The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024733	Prevotella intermedia strain KCOM 1741 chromosome 2, complete sequence	737408	477210	526950	737408	transposase,integrase	Bacillus_phage(18.18%)	41	478291:478318	525709:525736
WP_099891171.1|477210_478056_-|transposase	transposase	transposase	NA	NA	NA	NA
478291:478318	attL	CCGTAGAGTCAACCAGCAAGTGCAAAAT	NA	NA	NA	NA
WP_100016236.1|478320_479433_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	29.4	4.0e-32
WP_100016238.1|479818_481483_+	S8 family peptidase	NA	A0A217EQY2	Bacillus_phage	44.4	1.3e-47
WP_100016240.1|481577_481814_+	peptidase inhibitor I9 domain protein	NA	NA	NA	NA	NA
WP_100016242.1|482053_483706_+	S8 family peptidase	NA	A0A217EQY2	Bacillus_phage	41.5	1.1e-46
WP_100016244.1|484127_484487_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099891159.1|484712_485363_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_100016245.1|485369_485828_+	pyridoxamine 5-phosphate oxidase	NA	NA	NA	NA	NA
WP_004346461.1|486908_487217_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099891157.1|487409_488174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100016247.1|489130_490648_-	helicase	NA	H2DE57	Erwinia_phage	29.2	7.8e-39
WP_100016410.1|490940_492161_+|integrase	tyrosine-type recombinase/integrase	integrase	H7BUI8	unidentified_phage	30.4	2.2e-23
WP_100016248.1|492165_493434_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	36.8	1.3e-23
WP_100016250.1|493486_493972_+	DUF1896 domain-containing protein	NA	NA	NA	NA	NA
WP_157765052.1|494063_494252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004348461.1|494621_494891_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_100016253.1|494911_495226_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_100016255.1|495213_495720_+	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_100016258.1|495927_496350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100016260.1|496357_497284_-|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	25.0	2.7e-18
WP_100016262.1|497406_498507_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_100016264.1|498499_499141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100016265.1|499136_499625_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_100016267.1|499617_500760_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	26.7	5.7e-18
WP_100016269.1|500905_502351_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_100016270.1|502357_504466_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_100016272.1|504484_506041_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	57.7	1.1e-168
WP_018911431.1|506048_506705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100016273.1|506717_509561_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_100016275.1|509601_509847_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_100016277.1|510065_514919_-	DUF2958 domain-containing protein	NA	I3PUW5	Vibrio_phage	30.2	2.9e-26
WP_100014947.1|515011_517114_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	30.7	1.1e-38
WP_100014948.1|517134_518544_-	DUF3945 domain-containing protein	NA	NA	NA	NA	NA
WP_100016279.1|519329_520856_-	phytoene desaturase	NA	NA	NA	NA	NA
WP_157765053.1|520804_521542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100016283.1|521552_522653_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_100016285.1|522649_523270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100016287.1|523274_523919_-	carotenoid biosynthesis protein	NA	NA	NA	NA	NA
WP_100016289.1|523899_524451_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_100016290.1|524454_525312_-	phytoene/squalene synthase family protein	NA	NA	NA	NA	NA
WP_088439803.1|525969_526950_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
525709:525736	attR	CCGTAGAGTCAACCAGCAAGTGCAAAAT	NA	NA	NA	NA
