The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024734	Prevotella intermedia strain KCOM 1944 chromosome 1, complete sequence	2213784	954523	1010610	2213784	integrase,transposase,protease,tRNA	Cellulophaga_phage(16.67%)	44	986470:986501	1003595:1003626
WP_099995082.1|954523_955447_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_100027434.1|955548_955932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045167664.1|956156_957491_+|integrase	tyrosine-type recombinase/integrase	integrase	S0A5Q5	Cellulophaga_phage	24.5	3.9e-18
WP_099995506.1|957503_958499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045167662.1|958584_958818_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_045167661.1|958905_959514_+	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_045167660.1|959546_961091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045167659.1|962027_962348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099995504.1|962851_963697_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_045167658.1|964029_964782_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_045167657.1|965305_967417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045167656.1|967969_968338_+	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_045167655.1|968419_969868_+	TonB family protein	NA	NA	NA	NA	NA
WP_045167654.1|970350_972249_+	2-oxoacid:acceptor oxidoreductase subunit alpha	NA	NA	NA	NA	NA
WP_099995503.1|972266_973274_+	2-oxoacid:ferredoxin oxidoreductase subunit beta	NA	NA	NA	NA	NA
WP_099995502.1|973616_974750_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_099995501.1|974779_975652_+	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_099995900.1|976295_976844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099995500.1|976904_978968_+|tRNA	methionine--tRNA ligase	tRNA	K7Y9Y6	Megavirus	32.2	2.1e-79
WP_099995499.1|979530_980301_+	HmuY family protein	NA	NA	NA	NA	NA
WP_099995498.1|980445_981663_+	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_014709319.1|981851_982646_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_172952416.1|982898_985415_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_099983701.1|985584_986166_-	YkgB family protein	NA	NA	NA	NA	NA
986470:986501	attL	AATTACTTACACGTAAAGAAATATTTATTTAC	NA	NA	NA	NA
WP_099995496.1|987817_988249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045167643.1|988608_989070_-	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_099995495.1|989074_990043_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_045168315.1|990223_991660_-	virulence-associated protein E	NA	D3W0G0	Lactococcus_phage	31.3	7.5e-15
WP_099995899.1|992135_992426_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099995494.1|992422_992728_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099995493.1|993768_994395_+	Vat family streptogramin A O-acetyltransferase	NA	NA	NA	NA	NA
WP_045168299.1|994608_994992_+	VOC family protein	NA	NA	NA	NA	NA
WP_157766254.1|995921_996635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099995491.1|996692_997505_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_099995199.1|997624_998029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045168326.1|998025_999270_-|integrase	site-specific integrase	integrase	A0A0K1Y646	Mycobacterium_phage	24.3	2.7e-05
WP_099995198.1|999282_1000512_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	37.5	1.6e-26
WP_157766253.1|1001306_1003229_+	Omp28-related outer membrane protein	NA	NA	NA	NA	NA
WP_172952428.1|1004147_1006328_+	adhesin	NA	NA	NA	NA	NA
1003595:1003626	attR	GTAAATAAATATTTCTTTACGTGTAAGTAATT	NA	NA	NA	NA
WP_044047678.1|1006337_1006544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045166433.1|1007027_1007903_+	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_099995488.1|1007914_1008487_+	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_014709303.1|1009068_1009344_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	52.8	1.9e-15
WP_099995485.1|1009653_1010610_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP024734	Prevotella intermedia strain KCOM 1944 chromosome 1, complete sequence	2213784	1082597	1144072	2213784	integrase,transposase,tRNA	Staphylococcus_phage(18.75%)	41	1115474:1115492	1138095:1138113
WP_099995443.1|1082597_1083842_-|integrase	site-specific integrase	integrase	G1JX48	Mycobacterium_phage	24.2	4.7e-05
WP_099995442.1|1083907_1085137_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	34.3	8.6e-28
WP_099995440.1|1085733_1087026_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	49.0	5.4e-105
WP_099995439.1|1087032_1087989_+	DUF4271 domain-containing protein	NA	NA	NA	NA	NA
WP_088438548.1|1087995_1088745_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_045166475.1|1088805_1089249_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_080889337.1|1089245_1089494_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	62.3	1.5e-16
WP_045166476.1|1089566_1090865_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	39.1	1.5e-70
WP_099995438.1|1091053_1092913_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_099995437.1|1093339_1094638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045166480.1|1094634_1095120_-	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_099995436.1|1095726_1097388_-	nucleoside kinase	NA	NA	NA	NA	NA
WP_099995435.1|1097480_1099190_+	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_028905495.1|1099241_1100087_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_014709245.1|1100127_1100904_+	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_099995434.1|1101355_1103380_-	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	31.5	1.6e-84
WP_045166510.1|1103573_1103936_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099995433.1|1104014_1104851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099995432.1|1104893_1105628_-	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_014709242.1|1105640_1106468_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	2.1e-17
WP_028905498.1|1106858_1107338_+	arginine repressor	NA	NA	NA	NA	NA
WP_099995431.1|1107962_1109192_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	34.7	3.5e-29
WP_004339693.1|1110952_1111369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004339692.1|1111420_1111819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004338288.1|1111815_1113879_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_004338289.1|1113866_1114175_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004352710.1|1114550_1115504_+	Abi family protein	NA	A3QSC6	Clostridium_virus	28.7	6.9e-25
1115474:1115492	attL	AAAATGGAGAGAATACTCT	NA	NA	NA	NA
WP_004352691.1|1115545_1121764_-	N-6 DNA methylase	NA	A0A248SL14	Klebsiella_phage	28.7	6.3e-127
WP_004338303.1|1121857_1123942_-	type IA DNA topoisomerase	NA	A0A076FM50	Aureococcus_anophage	24.8	1.9e-19
WP_004338306.1|1123963_1125367_-	DUF3945 domain-containing protein	NA	NA	NA	NA	NA
WP_004338308.1|1125799_1126312_-	isoprenylcysteine carboxyl methyltransferase family protein	NA	NA	NA	NA	NA
WP_099995430.1|1127930_1128467_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004352700.1|1130263_1132729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004339688.1|1132752_1132926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004292844.1|1133889_1134825_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_050749437.1|1134966_1136049_+|integrase	site-specific integrase	integrase	B9UDL9	Salmonella_phage	24.3	1.1e-07
WP_004353653.1|1136207_1137788_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	23.6	9.1e-06
WP_004353655.1|1137794_1138583_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	34.9	1.1e-36
1138095:1138113	attR	AAAATGGAGAGAATACTCT	NA	NA	NA	NA
WP_002560998.1|1139269_1141195_+	tetracycline resistance ribosomal protection protein Tet(Q)	NA	A0A1S5SF82	Streptococcus_phage	40.8	2.2e-139
WP_004353651.1|1141194_1142328_+	histidine kinase	NA	NA	NA	NA	NA
WP_004353653.1|1142491_1144072_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	23.6	9.1e-06
>prophage 3
NZ_CP024734	Prevotella intermedia strain KCOM 1944 chromosome 1, complete sequence	2213784	1622650	1706842	2213784	integrase,protease,transposase,tRNA	Bacillus_phage(16.67%)	55	1671114:1671131	1712655:1712672
WP_045167578.1|1622650_1624051_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_099995223.1|1624104_1625259_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_045167580.1|1625268_1625790_-	16S rRNA processing protein RimM	NA	NA	NA	NA	NA
WP_028906341.1|1625802_1627116_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_045167581.1|1627120_1627723_-	DUF4290 domain-containing protein	NA	NA	NA	NA	NA
WP_045167582.1|1627776_1628469_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_014708882.1|1629087_1629876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099995222.1|1630176_1630947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099995221.1|1631096_1632947_-	glycoside hydrolase family 13 protein	NA	NA	NA	NA	NA
WP_099995220.1|1632956_1634870_-	type I pullulanase	NA	NA	NA	NA	NA
WP_099995219.1|1634929_1637131_-	glycoside hydrolase family 97 protein	NA	NA	NA	NA	NA
WP_099995218.1|1637206_1639900_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_099995217.1|1640565_1641786_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_099995216.1|1641961_1642843_-	carbohydrate kinase	NA	NA	NA	NA	NA
WP_097551034.1|1642854_1644009_-	MFS transporter	NA	NA	NA	NA	NA
WP_099995215.1|1644026_1645925_-	GH32 C-terminal domain-containing protein	NA	S6ATV4	Bacillus_phage	32.0	2.2e-59
WP_099995214.1|1645951_1648270_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_099995213.1|1648606_1651255_+	substrate-binding domain-containing protein	NA	Q6XM27	Feldmannia_irregularis_virus	24.2	9.9e-13
WP_099995212.1|1652010_1652892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045167595.1|1653022_1653469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045167596.1|1653665_1654169_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_045167597.1|1654165_1654897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045167598.1|1654893_1655808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028906361.1|1655895_1656264_+	DNA topoisomerase II	NA	NA	NA	NA	NA
WP_099995210.1|1662326_1664012_+	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	5.1e-39
WP_080889525.1|1665351_1665861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172952406.1|1667654_1668815_-	OmpA family protein	NA	NA	NA	NA	NA
WP_045168102.1|1668985_1670833_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.3	6.6e-56
WP_045168103.1|1670846_1671119_-	hypothetical protein	NA	NA	NA	NA	NA
1671114:1671131	attL	TATCATAAAAGCGAAAAA	NA	NA	NA	NA
WP_045168104.1|1671134_1673078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045168105.1|1673074_1674508_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_099995880.1|1674524_1675907_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_099995209.1|1676063_1677548_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.4	2.3e-99
WP_097549744.1|1678390_1680574_-	DNA helicase RecQ	NA	A0A2K9L021	Tupanvirus	38.9	7.2e-86
WP_099995208.1|1680668_1681901_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	51.7	1.6e-114
WP_014708844.1|1681904_1682570_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	46.6	2.8e-41
WP_099995207.1|1683404_1684847_-	trigger factor	NA	NA	NA	NA	NA
WP_061868644.1|1685110_1686778_-	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_099995205.1|1687397_1688417_-	S41 family peptidase	NA	NA	NA	NA	NA
WP_099995204.1|1688416_1689235_-	DUF3316 domain-containing protein	NA	NA	NA	NA	NA
WP_099995203.1|1689242_1692080_-	DNA gyrase/topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	29.5	2.0e-40
WP_099995202.1|1692757_1694308_+|tRNA	glycine--tRNA ligase	tRNA	A0A2I2L3K8	Orpheovirus	30.7	4.1e-43
WP_172419443.1|1694334_1695027_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_099995201.1|1695102_1696560_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_014708853.1|1696595_1697231_+	DedA family protein	NA	NA	NA	NA	NA
WP_099995082.1|1697501_1698425_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_099995200.1|1698532_1698823_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005845322.1|1698819_1699125_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_007367849.1|1699229_1700135_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_006949223.1|1700254_1700707_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_045168305.1|1700720_1701485_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_099995199.1|1702623_1703028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045168326.1|1703024_1704269_-|integrase	site-specific integrase	integrase	A0A0K1Y646	Mycobacterium_phage	24.3	2.7e-05
WP_099995198.1|1704281_1705511_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	37.5	1.6e-26
WP_099995082.1|1705918_1706842_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
1712655:1712672	attR	TTTTTCGCTTTTATGATA	NA	NA	NA	NA
