phage	28.3	2.2e-39
WP_099963132.1|2485675_2486305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099963133.1|2486307_2487465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047021401.1|2487478_2487970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099963134.1|2487982_2488411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099963135.1|2488422_2488590_+	XkdX family protein	NA	NA	NA	NA	NA
WP_043022776.1|2488693_2489047_+	hypothetical protein	NA	D6PSR9	Lactobacillus_phage	68.1	3.8e-37
WP_099963136.1|2489036_2489399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099963137.1|2489410_2489929_+	hypothetical protein	NA	D6PSS1	Lactobacillus_phage	94.2	1.1e-80
WP_099963138.1|2489928_2490981_+	Lyzozyme M1 (1,4-beta-N-acetylmuramidase)	NA	D6PSS2	Lactobacillus_phage	91.3	5.4e-172
WP_069360097.1|2491378_2491642_+	hypothetical protein	NA	A9D9X7	Lactobacillus_prophage	44.0	1.9e-09
WP_069360098.1|2491703_2492033_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_099963139.1|2492172_2492472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099963158.1|2492846_2493104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024526520.1|2493939_2495322_+	KxYKxGKxW signal peptide domain-containing protein	NA	NA	NA	NA	NA
2493238:2493258	attR	TTCGACTATTGAGTGGGAATA	NA	NA	NA	NA
WP_012695418.1|2495430_2496456_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.5	5.7e-41
WP_024526521.1|2496508_2497402_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_024526522.1|2497599_2499813_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_011668375.1|2499888_2500287_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_024526523.1|2500445_2502980_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.1	1.8e-64
WP_024526524.1|2503353_2504796_+	arginine-ornithine antiporter	NA	NA	NA	NA	NA
WP_024526525.1|2504886_2506290_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_035466152.1|2506491_2507034_-	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_024526527.1|2507207_2507630_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_024526528.1|2507886_2509662_+	DNA helicase RecQ	NA	M1PGQ0	Moumouvirus	36.3	7.7e-78
WP_024526529.1|2509698_2511189_-	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
WP_015474069.1|2511254_2512544_-	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_024526530.1|2512557_2513538_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_024526531.1|2513801_2514692_+	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_024526532.1|2514778_2515855_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024526065.1|2516019_2516943_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	6.7e-33
WP_080662563.1|2517004_2517532_-	MFS transporter	NA	NA	NA	NA	NA
WP_012695418.1|2517592_2518618_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.5	5.7e-41
>prophage 8
NZ_CP024635	Lactobacillus brevis strain BDGP6 chromosome, complete genome	2785111	2732774	2785111	2785111	portal,terminase,protease,capsid,head,tail	Lactobacillus_phage(58.62%)	64	NA	NA
WP_024526644.1|2732774_2733344_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_024526645.1|2733717_2734041_-	heavy metal-binding domain-containing protein	NA	M4STD1	Rhodobacter_phage	35.6	9.2e-06
WP_024526646.1|2734246_2734816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024526647.1|2734863_2735205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021742221.1|2735310_2736018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024526648.1|2736261_2737449_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	69.4	7.3e-149
WP_021742220.1|2737654_2739130_+	MFS transporter	NA	NA	NA	NA	NA
WP_011668242.1|2739203_2739530_+	DUF960 domain-containing protein	NA	NA	NA	NA	NA
WP_021742219.1|2739578_2740226_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	46.4	1.8e-45
WP_021742218.1|2740379_2741150_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_021742217.1|2741203_2741875_-	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_024526649.1|2741887_2744602_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_024526650.1|2744822_2745785_-	NAD(P)-binding domain-containing protein	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	28.7	9.1e-25
WP_024526651.1|2745934_2746180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024526652.1|2746487_2747168_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011668234.1|2747219_2747696_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024526653.1|2748251_2748770_+	VanZ family protein	NA	NA	NA	NA	NA
WP_024526654.1|2748760_2749054_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_024526655.1|2750774_2751101_-	YbjQ family protein	NA	NA	NA	NA	NA
WP_024526656.1|2751248_2751581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024526657.1|2751697_2752075_-	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_157771908.1|2754170_2754317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024526661.1|2754386_2754728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035466212.1|2755177_2755390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024526663.1|2755879_2756206_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Y3N1	Lactobacillus_phage	57.1	1.1e-27
WP_024526664.1|2756488_2756698_+	hypothetical protein	NA	A0A2P0ZL97	Lactobacillus_phage	59.4	2.6e-17
WP_024526665.1|2756700_2757417_+	phage antirepressor KilAC domain-containing protein	NA	X2CXX0	Lactobacillus_phage	50.4	4.8e-63
WP_143447276.1|2757581_2758082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024525105.1|2758153_2758417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157771891.1|2758476_2758635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024525106.1|2758631_2759228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039105860.1|2759245_2759449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024526667.1|2759558_2759807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024526668.1|2759809_2760295_+	siphovirus Gp157 family protein	NA	D6PSU0	Lactobacillus_phage	62.1	1.7e-48
WP_024526669.1|2760304_2760940_+	ERF family protein	NA	Q8SDH6	Lactococcus_phage	37.8	3.1e-21
WP_024526670.1|2760936_2761365_+	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	60.7	1.6e-42
WP_024526671.1|2761375_2761933_+	HNH endonuclease	NA	A0A286QSR3	Streptococcus_phage	49.2	1.9e-43
WP_024526672.1|2761942_2762644_+	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	64.5	3.9e-86
WP_024526673.1|2762644_2763583_+	phage replisome organizer N-terminal domain-containing protein	NA	D6PSU3	Lactobacillus_phage	57.8	5.2e-41
WP_035466216.1|2763579_2763747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024526674.1|2763749_2764169_+	hypothetical protein	NA	D6PSU8	Lactobacillus_phage	76.8	2.4e-30
WP_024526675.1|2764214_2764829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024526676.1|2764866_2765223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080662575.1|2765241_2765562_+	hypothetical protein	NA	A0A1B1SDX7	Weissella_phage	43.3	1.2e-05
WP_024526678.1|2765616_2765922_+	hypothetical protein	NA	A0A2K9VCS9	Lactobacillus_phage	63.4	5.1e-30
WP_024526679.1|2766191_2766620_+	transcriptional regulator	NA	E9LUP5	Lactobacillus_phage	71.6	2.1e-53
WP_024526680.1|2767881_2768262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024526681.1|2768556_2768880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024526682.1|2768930_2769248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024526683.1|2769250_2769583_+	HNH endonuclease	NA	A0A0K2CYS9	Paenibacillus_phage	45.7	5.2e-20
WP_024526684.1|2769741_2770200_+|terminase	phage terminase small subunit P27 family	terminase	F8J1A9	Lactobacillus_phage	37.0	3.1e-15
WP_024526685.1|2770183_2771977_+|terminase	terminase large subunit	terminase	F8J1B1	Lactobacillus_phage	65.9	4.2e-233
WP_096110518.1|2772023_2773226_+|portal	phage portal protein	portal	A0A0U3SQF0	Bacillus_phage	51.3	4.8e-108
WP_024526687.1|2773197_2773917_+|protease	Clp protease ClpP	protease	A0A0B5A796	Paenibacillus_phage	55.3	5.7e-64
WP_024526688.1|2773919_2775065_+|capsid	phage major capsid protein	capsid	A0A0K2CZ99	Paenibacillus_phage	46.7	5.8e-87
WP_024526689.1|2775297_2775642_+|head,tail	phage gp6-like head-tail connector protein	head,tail	F8J1B6	Lactobacillus_phage	35.0	2.3e-07
WP_024526690.1|2775625_2775982_+|head	phage head closure protein	head	E9LUQ5	Lactobacillus_phage	52.1	5.9e-30
WP_024526691.1|2775974_2776394_+	hypothetical protein	NA	A0A2P0ZLE6	Lactobacillus_phage	36.2	5.7e-16
WP_024526692.1|2776389_2776776_+	DUF806 family protein	NA	NA	NA	NA	NA
WP_024526693.1|2776779_2777397_+|tail	phage tail protein	tail	A0A0M7RF39	Lactobacillus_phage	49.5	1.2e-46
WP_024526694.1|2777521_2777890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024526695.1|2777889_2778102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024526696.1|2778117_2783133_+|tail	phage tail tape measure protein	tail	Q9AZS0	Lactococcus_phage	35.5	1.2e-104
WP_080662579.1|2783119_2785111_+|tail	phage tail family protein	tail	A0A1I9KK52	Lactobacillus_phage	26.9	1.5e-53
