The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024797	Bacillus velezensis strain TJ02 chromosome, complete genome	4061552	153684	219835	4061552	tRNA,terminase,integrase,tail,plate,holin,capsid,portal	Bacillus_phage(43.18%)	82	166798:166817	220802:220821
WP_076425820.1|153684_154428_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_003225844.1|154587_155025_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_003225846.1|155045_155438_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_007410414.1|155575_156343_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_025284101.1|156356_156830_-	DUF664 domain-containing protein	NA	NA	NA	NA	NA
WP_011996201.1|156960_157404_+	DUF2521 family protein	NA	NA	NA	NA	NA
WP_007410417.1|157464_158178_+	N-acetylmuramoyl-L-alanine amidase CwlD	NA	NA	NA	NA	NA
WP_007410418.1|158257_159310_+	Mrp/NBP35 family ATP-binding protein	NA	NA	NA	NA	NA
WP_007410419.1|159342_159900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007410420.1|160007_160604_+	KinB signaling pathway activation protein	NA	NA	NA	NA	NA
WP_007410421.1|160604_161369_-	polysaccharide deacetylase family sporulation protein PdaB	NA	NA	NA	NA	NA
166798:166817	attL	GGGGACGAATTGGGGACGAA	NA	NA	NA	NA
WP_069013509.1|166902_168117_-|integrase	site-specific integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	39.2	5.6e-72
WP_025284104.1|168103_168634_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	48.4	1.6e-34
WP_100001110.1|168713_169322_-	hypothetical protein	NA	O64079	Bacillus_phage	68.8	4.0e-50
WP_025284106.1|169554_169881_-	helix-turn-helix transcriptional regulator	NA	O64078	Bacillus_phage	46.7	2.6e-16
WP_053285433.1|170040_170274_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025284108.1|170341_170536_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_025284109.1|170631_170889_+	helix-turn-helix domain-containing protein	NA	S5MNZ7	Brevibacillus_phage	57.0	1.1e-17
WP_100001111.1|170890_171169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069013506.1|171495_171690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069013505.1|171802_171988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100001112.1|171984_173973_+	hypothetical protein	NA	A0A1L2K2K3	Aeribacillus_phage	48.3	7.9e-156
WP_100001113.1|173969_174221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069013502.1|174213_174954_+	phage recombination protein Bet	NA	A8ATK8	Listeria_phage	59.8	3.9e-68
WP_100001114.1|174950_175652_+	MBL fold metallo-hydrolase	NA	A0A1L2JY21	Aeribacillus_phage	67.0	4.1e-91
WP_100001115.1|175852_176608_+	hypothetical protein	NA	U5Q085	Bacillus_phage	30.4	7.7e-11
WP_088462023.1|176613_176895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100001116.1|176869_178168_+	replicative DNA helicase	NA	Q38152	Bacillus_phage	44.7	9.5e-94
WP_069013496.1|178452_178911_+	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	66.9	9.2e-52
WP_100001119.1|178880_179573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100001121.1|179880_180132_+	DUF3850 domain-containing protein	NA	A0A059T699	Listeria_phage	62.2	1.3e-18
WP_100001124.1|180124_180400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069013491.1|180471_180675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100001126.1|180713_180935_+	hypothetical protein	NA	A0A0M3ULE9	Bacillus_phage	39.7	5.3e-05
WP_100001128.1|180982_181312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069013006.1|181308_181566_+	hypothetical protein	NA	F8WQ54	Bacillus_phage	42.3	1.2e-05
WP_100001131.1|181609_181972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100001133.1|182080_182515_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	67.9	3.8e-47
WP_100001135.1|182615_183002_+	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	59.3	1.3e-30
WP_100001140.1|183761_184106_+	structural protein	NA	Q38579	Bacillus_phage	62.3	5.2e-31
WP_100001142.1|184169_184643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100001144.1|184698_185970_+	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	44.9	1.0e-92
WP_100001146.1|186104_186353_+	hypothetical protein	NA	A8ATN7	Listeria_phage	36.5	7.8e-05
WP_100001149.1|186445_187483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100001151.1|187516_188398_+|terminase	terminase	terminase	D2J000	Enterococcus_phage	42.2	1.0e-35
WP_100001153.1|188397_189744_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	62.5	6.5e-154
WP_100001155.1|189709_191257_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	51.7	4.4e-146
WP_100001157.1|191240_192149_+	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	39.6	7.0e-51
WP_100001159.1|192185_192536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100001161.1|192765_193389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100001163.1|193423_194611_+|terminase	terminase	terminase	A0A1B1P7E4	Bacillus_phage	52.8	7.7e-82
WP_100001165.1|194640_195576_+|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	65.0	1.6e-106
WP_100001167.1|195587_195938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100001704.1|195943_196336_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	37.7	1.9e-13
WP_100001170.1|196332_196695_+	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_100001172.1|196691_197195_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	46.9	8.3e-38
WP_100001174.1|197208_197646_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_100001176.1|197642_197834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100001178.1|197834_199235_+|tail	phage tail sheath protein	tail	A0A0A7RTT5	Clostridium_phage	40.9	2.9e-80
WP_019712741.1|199236_199680_+|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	46.5	5.8e-27
WP_129192939.1|200047_200137_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_100001180.1|200281_200731_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	38.2	2.0e-11
WP_100001182.1|200946_206253_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	44.4	3.1e-42
WP_069013434.1|206245_206905_+	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	49.1	4.5e-07
WP_100001184.1|206918_207899_+|portal	phage portal protein	portal	H7BV96	unidentified_phage	32.0	7.1e-41
WP_069013436.1|207895_208162_+	DUF2577 family protein	NA	NA	NA	NA	NA
WP_069013437.1|208175_208601_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.2	1.1e-11
WP_100001186.1|208593_209640_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.6	1.6e-70
WP_025284118.1|209623_210202_+	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	33.1	1.3e-13
WP_100001188.1|210198_210471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025284120.1|210473_211571_+	hypothetical protein	NA	M4ZRP1	Bacillus_phage	53.5	3.1e-13
WP_069013440.1|211582_211921_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_069013441.1|211917_212082_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	58.5	1.1e-12
WP_069013442.1|212177_213080_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_025284124.1|213150_213429_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	70.7	1.5e-28
WP_025284125.1|213441_213705_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	69.0	1.1e-25
WP_100001190.1|213760_214732_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	67.4	9.1e-65
WP_061862609.1|215294_215837_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_022552615.1|215850_216408_+	SMI1/KNR4 family protein	NA	O64022	Bacillus_phage	53.8	2.4e-46
WP_100001192.1|216502_216781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100001194.1|216787_218497_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	54.8	3.4e-67
WP_021494571.1|218707_219835_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	48.3	7.3e-90
220802:220821	attR	GGGGACGAATTGGGGACGAA	NA	NA	NA	NA
>prophage 2
NZ_CP024797	Bacillus velezensis strain TJ02 chromosome, complete genome	4061552	724167	734058	4061552		Synechococcus_phage(50.0%)	9	NA	NA
WP_007408896.1|724167_725460_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	4.5e-19
WP_007408897.1|725535_726255_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.7	5.7e-48
WP_003155758.1|726254_726509_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	4.7e-05
WP_007408898.1|726505_727189_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_061046488.1|727172_729401_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.5	5.5e-158
WP_007609856.1|729376_730807_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	6.2e-54
WP_094031563.1|730898_731939_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.9	3.7e-64
WP_007408902.1|731935_732523_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.8	1.3e-26
WP_094031564.1|732519_734058_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.8	6.7e-78
>prophage 3
NZ_CP024797	Bacillus velezensis strain TJ02 chromosome, complete genome	4061552	1294117	1326151	4061552	terminase,tail,plate,holin,portal	Bacillus_phage(32.26%)	42	NA	NA
WP_100001381.1|1294117_1295254_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.6	8.3e-94
WP_003154881.1|1295243_1295378_+	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_015417280.1|1295520_1296474_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	69.3	1.1e-62
WP_007610770.1|1296511_1296889_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	41.4	1.5e-15
WP_047935636.1|1296998_1297604_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	48.3	1.0e-42
WP_007610775.1|1297722_1298313_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
WP_003154871.1|1298461_1298800_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	8.4e-18
WP_007407285.1|1298990_1299170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100001383.1|1299159_1299987_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	49.0	2.2e-19
WP_014417520.1|1299886_1300687_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	45.3	3.0e-58
WP_100001386.1|1300951_1301293_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_100001388.1|1301282_1301486_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	51.5	1.4e-12
WP_007407279.1|1301599_1302112_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	44.6	3.8e-22
WP_100001390.1|1302224_1303022_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	49.8	1.6e-59
WP_032871272.1|1303018_1304317_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	59.2	7.2e-150
WP_094031916.1|1304365_1305757_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.8	3.0e-138
WP_094031665.1|1305776_1306622_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	57.6	9.7e-55
WP_007407274.1|1306648_1307584_+|portal	phage portal protein	portal	A0A1B1P7E3	Bacillus_phage	62.8	3.3e-104
WP_015239680.1|1307600_1307984_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_007407272.1|1307980_1308337_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_015239681.1|1308333_1308837_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	41.1	2.1e-36
WP_032871277.1|1308833_1309280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007610809.1|1309276_1309486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015239683.1|1309485_1310883_+	phage-like element PBSX protein xkdK	NA	A0A0A7RTT5	Clostridium_phage	40.4	9.0e-82
WP_003154837.1|1310884_1311328_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_094031666.1|1311404_1311851_+|portal	phage portal protein	portal	A0A0K2CNS3	Brevibacillus_phage	35.8	1.0e-10
WP_015239684.1|1311892_1312045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094031667.1|1312032_1317321_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	46.6	2.0e-41
WP_007610816.1|1317313_1317973_+	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	45.3	1.8e-08
WP_100001393.1|1317986_1318964_+|portal	phage portal protein	portal	A0A1L6BY20	Clostridium_phage	30.6	6.4e-34
WP_007610818.1|1318963_1319230_+	DUF2577 family protein	NA	S6C459	Thermus_phage	38.6	1.2e-06
WP_094031917.1|1319333_1319759_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.9	2.5e-11
WP_015239688.1|1319751_1320798_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.1	1.3e-69
WP_015239689.1|1320781_1321360_+	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	28.9	3.1e-12
WP_060674884.1|1321356_1321629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052827325.1|1321631_1323263_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	33.5	1.6e-53
WP_043021266.1|1323275_1323647_+	YomQ/XkdW protein, phage-like element PBSX	NA	NA	NA	NA	NA
WP_012117366.1|1323651_1323849_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	63.6	2.5e-14
WP_015239693.1|1323905_1324667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154815.1|1324718_1324982_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	63.1	8.8e-23
WP_003154813.1|1324995_1325259_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
WP_020955695.1|1325272_1326151_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	60.2	1.1e-80
>prophage 4
NZ_CP024797	Bacillus velezensis strain TJ02 chromosome, complete genome	4061552	1882946	1889160	4061552		Bacillus_phage(50.0%)	7	NA	NA
WP_003154061.1|1882946_1883339_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	59.1	3.8e-30
WP_007410373.1|1883298_1885401_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	85.7	0.0e+00
WP_012117608.1|1885418_1886408_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.0	1.1e-155
WP_012117609.1|1886456_1887077_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	47.9	2.1e-46
WP_020955856.1|1887126_1887885_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.4	4.8e-53
WP_007410369.1|1887918_1888143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015417523.1|1888191_1889160_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.9	8.0e-53
>prophage 5
NZ_CP024797	Bacillus velezensis strain TJ02 chromosome, complete genome	4061552	1969924	2130236	4061552	tRNA,bacteriocin,head,terminase,protease,integrase,tail,plate,holin,capsid,portal	Bacillus_phage(44.9%)	99	2124076:2124091	2126048:2126063
WP_052827494.1|1969924_1970134_+|bacteriocin	bacteriocin-like WGxF protein	bacteriocin	NA	NA	NA	NA
WP_031379074.1|1970393_1970705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094031748.1|1970997_1972134_-|holin	choline esterase	holin	NA	NA	NA	NA
WP_094031749.1|1972378_1973878_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_017417895.1|1974327_1974639_+	DUF4870 domain-containing protein	NA	A0A2H4J741	uncultured_Caudovirales_phage	41.7	4.5e-10
WP_094031750.1|1974693_1976091_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.4	8.9e-29
WP_094031751.1|1976093_1976801_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.0	4.0e-38
WP_042635241.1|1976944_1978216_-	glucuronoxylanase	NA	NA	NA	NA	NA
WP_094031752.1|1978277_1979816_-	carbohydrate-binding protein	NA	NA	NA	NA	NA
WP_094031753.1|1980140_1987997_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	22.5	6.3e-124
WP_094031754.1|1988085_2004174_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.2	2.5e-90
WP_094031755.1|2004218_2016167_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	28.1	2.2e-115
WP_017417904.1|2016186_2017389_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_007410137.1|2017948_2018734_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_014305098.1|2018746_2019409_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_094031756.1|2019426_2020128_-	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_017417906.1|2020152_2021598_-	GntP family permease	NA	NA	NA	NA	NA
WP_094031757.1|2021902_2023099_-	cytochrome P450	NA	NA	NA	NA	NA
WP_007410132.1|2023100_2024120_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_059367361.1|2024122_2024824_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_094031758.1|2024820_2025981_-	8-amino-7-oxononanoate synthase	NA	D2TEZ5	Emiliania_huxleyi_virus	27.4	5.4e-32
WP_085342051.1|2025970_2027317_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	23.0	8.6e-13
WP_094031759.1|2027316_2028084_-	6-carboxyhexanoate--CoA ligase	NA	NA	NA	NA	NA
WP_014418060.1|2028350_2028758_+	GtrA family protein	NA	NA	NA	NA	NA
WP_038463964.1|2028764_2029658_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	55.3	6.8e-83
WP_016935933.1|2029732_2030323_+	DedA family protein	NA	NA	NA	NA	NA
WP_038463969.1|2030378_2031908_-	acyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
WP_020955908.1|2031925_2032705_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_007410122.1|2032718_2033618_-	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
WP_007410121.1|2033633_2033846_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_032865960.1|2033842_2035192_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_042635251.1|2035213_2036854_-	AMP-binding protein	NA	Q75ZG1	Hepacivirus	26.4	1.4e-46
WP_007410118.1|2036898_2038041_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_094031760.1|2038181_2039720_-	family 10 glycosylhydrolase	NA	NA	NA	NA	NA
WP_007410116.1|2039841_2040222_-	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_038463981.1|2040294_2044098_-	non-ribosomal peptide synthase	NA	A0A2K9KZV5	Tupanvirus	26.7	1.4e-84
WP_094031761.1|2044116_2054892_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.5	1.9e-158
WP_100001466.1|2054917_2062567_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	26.2	3.1e-75
WP_100001468.1|2062582_2070280_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.5	2.5e-157
WP_100001471.1|2070305_2077964_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	23.4	7.4e-77
WP_020955915.1|2078443_2079919_-	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_039063411.1|2079937_2080906_-	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_007407362.1|2081021_2082410_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_053104023.1|2082638_2083181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100001473.1|2083523_2085350_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	51.6	4.2e-103
WP_053285546.1|2085364_2085805_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_100001475.1|2085999_2086680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100001477.1|2086786_2087797_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1J0MS59	Bacillus_phage	97.6	1.0e-188
WP_100001479.1|2087852_2088116_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	67.8	1.5e-25
WP_046559637.1|2088130_2088343_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	59.4	1.4e-15
WP_013353491.1|2088393_2088582_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	96.8	5.3e-30
WP_100001481.1|2088578_2088941_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	90.0	2.7e-54
WP_100001484.1|2088937_2090215_-|plate	BppU family phage baseplate upper protein	plate	D6R402	Bacillus_phage	77.6	3.8e-143
WP_100001486.1|2090227_2092792_-	peptidase G2	NA	D6R401	Bacillus_phage	57.0	2.9e-288
WP_100001488.1|2092842_2094546_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	57.2	2.7e-181
WP_100001490.1|2094560_2095400_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	59.0	2.5e-95
WP_100001492.1|2095393_2099881_-|tail	phage tail tape measure protein	tail	A0A1Q1PVX7	Staphylococcus_phage	31.5	2.7e-63
WP_049627390.1|2100086_2100455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014418477.1|2100513_2101128_-|tail	tail protein	tail	A0A2H4J8F3	uncultured_Caudovirales_phage	33.9	1.1e-23
WP_100001494.1|2101142_2101526_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_100001496.1|2101522_2101921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100001498.1|2101917_2102235_-|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	36.3	1.4e-11
WP_100001500.1|2102224_2102527_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	40.5	2.6e-10
WP_100001503.1|2102544_2102943_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	43.6	1.4e-11
WP_088005403.1|2102970_2104263_-|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	47.6	9.8e-91
WP_100001505.1|2104300_2104927_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	79.1	1.5e-84
WP_100001507.1|2104889_2106170_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	63.3	2.6e-152
WP_100001509.1|2106358_2108065_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	61.8	1.1e-203
WP_014418488.1|2108061_2108577_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	44.6	9.8e-34
WP_048367493.1|2108805_2109171_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	51.7	1.7e-27
WP_044053307.1|2109251_2109782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100001513.1|2109781_2111116_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_100001516.1|2111413_2111881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024085426.1|2112111_2112654_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	66.7	4.7e-63
WP_024085427.1|2112650_2113103_-	DUF1492 domain-containing protein	NA	S6AVV9	Thermus_phage	57.4	4.4e-38
WP_024085429.1|2113422_2114637_-	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_017417492.1|2114914_2115349_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	70.0	1.2e-48
WP_017417491.1|2115456_2115807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024085433.1|2115950_2116364_-	hypothetical protein	NA	A0A1P8CWZ8	Bacillus_phage	94.7	4.7e-71
WP_014304486.1|2116368_2116623_-	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	39.8	8.5e-07
WP_038458317.1|2116622_2116835_-	hypothetical protein	NA	A0A0A7AR03	Bacillus_phage	60.3	5.4e-15
WP_024085435.1|2116831_2117212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024085436.1|2117352_2117556_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	55.4	7.5e-14
WP_157774447.1|2117787_2117943_-	BH0509 family protein	NA	NA	NA	NA	NA
WP_024085439.1|2118050_2118599_-	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	36.5	2.0e-05
WP_038458325.1|2118914_2119748_-	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	34.8	3.5e-33
WP_100001518.1|2119731_2120604_-	replication protein	NA	V9QKF6	Oenococcus_phage	45.1	6.3e-49
WP_024085444.1|2120590_2120815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024085445.1|2120832_2121156_-	DUF771 domain-containing protein	NA	Q9MC19	Lactococcus_phage	39.8	6.0e-13
WP_041482367.1|2121222_2121426_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014305167.1|2121591_2121990_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_048367326.1|2122421_2123522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024085448.1|2123764_2124871_+|integrase	site-specific integrase	integrase	Q5YAA6	Bacillus_phage	58.0	1.7e-112
2124076:2124091	attL	TCAAGAGTTTTTAAAT	NA	NA	NA	NA
WP_094031767.1|2125144_2125690_-|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	49.2	7.2e-43
WP_003153848.1|2126005_2126236_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
2126048:2126063	attR	ATTTAAAAACTCTTGA	NA	NA	NA	NA
WP_094031768.1|2126479_2128255_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_007407356.1|2128301_2129477_-	MFS transporter	NA	NA	NA	NA	NA
WP_003153841.1|2129620_2129923_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_062848359.1|2129969_2130236_-|tRNA	threonyl-tRNA synthetase	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP024797	Bacillus velezensis strain TJ02 chromosome, complete genome	4061552	2226485	2239458	4061552		Bacillus_phage(90.0%)	14	NA	NA
WP_003153663.1|2226485_2226911_+	SDR family NAD(P)-dependent oxidoreductase	NA	A0A1V0SAI8	Catovirus	35.6	2.7e-13
WP_003153662.1|2226944_2227121_-	hypothetical protein	NA	O64196	Bacillus_phage	93.1	6.5e-22
WP_012117786.1|2227483_2227837_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_032869991.1|2228291_2228528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015240044.1|2228653_2229028_+	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	52.0	9.0e-29
WP_094031786.1|2229261_2229714_-	hypothetical protein	NA	O64117	Bacillus_phage	77.3	4.8e-61
WP_059368422.1|2230081_2231218_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	75.9	1.0e-163
WP_032870000.1|2231207_2231390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007612065.1|2232427_2232766_-	hypothetical protein	NA	A0A1P8CWM9	Bacillus_phage	60.2	3.8e-26
WP_094031787.1|2233524_2234121_-	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	82.4	7.5e-86
WP_094031788.1|2234122_2235874_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	68.0	6.6e-231
WP_076982865.1|2235910_2236345_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_094031789.1|2236609_2237575_+	endonuclease	NA	A0A1P8CWK6	Bacillus_phage	75.0	5.5e-78
WP_032866268.1|2237790_2239458_+	recombinase family protein	NA	O64015	Bacillus_phage	91.2	4.9e-276
>prophage 7
NZ_CP024797	Bacillus velezensis strain TJ02 chromosome, complete genome	4061552	2375248	2381501	4061552		Staphylococcus_phage(66.67%)	9	NA	NA
WP_007409428.1|2375248_2375842_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.6e-14
WP_100001543.1|2375831_2376587_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.7	2.2e-10
WP_003153376.1|2376794_2376884_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_012117889.1|2376971_2377493_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003153373.1|2377558_2377933_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003153372.1|2378049_2378514_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
WP_094031815.1|2378546_2379743_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	1.6e-116
WP_007409425.1|2379757_2380405_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	1.5e-39
WP_094031816.1|2380385_2381501_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.6	1.3e-54
>prophage 8
NZ_CP024797	Bacillus velezensis strain TJ02 chromosome, complete genome	4061552	3723787	3773031	4061552	coat,protease	Staphylococcus_phage(16.67%)	51	NA	NA
WP_003151043.1|3723787_3724447_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_020957977.1|3724552_3724741_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_020957978.1|3724778_3725198_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015240784.1|3725583_3726963_+	amino acid permease	NA	NA	NA	NA	NA
WP_039063796.1|3727027_3727528_-	YwgA family protein	NA	NA	NA	NA	NA
WP_007407654.1|3727567_3728869_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.5	1.0e-23
WP_003151034.1|3729029_3729254_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_007407656.1|3729456_3730230_+	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
WP_079891039.1|3730529_3730805_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007407658.1|3730805_3731360_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_020957981.1|3731457_3732378_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.6	1.7e-36
WP_025285429.1|3732374_3733328_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_020957983.1|3733317_3734154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020957984.1|3734144_3734942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100001632.1|3734910_3735834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003151018.1|3735882_3736062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007407665.1|3736213_3737077_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_007407666.1|3737123_3738023_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	40.2	2.1e-07
WP_015240790.1|3738138_3739116_+	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_003151012.1|3739153_3740125_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003151011.1|3740386_3741151_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_100001634.1|3741270_3742050_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_021494772.1|3742066_3743266_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_007407671.1|3743278_3744460_-	MFS transporter	NA	NA	NA	NA	NA
WP_038464381.1|3744456_3745875_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_020957990.1|3745892_3746654_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.5	1.7e-21
WP_038464384.1|3746650_3747361_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_015418458.1|3747350_3747965_-	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
WP_038464387.1|3748126_3749365_-	MFS transporter	NA	NA	NA	NA	NA
WP_094031371.1|3749587_3750790_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.1	3.2e-27
WP_039063798.1|3750822_3752241_-	amino acid permease	NA	NA	NA	NA	NA
WP_094031372.1|3752265_3753948_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_015240796.1|3754019_3755567_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_007407680.1|3755775_3757062_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_076424692.1|3757295_3758231_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	28.9	3.7e-23
WP_012118715.1|3758232_3758931_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.4	9.2e-35
WP_094031373.1|3759122_3759989_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_025285445.1|3760009_3760714_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_076424918.1|3760778_3761705_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	45.9	1.1e-43
WP_003150986.1|3762053_3762509_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_015418465.1|3762505_3763354_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.3	5.4e-37
WP_007407684.1|3763374_3764322_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	42.9	5.9e-69
WP_012118722.1|3764324_3765062_-	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	42.3	6.5e-47
WP_094031374.1|3765089_3766094_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_094031375.1|3766095_3766839_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_012118725.1|3766828_3767950_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_032868197.1|3767949_3768813_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012118727.1|3768813_3769983_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_094031376.1|3770005_3771430_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_094031377.1|3771434_3772205_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	26.3	4.4e-06
WP_094031378.1|3772485_3773031_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
