The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024720	Escherichia coli isolate NQ3 chromosome, complete genome	5196957	412785	465785	5196957	transposase,integrase,protease	Stx2-converting_phage(25.0%)	36	463771:463785	472363:472377
WP_000997995.1|412785_414324_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	93.9	1.2e-281
WP_000624646.1|415451_415802_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.1	5.4e-36
WP_000435655.1|415798_416224_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	74.2	3.6e-34
WP_085949591.1|416595_416733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001149834.1|416884_417802_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000629094.1|417835_418711_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000376547.1|418759_420232_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	22.7	2.2e-06
WP_000948500.1|420235_421066_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001296386.1|421111_421822_+	N-acetylneuraminic acid channel protein	NA	NA	NA	NA	NA
WP_000865295.1|421834_422944_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_001030790.1|423005_423929_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001282578.1|423964_424699_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000274668.1|424798_425785_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	57.7	4.0e-108
WP_096928816.1|425936_427164_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	7.2e-168
WP_001223344.1|427664_429755_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001305021.1|430586_430859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296382.1|431149_431509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266542.1|431512_431728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001254932.1|436508_437660_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001034083.1|438256_442144_-|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
WP_000973516.1|443087_445289_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000750130.1|445370_446648_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001015715.1|446644_448387_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_001287500.1|448386_449334_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001296374.1|449334_451059_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000074472.1|451194_452388_+	MFS transporter	NA	NA	NA	NA	NA
WP_001296373.1|453105_453534_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_000109147.1|453573_454134_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001110186.1|454175_454436_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001513409.1|456269_456383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099156432.1|456473_457599_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	96.6	2.5e-146
WP_023146305.1|457568_457784_-	hypothetical protein	NA	A0A0N7C1Y0	Escherichia_phage	85.2	1.7e-27
WP_000006213.1|458250_458484_-	Major pilus subunit operon regulatory protein	NA	NA	NA	NA	NA
WP_001774069.1|460975_461527_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000147017.1|463220_464264_-	hypothetical protein	NA	NA	NA	NA	NA
463771:463785	attL	GCGCCAGTGCGTAAC	NA	NA	NA	NA
WP_001218869.1|464519_465785_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_001218869.1|464519_465785_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
472363:472377	attR	GCGCCAGTGCGTAAC	NA	NA	NA	NA
>prophage 2
NZ_CP024720	Escherichia coli isolate NQ3 chromosome, complete genome	5196957	747868	755008	5196957		Escherichia_phage(83.33%)	6	NA	NA
WP_001279004.1|747868_748507_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
WP_000590411.1|748503_749766_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_000847996.1|749762_750671_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_001296319.1|750866_751634_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_001141293.1|751684_752341_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_000103863.1|752446_755008_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
>prophage 3
NZ_CP024720	Escherichia coli isolate NQ3 chromosome, complete genome	5196957	788107	867732	5196957	capsid,plate,head,lysis,portal,tail,terminase,integrase,tRNA	Salmonella_phage(66.67%)	93	823610:823659	856457:856506
WP_000047157.1|788107_790738_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.4	9.3e-80
WP_000906486.1|790972_791158_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000273309.1|792346_792913_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_001287462.1|792909_793338_+	DedA family protein	NA	NA	NA	NA	NA
WP_000611804.1|793410_794967_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001130208.1|795116_795632_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_000638136.1|795682_796795_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001097132.1|796791_797499_-	RNA ligase family protein	NA	NA	NA	NA	NA
WP_001296316.1|797756_799295_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001295175.1|799311_800484_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_000378443.1|800610_801141_-	multidrug efflux transporter EmrAB transcriptional repressor EmrR	NA	NA	NA	NA	NA
WP_000119749.1|801231_801567_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_000445658.1|801556_802294_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_000165701.1|802417_803602_-	MFS transporter	NA	NA	NA	NA	NA
WP_001216534.1|803793_804786_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000774966.1|804842_805907_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_000985509.1|805899_807102_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777934.1|807457_808417_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	72.4	1.4e-134
WP_000246582.1|808426_810571_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	2.9e-196
WP_000080947.1|810543_810954_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_001223227.1|810950_811196_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_001295174.1|811442_811772_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000281320.1|811923_812268_+	YgaC family protein	NA	NA	NA	NA	NA
WP_000492656.1|812304_812754_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_000115381.1|813421_813826_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_001229463.1|813872_814397_-	thiosulfate sulfurtransferase YgaP	NA	NA	NA	NA	NA
WP_000137288.1|814406_814706_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000508177.1|814888_815047_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000522415.1|815130_815580_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156817.1|815580_816243_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001296312.1|816263_817664_-	GABA permease	NA	NA	NA	NA	NA
WP_000625041.1|817900_819181_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.3	3.8e-34
WP_000772888.1|819194_820643_-	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000271888.1|820668_821934_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_000993107.1|821953_822931_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
823610:823659	attL	TTATTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_001547641.1|823776_824802_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	95.3	1.4e-193
WP_023352525.1|824803_825436_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	90.5	6.9e-106
WP_000063849.1|825555_825804_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	71.6	3.4e-24
WP_023135813.1|825836_826346_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	95.9	7.8e-84
WP_000956182.1|826353_826554_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000963473.1|826517_826859_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_001244228.1|826926_827160_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_000752619.1|827159_827387_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_029364117.1|827383_828241_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.9	1.2e-161
WP_099996227.1|828237_830652_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.9	0.0e+00
WP_001154431.1|830804_830993_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_001555842.1|831003_831237_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	4.0e-35
WP_001399243.1|831539_832973_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_073980331.1|833007_834048_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.8	7.5e-174
WP_001717244.1|834044_834770_-|terminase	terminase-like family protein	terminase	A4JWU9	Burkholderia_virus	32.6	3.2e-22
WP_073980332.1|834769_836536_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.1	0.0e+00
WP_000216237.1|836678_837512_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_000742511.1|837528_838587_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000059191.1|838590_839241_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000673523.1|839336_839801_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_000868175.1|839800_840004_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|840007_840223_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001341072.1|840242_840716_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
WP_077896521.1|840717_841095_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	37.6	2.6e-15
WP_073980334.1|841091_841520_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.2	2.4e-46
WP_001039944.1|841615_842047_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	4.4e-72
WP_000829122.1|842039_842486_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	5.1e-63
WP_000993775.1|842554_843133_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
WP_000177590.1|843129_843489_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_000268280.1|843475_844384_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	7.8e-143
WP_001086824.1|844376_844982_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	93.0	1.8e-111
WP_099996228.1|844978_846535_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	70.8	2.7e-196
WP_047649528.1|846534_847137_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	88.4	4.3e-97
WP_021546685.1|847108_847549_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	69.7	4.7e-53
WP_157759957.1|847575_847965_-	hypothetical protein	NA	F1BUP1	Erwinia_phage	45.8	7.9e-12
WP_001463281.1|847995_848562_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
WP_000046146.1|848704_849877_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	7.8e-204
WP_001207660.1|849886_850402_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281016.1|850456_850759_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	90.0	8.2e-41
WP_000763311.1|850773_850893_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_099996229.1|850885_853963_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.2	0.0e+00
WP_000980413.1|853959_854445_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_001011796.1|854441_855542_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.5	3.4e-177
WP_000980501.1|855610_855829_+	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	77.8	7.5e-28
WP_048231062.1|855855_856338_-	hypothetical protein	NA	Q19UP0	Mannheimia_phage	33.7	6.0e-17
WP_000162574.1|857038_857521_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
856457:856506	attR	TTATTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000600193.1|857652_858129_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117834.1|858118_858409_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|858470_858812_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880939.1|858960_860622_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059176.1|860707_861586_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|861708_862302_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|862355_863642_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001314062.1|863662_864454_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|864620_865982_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|866118_866367_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|866385_866934_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264790.1|866964_867732_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP024720	Escherichia coli isolate NQ3 chromosome, complete genome	5196957	1364415	1373860	5196957		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569347.1|1364415_1365342_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
WP_000783109.1|1365346_1366078_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1366058_1366166_-	protein YohO	NA	NA	NA	NA	NA
WP_001240408.1|1366225_1366957_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001295431.1|1367178_1368864_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1368860_1369580_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1369626_1370097_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|1370137_1370599_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001296230.1|1370723_1372727_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001292786.1|1372723_1373860_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
>prophage 5
NZ_CP024720	Escherichia coli isolate NQ3 chromosome, complete genome	5196957	1468036	1474339	5196957		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001116066.1|1468036_1469431_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
WP_000183040.1|1469605_1470499_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
WP_000699407.1|1470871_1471957_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
WP_001023641.1|1471956_1472856_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000857525.1|1472913_1473792_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001100793.1|1473796_1474339_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
>prophage 6
NZ_CP024720	Escherichia coli isolate NQ3 chromosome, complete genome	5196957	1505142	1511594	5196957	transposase	Pseudomonas_phage(16.67%)	9	NA	NA
WP_000086752.1|1505142_1505787_-	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
WP_000692345.1|1505805_1506027_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186200.1|1506089_1506566_-	RadC family protein	NA	NA	NA	NA	NA
WP_001542276.1|1506581_1507055_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
WP_001164966.1|1507148_1507394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001542275.1|1507393_1508212_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
WP_000846703.1|1508432_1508843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001016257.1|1509291_1510038_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|1510052_1511594_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
>prophage 7
NZ_CP024720	Escherichia coli isolate NQ3 chromosome, complete genome	5196957	1653194	1741440	5196957	capsid,transposase,plate,holin,portal,tail,terminase,integrase,tRNA	Escherichia_phage(22.73%)	103	1653009:1653068	1695621:1695745
1653009:1653068	attL	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGG	NA	NA	NA	NA
WP_001531780.1|1653194_1654211_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
WP_000833838.1|1654179_1654443_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
WP_000916334.1|1654652_1654835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000100753.1|1654834_1655404_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
WP_000151806.1|1655400_1657617_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
WP_000388260.1|1657647_1657968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296165.1|1658978_1659392_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_000360804.1|1659490_1659721_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_000431205.1|1659779_1660256_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_000943914.1|1660295_1660520_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
WP_001023813.1|1660516_1661272_+	hypothetical protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
WP_000609322.1|1661261_1662677_+	AAA family ATPase	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
WP_000214056.1|1662715_1663126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000918616.1|1663127_1663364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875806.1|1663360_1663672_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
WP_000661082.1|1663668_1663893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531776.1|1664574_1665363_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
WP_001237642.1|1665537_1666461_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000536231.1|1667649_1668348_+	hypothetical protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
WP_001138663.1|1668810_1669416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|1669425_1669914_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_000536919.1|1670312_1670546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000847617.1|1670789_1671431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001025459.1|1671582_1671762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000057010.1|1671839_1672436_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
WP_000717783.1|1672432_1672726_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
WP_000064384.1|1672725_1673397_+	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
WP_001294589.1|1673509_1673893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000172496.1|1673892_1674165_+|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_000131873.1|1674164_1674644_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000734931.1|1674651_1674846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531775.1|1674905_1675151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000168117.1|1675519_1676086_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
WP_000148195.1|1676072_1677935_+|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
WP_000203897.1|1677934_1678168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126513.1|1678164_1679739_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
WP_001145892.1|1679738_1681046_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
WP_000206292.1|1681045_1681375_+	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_001283997.1|1681433_1682468_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
WP_000105179.1|1682502_1682922_+	DNA-packaging protein	NA	NA	NA	NA	NA
WP_001531773.1|1682918_1683299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|1683330_1684011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015612.1|1684007_1684544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000079174.1|1684524_1685427_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_000901289.1|1685429_1685771_+|plate	phage baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.1e-20
WP_000633314.1|1685767_1686688_+|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
WP_000203868.1|1686690_1687317_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
WP_000829621.1|1687309_1688494_+|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
WP_000626358.1|1688493_1688883_+	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_000117510.1|1688879_1690382_+|tail	tail sheath protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
WP_000785563.1|1690399_1690912_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000444667.1|1690924_1691206_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001018353.1|1691314_1692955_+	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
WP_001531768.1|1692990_1693380_+|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_001531767.1|1693541_1693766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296152.1|1694980_1695400_+	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
WP_000847882.1|1695871_1696537_+	UPF0149 family protein YecA	NA	NA	NA	NA	NA
1695621:1695745	attR	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTTTGT	NA	NA	NA	NA
WP_000797555.1|1696587_1697799_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000377224.1|1697989_1698229_+	YecH family protein	NA	NA	NA	NA	NA
WP_000917208.1|1698266_1698764_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_001237881.1|1698935_1699259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723106.1|1699522_1699609_+	stress response protein AzuC	NA	NA	NA	NA	NA
WP_000082127.1|1699723_1699975_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_000179469.1|1700052_1700556_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000548680.1|1701350_1702340_+	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001187827.1|1702409_1703924_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
WP_000100203.1|1703938_1704925_+	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001296149.1|1705091_1705892_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001296148.1|1705866_1707291_+	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_000122413.1|1707297_1707726_-	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295647.1|1708505_1708856_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_001291603.1|1708858_1709437_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_000906342.1|1709563_1710451_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_000795641.1|1710447_1711374_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_001531763.1|1711378_1713343_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000147302.1|1713363_1713867_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001296146.1|1714011_1715673_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000204320.1|1715963_1716824_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_059329493.1|1716826_1717876_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	4.6e-06
WP_000763867.1|1717890_1718280_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000983600.1|1718290_1718935_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_001278946.1|1719123_1720272_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000066973.1|1720264_1722343_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001202076.1|1722342_1722735_+	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_001025326.1|1722787_1724521_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001490174.1|1724736_1725303_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185734.1|1725316_1726063_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214293.1|1726450_1727551_+	cytochrome c	NA	NA	NA	NA	NA
WP_000176764.1|1727575_1730005_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	NA	NA	NA	NA
WP_000564759.1|1730040_1731012_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|1731008_1731752_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|1731792_1732188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000639277.1|1732240_1733059_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000891625.1|1733055_1733622_-	hydrolase	NA	NA	NA	NA	NA
WP_001258676.1|1733931_1735704_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_077249130.1|1735696_1736149_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907234.1|1736177_1736918_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001295503.1|1736952_1737474_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024911.1|1737475_1738078_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_072093883.1|1738148_1738214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|1738352_1738964_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568520.1|1738972_1739983_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_099156422.1|1740092_1741440_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	8.7e-74
>prophage 8
NZ_CP024720	Escherichia coli isolate NQ3 chromosome, complete genome	5196957	2232697	2302412	5196957	capsid,integrase,head,holin,portal,protease,tail,terminase,transposase	Stx2-converting_phage(25.0%)	79	2261583:2261597	2303376:2303390
WP_000422062.1|2232697_2233747_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559273.1|2233966_2234725_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_001278898.1|2234721_2235312_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001000715.1|2235368_2235677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023141019.1|2235686_2236673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001291206.1|2236878_2237754_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001296033.1|2237966_2239862_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2239889_2240510_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285702.1|2240506_2241388_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2241525_2241570_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194644.1|2241661_2243224_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763535.1|2243223_2244819_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001195273.1|2244822_2246181_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000209513.1|2246192_2247386_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443082.1|2247385_2248192_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_001296031.1|2248567_2248843_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
WP_001348267.1|2248839_2249397_+	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
WP_000937495.1|2249808_2250078_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000240999.1|2250134_2250803_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001421220.1|2251001_2251184_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
WP_022645053.1|2251411_2252197_+	hypothetical protein	NA	Q858V4	Yersinia_virus	77.8	1.3e-109
WP_000972097.1|2252198_2252732_+|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
WP_001164137.1|2252762_2253290_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
WP_071550361.1|2253305_2256212_-	hypothetical protein	NA	A0A0F7LDR4	Escherichia_phage	45.9	1.1e-118
WP_001016257.1|2256673_2257420_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|2257434_2258976_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_000514710.1|2259616_2263090_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
2261583:2261597	attL	CGGGTGGCAGCATCA	NA	NA	NA	NA
WP_061089814.1|2263432_2264065_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.6	3.0e-101
WP_000194730.1|2264010_2264754_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	4.3e-147
WP_001296027.1|2264764_2265463_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
WP_000807937.1|2265462_2265804_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
WP_000212991.1|2265796_2269039_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.6	0.0e+00
WP_001513217.1|2269086_2269296_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000710949.1|2269391_2269766_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001275441.1|2269780_2270497_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000133388.1|2270563_2270908_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2270904_2271351_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2271347_2271698_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125990.1|2271707_2272034_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_000267294.1|2272030_2274616_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_001063099.1|2274561_2274783_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173031.1|2274827_2276765_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_001296023.1|2276828_2278490_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
WP_000958366.1|2278486_2279050_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
WP_000829185.1|2279340_2279706_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
WP_000095741.1|2279747_2279948_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000736382.1|2280146_2280362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|2280447_2280633_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_032140280.1|2280854_2280941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992071.1|2281495_2282029_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_000369850.1|2282134_2282407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193278.1|2282372_2282717_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000284510.1|2282721_2282937_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_016230612.1|2283087_2284941_-	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
WP_000871291.1|2285201_2285537_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_023142244.1|2285817_2285949_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
WP_000024331.1|2286750_2287800_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
WP_000917751.1|2287951_2288149_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
WP_001513213.1|2288375_2289197_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.7e-80
WP_000140014.1|2289193_2289574_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.9e-35
WP_001265085.1|2289574_2290630_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_001329966.1|2290631_2290904_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_000018429.1|2291071_2291284_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_000150294.1|2291464_2292130_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001151161.1|2292304_2292730_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
WP_000450998.1|2292745_2293516_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_000788950.1|2293537_2294284_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000095675.1|2294290_2295253_-	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000693845.1|2295275_2295701_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000471549.1|2295697_2295913_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000103687.1|2295962_2296679_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
WP_000379589.1|2296951_2297107_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171951.1|2297266_2297485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023142248.1|2297533_2297701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449179.1|2298050_2298239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001090200.1|2298235_2298427_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_016230610.1|2298519_2300991_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
WP_000113189.1|2301055_2301304_+	excisionase	NA	NA	NA	NA	NA
WP_000113700.1|2301281_2302412_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
2303376:2303390	attR	TGATGCTGCCACCCG	NA	NA	NA	NA
>prophage 9
NZ_CP024720	Escherichia coli isolate NQ3 chromosome, complete genome	5196957	2440491	2486200	5196957	capsid,head,lysis,holin,portal,tail,terminase,integrase,tRNA	Enterobacteria_phage(56.0%)	58	2459275:2459289	2487869:2487883
WP_000654172.1|2440491_2440770_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
WP_000290538.1|2440766_2442788_-	hypothetical protein	NA	A0A0E3M0V5	Enterobacteria_phage	72.3	7.2e-181
WP_001531667.1|2442846_2446329_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_023149564.1|2446389_2446992_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	2.1e-88
WP_023146277.1|2446928_2447672_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_001152626.1|2447676_2448375_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_000847375.1|2448374_2448704_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_000840216.1|2448700_2451262_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
WP_000459457.1|2451254_2451689_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479203.1|2451670_2452093_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
WP_001295979.1|2452108_2452849_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
WP_000683150.1|2452856_2453252_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
WP_000985120.1|2453248_2453827_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.7	5.9e-80
WP_000753018.1|2453838_2454192_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
WP_000158908.1|2454203_2454602_-	DNA packaging protein from bacteriophage origin	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.0e-62
WP_000063293.1|2454643_2455669_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
WP_001295978.1|2455724_2456057_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123268.1|2456066_2457386_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
WP_001295977.1|2457366_2458968_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
WP_000198149.1|2458964_2459171_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027261.1|2459167_2461093_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
2459275:2459289	attL	GCTGCCAGCGGGAAA	NA	NA	NA	NA
WP_000453620.1|2461067_2461613_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
WP_000881610.1|2462176_2462359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|2462565_2462892_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001298464.1|2463372_2463666_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_001228695.1|2463756_2463939_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001180486.1|2464155_2464632_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
WP_000544528.1|2464618_2464924_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097224.1|2465245_2465935_-	antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
WP_000971096.1|2465931_2466072_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
WP_001099488.1|2466068_2466431_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_000774479.1|2466427_2466718_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_000224914.1|2466710_2466881_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053005.1|2466880_2467336_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
WP_072147164.1|2467332_2467434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000700202.1|2467783_2468827_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_022645049.1|2468863_2473129_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000788794.1|2473378_2474080_-	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	97.0	1.5e-125
WP_001435464.1|2474076_2475006_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	6.1e-111
WP_001182900.1|2475092_2475632_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_001067458.1|2475701_2475932_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|2476036_2476726_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000233576.1|2477321_2477528_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995418.1|2477603_2477900_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
WP_000100847.1|2477905_2478691_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186848.1|2478687_2479368_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000149537.1|2479364_2479547_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000548516.1|2479519_2479711_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_021533932.1|2479721_2480003_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
WP_000763374.1|2480101_2480323_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000002139.1|2480322_2480649_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000490213.1|2480632_2480872_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000088653.1|2481011_2481248_+	excisionase	NA	NA	NA	NA	NA
WP_000741335.1|2481237_2482380_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000444487.1|2482493_2483744_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248677.1|2483915_2484569_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|2484578_2485040_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001295972.1|2485093_2486200_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
2487869:2487883	attR	TTTCCCGCTGGCAGC	NA	NA	NA	NA
>prophage 10
NZ_CP024720	Escherichia coli isolate NQ3 chromosome, complete genome	5196957	2778120	2865406	5196957	capsid,transposase,plate,head,lysis,holin,portal,tail,terminase,integrase,tRNA	Burkholderia_virus(25.35%)	104	2796343:2796359	2858873:2858889
WP_001295930.1|2778120_2778906_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899600.1|2779041_2779821_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436917.1|2779797_2780691_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011610.1|2780844_2781591_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350057.1|2781587_2781770_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056492.1|2781821_2783054_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000570547.1|2783090_2784077_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551259.1|2784073_2785822_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
WP_000705731.1|2785858_2788123_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|2788328_2788613_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|2788772_2790446_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|2790556_2791240_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_029364556.1|2791412_2792195_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_001281701.1|2792338_2792728_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
WP_001170114.1|2792699_2793149_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
WP_000206212.1|2793150_2793357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000631813.1|2793346_2793577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000132039.1|2793573_2794257_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
WP_000763554.1|2794253_2794469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295929.1|2794483_2794780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000632576.1|2794789_2795062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|2795350_2795881_-	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000843446.1|2795908_2796178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000960679.1|2796180_2797347_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
2796343:2796359	attL	CACTGCACCGGCGTCCA	NA	NA	NA	NA
WP_000186588.1|2797357_2799127_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
WP_001095645.1|2799142_2799460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000533817.1|2799459_2800380_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
WP_000047759.1|2800390_2800699_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
WP_000123378.1|2800751_2800940_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000031013.1|2801033_2801390_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000783854.1|2801506_2802271_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_001069611.1|2802461_2802677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000972294.1|2802675_2803080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194951.1|2803055_2803784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000793146.1|2803914_2804265_+	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_001104440.1|2804267_2805008_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000264665.1|2804991_2805642_+	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
WP_000175099.1|2805638_2805965_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
WP_000227701.1|2805964_2806276_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000124060.1|2806275_2806821_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
WP_000167500.1|2806817_2808413_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	6.5e-185
WP_000090684.1|2808412_2809909_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
WP_000117548.1|2809889_2810711_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
WP_000135514.1|2810713_2811172_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_001273074.1|2811386_2812502_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_001286908.1|2812516_2813470_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_000537457.1|2813479_2813818_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_000271668.1|2813819_2814266_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_001101804.1|2814265_2814730_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_012602372.1|2814726_2814981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729834.1|2814970_2816398_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_000034294.1|2816397_2816919_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
WP_000110114.1|2816921_2817203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084213.1|2817300_2817636_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001202894.1|2817559_2817718_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000016538.1|2817793_2820745_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
WP_000458387.1|2820744_2821629_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_012602373.1|2821625_2821841_+	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000808007.1|2821828_2822983_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
WP_000148266.1|2822979_2823576_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
WP_000859111.1|2823630_2823978_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_001219098.1|2823968_2825072_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
WP_000138756.1|2825064_2825643_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_074162941.1|2825645_2826926_+|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	44.1	2.7e-40
WP_000072165.1|2826932_2827547_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
WP_001486917.1|2827546_2828029_-|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	44.7	7.5e-28
WP_064767240.1|2828069_2828510_-|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	55.6	7.1e-41
WP_000904922.1|2828569_2829142_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_000445240.1|2829397_2830681_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057158.1|2830751_2831840_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
WP_000642852.1|2832038_2832731_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000194832.1|2832860_2834621_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_001295917.1|2835026_2835884_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292822.1|2835938_2838221_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000468308.1|2838540_2838759_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001576679.1|2838840_2840004_-	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	97.4	5.9e-204
WP_000978911.1|2840003_2840483_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_000785970.1|2842936_2843056_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|2843088_2843364_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|2843420_2843939_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001576673.1|2843951_2845142_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	3.1e-224
WP_001576672.1|2845453_2845930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001576671.1|2846370_2846748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001016257.1|2847801_2848548_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|2848562_2850104_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001576667.1|2850363_2852988_-|tail	phage tail protein	tail	Q858V4	Yersinia_virus	95.7	0.0e+00
WP_001576666.1|2852998_2853529_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	99.4	2.3e-102
WP_001121498.1|2853521_2854430_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	1.7e-161
WP_000127163.1|2854434_2854782_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001576664.1|2854778_2855414_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	1.2e-113
WP_001001786.1|2855480_2855933_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	100.0	8.2e-77
WP_000917151.1|2855925_2856393_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	100.0	6.1e-83
WP_001576659.1|2856500_2856926_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	93.6	1.5e-64
WP_001576658.1|2856913_2857339_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	96.5	1.0e-57
WP_001576656.1|2857353_2857851_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	3.4e-92
WP_000123124.1|2857850_2858132_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_000846399.1|2858135_2858339_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988633.1|2858338_2858848_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_001576654.1|2858947_2859691_-|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	98.8	1.6e-125
2858873:2858889	attR	TGGACGCCGGTGCAGTG	NA	NA	NA	NA
WP_001576652.1|2859694_2860768_-|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	98.9	2.2e-200
WP_001085955.1|2860826_2861681_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MH0	Enterobacteria_phage	98.2	5.2e-133
WP_000156861.1|2861854_2863627_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001576650.1|2863626_2864661_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	98.8	7.9e-200
WP_001576649.1|2864986_2865406_-	hypothetical protein	NA	Q6K1E9	Salmonella_virus	76.3	5.7e-56
>prophage 11
NZ_CP024720	Escherichia coli isolate NQ3 chromosome, complete genome	5196957	2868722	2929463	5196957	capsid,transposase,plate,head,holin,portal,tail,terminase,integrase,tRNA	Enterobacteria_phage(71.19%)	72	2881801:2881820	2921808:2921827
WP_001576643.1|2868722_2871002_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.9	0.0e+00
WP_001576641.1|2870991_2871267_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	98.9	1.9e-44
WP_001576640.1|2871263_2871488_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	97.3	1.5e-34
WP_001576638.1|2871487_2871790_-	hypothetical protein	NA	Q7Y4C1	Escherichia_virus	96.0	1.6e-44
WP_001576637.1|2871789_2872014_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	5.2e-32
WP_000217677.1|2872077_2872578_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_001576635.1|2872755_2873112_-	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	98.3	2.0e-62
WP_000072552.1|2873216_2873528_+	helix-turn-helix transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	100.0	4.3e-53
WP_000023390.1|2873621_2874617_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	100.0	5.4e-190
WP_000067979.1|2874648_2875446_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_000109283.1|2875542_2876691_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165876.1|2877004_2877631_+	hydrolase	NA	NA	NA	NA	NA
WP_000534666.1|2877666_2878530_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213098.1|2878531_2879149_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850306.1|2879159_2881604_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
2881801:2881820	attL	AAAGCGCCCGCAGGCGCTTT	NA	NA	NA	NA
WP_000023737.1|2881903_2882896_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.2	1.3e-103
WP_001368591.1|2882965_2883307_-	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
WP_001204236.1|2883411_2883933_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000856387.1|2883937_2884360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287828.1|2884366_2884558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000776267.1|2884695_2885046_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	8.1e-56
WP_000159455.1|2885056_2885335_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
WP_000514277.1|2885346_2885589_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021715.1|2885585_2885699_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	1.8e-09
WP_000543036.1|2885792_2886203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|2886226_2886430_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153700.1|2886426_2886693_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000104290.1|2886689_2886989_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	2.4e-40
WP_000013455.1|2887311_2887542_+	hypothetical protein	NA	A0A0A7NV48	Enterobacteria_phage	97.4	9.1e-32
WP_000599382.1|2887614_2887980_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_000123489.1|2887986_2890809_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.4	0.0e+00
WP_000686485.1|2890885_2891845_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	4.2e-179
WP_000211282.1|2891849_2892164_+	plasmid partition protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.3	4.1e-19
WP_000193205.1|2892247_2893090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068329.1|2893129_2893627_-	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_001300563.1|2893834_2894947_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000236495.1|2895700_2896225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000087814.1|2896239_2897286_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_000613780.1|2897285_2899037_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_001262655.1|2899191_2900028_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
WP_001055083.1|2900051_2901104_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	1.4e-188
WP_000632309.1|2901149_2901950_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	6.9e-127
WP_000063100.1|2902051_2902546_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000864901.1|2902545_2902746_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_001342221.1|2902748_2903072_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000072341.1|2903068_2903461_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	1.9e-69
WP_000780577.1|2903457_2903853_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	1.0e-59
WP_000202148.1|2903991_2905869_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	80.2	2.7e-299
WP_000921127.1|2905892_2906360_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
WP_000356366.1|2906352_2906988_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
WP_001271941.1|2906984_2907566_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	3.3e-102
WP_000213444.1|2907562_2907913_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	3.5e-59
WP_001111954.1|2907916_2908813_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
WP_000071703.1|2908805_2909336_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	3.6e-92
WP_032140708.1|2909338_2911561_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	65.0	3.8e-183
WP_001554335.1|2911562_2912090_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.7	2.6e-90
WP_000972134.1|2912118_2912652_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	4.2e-96
WP_032142265.1|2912654_2913212_-	hypothetical protein	NA	A0A0A7NPY7	Enterobacteria_phage	88.5	5.0e-84
WP_000905061.1|2913430_2914030_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_000979945.1|2914058_2914547_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000853410.1|2914559_2917367_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.1	0.0e+00
WP_000333503.1|2917353_2917509_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651577.1|2917517_2917892_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	9.9e-36
WP_000290462.1|2917947_2918460_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000005447.1|2918459_2919644_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	8.4e-222
WP_000132830.1|2919801_2920911_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000488106.1|2920951_2921212_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|2921403_2921544_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000886683.1|2921849_2923142_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
2921808:2921827	attR	AAAGCGCCCGCAGGCGCTTT	NA	NA	NA	NA
WP_000067797.1|2923232_2924576_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|2924586_2925198_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077041.1|2925356_2929463_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
>prophage 13
NZ_CP024720	Escherichia coli isolate NQ3 chromosome, complete genome	5196957	3888496	3982104	5196957	integrase,lysis,portal,protease,tail,terminase,transposase,tRNA	Enterobacteria_phage(39.34%)	99	3939188:3939203	3985715:3985730
WP_001300563.1|3888496_3889609_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_001118464.1|3889871_3891002_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000516135.1|3891090_3893007_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_000843689.1|3893377_3893782_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001102393.1|3893807_3894521_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528533.1|3894669_3895236_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001094685.1|3895270_3895858_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130187.1|3895972_3896926_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
WP_001112568.1|3897204_3898635_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000906193.1|3898704_3899481_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_000738712.1|3899520_3899817_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_000781072.1|3900030_3901317_-	threonine synthase	NA	NA	NA	NA	NA
WP_000241659.1|3901317_3902250_-	homoserine kinase	NA	NA	NA	NA	NA
WP_001264707.1|3902251_3904714_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_001386572.1|3904795_3904861_-	thr operon leader peptide	NA	NA	NA	NA	NA
WP_001223200.1|3905074_3905761_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001295754.1|3906160_3906301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|3906396_3907113_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_000920358.1|3907172_3908525_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001219582.1|3908582_3910007_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.9	3.2e-10
WP_001188689.1|3910006_3910696_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_000875487.1|3910708_3911182_-	protein CreA	NA	NA	NA	NA	NA
WP_000371666.1|3911392_3912262_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000942350.1|3912258_3912906_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_001531361.1|3912957_3913485_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000068677.1|3913563_3913890_-	trp operon repressor	NA	NA	NA	NA	NA
WP_000409419.1|3913979_3915917_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046754.1|3916123_3917791_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.7	1.0e-39
WP_000093834.1|3917911_3919144_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
WP_001295751.1|3919164_3920547_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132966.1|3920595_3921564_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_000124608.1|3921669_3922314_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_000105853.1|3922341_3923358_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_001293116.1|3923358_3924690_-	type II toxin-antitoxin system HipA family toxin YjjJ	NA	NA	NA	NA	NA
WP_000224879.1|3924856_3925576_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816460.1|3925632_3926856_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000477800.1|3926907_3928230_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.5	1.5e-78
WP_001295412.1|3928307_3929087_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001143221.1|3929344_3930895_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001088370.1|3930866_3931730_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_000563043.1|3931964_3932744_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001298490.1|3932740_3933814_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|3933935_3934097_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001531357.1|3934223_3934829_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202563.1|3935221_3936808_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001217535.1|3937027_3937276_+	DinI family protein	NA	A5LH55	Enterobacteria_phage	96.3	3.5e-37
WP_000389073.1|3937722_3938757_+	hypothetical protein	NA	A4KWR9	Enterobacteria_phage	41.8	7.1e-76
WP_000954672.1|3938855_3939614_+	hypothetical protein	NA	NA	NA	NA	NA
3939188:3939203	attL	TGATAATGAATTTGAA	NA	NA	NA	NA
WP_001555785.1|3939917_3940211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001555784.1|3940253_3941294_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.6	2.4e-124
WP_000654148.1|3941303_3941585_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	51.1	2.4e-18
WP_021548541.1|3941584_3943957_-|tail	phage tail fiber protein	tail	A0A1X7QGG5	Escherichia_phage	70.4	1.8e-170
WP_021548540.1|3944017_3947431_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.6	0.0e+00
WP_011478365.1|3947491_3948139_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.4	4.0e-109
WP_032142951.1|3948036_3948780_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	4.5e-149
WP_001152386.1|3948784_3949483_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	1.0e-134
WP_000447253.1|3949492_3949822_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000372035.1|3949821_3952878_-|tail	phage tail tape measure protein	tail	A5LH38	Enterobacteria_phage	99.5	0.0e+00
WP_001161009.1|3952849_3953179_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001298500.1|3953187_3953574_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
WP_000211119.1|3953634_3954378_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.2	1.4e-129
WP_001079398.1|3954388_3954790_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000677123.1|3954786_3955377_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.1	1.6e-80
WP_001283153.1|3955388_3955664_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3955656_3955980_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001360054.1|3956066_3958094_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.7	0.0e+00
WP_011478361.1|3958038_3959619_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	100.0	4.3e-290
WP_001072975.1|3959546_3959759_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934133.1|3959755_3961858_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.1	0.0e+00
WP_000349501.1|3961857_3962349_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	86.6	6.6e-72
WP_001139675.1|3963024_3963177_-	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	100.0	1.2e-21
WP_001341210.1|3963164_3963632_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
WP_001135250.1|3963628_3964126_-	lysozyme	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_000839596.1|3964125_3964341_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000799705.1|3964408_3965461_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.4	6.1e-208
WP_000917723.1|3965611_3965815_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	98.5	1.8e-31
WP_001033965.1|3966085_3966532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001577385.1|3966616_3966982_-	antitermination protein Q	NA	Q777W5	Enterobacteria_phage	81.8	7.9e-54
WP_001577384.1|3966999_3967989_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	4.3e-195
WP_001061386.1|3967996_3968794_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	98.5	8.3e-149
WP_000767115.1|3968813_3969203_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	99.2	3.5e-68
WP_000210170.1|3969199_3969526_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000066917.1|3969522_3970176_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_011478357.1|3970175_3970670_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	96.3	2.6e-84
WP_000061519.1|3970666_3971485_-	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.6	4.7e-123
WP_000620696.1|3971481_3971706_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_099996242.1|3971702_3972854_-	peptidase	NA	A0A0P0ZE80	Stx2-converting_phage	99.0	4.8e-214
WP_000526665.1|3972850_3973402_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	99.5	1.7e-100
WP_001191669.1|3973394_3973655_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_001311077.1|3973752_3974445_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	2.9e-121
WP_000135682.1|3975167_3975530_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000081290.1|3975595_3976420_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.0e-149
WP_000008232.1|3976547_3977084_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	100.0	7.4e-101
WP_001242727.1|3977074_3977437_+	hypothetical protein	NA	U5P092	Shigella_phage	95.8	1.7e-64
WP_000206713.1|3977436_3977793_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	74.1	7.7e-38
WP_001229296.1|3977794_3978160_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	100.0	5.1e-69
WP_000628710.1|3978156_3978951_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	49.8	2.7e-59
WP_000653746.1|3979518_3980514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001218287.1|3980889_3982104_-|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	99.3	1.6e-236
3985715:3985730	attR	TTCAAATTCATTATCA	NA	NA	NA	NA
>prophage 1
NZ_CP024721	Escherichia coli isolate NQ3 plasmid p1NQ3, complete sequence	111776	12289	53241	111776	integrase,transposase	Escherichia_phage(35.29%)	38	31089:31105	56526:56542
WP_001067834.1|12289_12994_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000874189.1|13703_14189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001267177.1|14213_14699_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000117262.1|14685_15381_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_000729220.1|15385_16516_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000964653.1|16505_17789_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000119836.1|17791_19171_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000178050.1|19274_19802_-	iron transporter	NA	NA	NA	NA	NA
WP_000118029.1|19842_21729_-	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_012372823.1|22075_22891_-	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_001067855.1|23116_23821_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000205725.1|28509_29256_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	2.4e-09
WP_000704528.1|29314_30175_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.8	6.7e-11
WP_000139321.1|30277_30838_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001309245.1|30966_31179_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
31089:31105	attL	GGCTGCGCAGTCTGCTC	NA	NA	NA	NA
WP_001233838.1|31423_31885_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	4.2e-20
WP_001298565.1|31930_32140_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_000766805.1|32177_32768_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000083819.1|33007_33268_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001365705.1|33492_33567_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130647.1|33559_34417_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000027057.1|35442_36303_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|36485_37043_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001067855.1|37469_38174_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000978817.1|39638_40100_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	3.6e-19
WP_001067855.1|40293_40998_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001553864.1|40888_41218_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	55.6	6.9e-09
WP_000454193.1|41343_41694_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|41896_42910_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001389366.1|43067_43541_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000503573.1|43671_44460_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_000679427.1|44665_45013_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|45006_45846_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|45973_46474_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001163403.1|46649_47432_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_001324342.1|47421_48945_-|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_000344784.1|50662_51523_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000935451.1|51525_53241_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
56526:56542	attR	GAGCAGACTGCGCAGCC	NA	NA	NA	NA
>prophage 2
NZ_CP024721	Escherichia coli isolate NQ3 plasmid p1NQ3, complete sequence	111776	88881	96405	111776	transposase	Stx2-converting_phage(33.33%)	7	NA	NA
WP_000086185.1|88881_89565_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
WP_001309734.1|90124_90559_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_000624688.1|90555_90906_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
WP_000080172.1|90936_92550_+|transposase	IS66-like element ISEc43 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.4	8.3e-172
WP_099996264.1|92576_93401_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000817036.1|94267_95239_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	99.4	7.0e-174
WP_000772446.1|95238_96405_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
