The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017719	Salmonella enterica subsp. enterica serovar Hayindogo strain FDA957831-1-1 chromosome, complete genome	4765719	1114017	1119821	4765719		Enterobacteria_phage(100.0%)	8	NA	NA
WP_021000674.1|1114017_1116351_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	84.5	0.0e+00
WP_000743150.1|1116365_1116686_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001604623.1|1116682_1116910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023243884.1|1116906_1117458_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	71.3	8.6e-36
WP_001604627.1|1117454_1117721_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	1.7e-29
WP_024155472.1|1118258_1118996_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.0	8.4e-79
WP_000984211.1|1118992_1119238_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
WP_000210078.1|1119254_1119821_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	7.7e-56
>prophage 2
NZ_CP017719	Salmonella enterica subsp. enterica serovar Hayindogo strain FDA957831-1-1 chromosome, complete genome	4765719	1190678	1237293	4765719	lysis,head,integrase,tail,holin,plate	Salmonella_phage(27.91%)	56	1188411:1188425	1223563:1223577
1188411:1188425	attL	GGGCGTGGCGGCGTG	NA	NA	NA	NA
WP_001007935.1|1190678_1191908_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.1	6.4e-233
WP_014344516.1|1191885_1192170_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	87.2	1.1e-42
WP_001237032.1|1192210_1192450_-	DUF4060 family protein	NA	H6WRW9	Salmonella_phage	97.5	2.2e-36
WP_001539618.1|1192492_1193650_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_000023721.1|1193612_1196792_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	68.1	0.0e+00
WP_000799630.1|1196932_1197268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000682660.1|1197343_1197550_-	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
WP_000103933.1|1197554_1197830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024135672.1|1198090_1198270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001224472.1|1198713_1199139_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	56.3	1.2e-13
WP_001033909.1|1199235_1199490_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	59.4	1.2e-16
WP_001533160.1|1199476_1199971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729537.1|1200017_1201025_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.5	7.6e-123
WP_157872077.1|1200936_1201479_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.8	7.1e-67
WP_000089421.1|1201493_1201889_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	38.1	1.7e-17
WP_000529512.1|1202175_1203306_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_001237395.1|1203702_1205682_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_109267269.1|1206370_1206619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000940752.1|1206682_1207282_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	1.2e-96
WP_000784703.1|1207278_1207473_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	6.1e-13
WP_000926965.1|1207454_1207751_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	79.8	1.1e-34
WP_000639985.1|1207747_1208302_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	64.6	1.7e-63
WP_001668190.1|1208508_1209045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001525456.1|1209177_1209480_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_001208105.1|1209457_1209997_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	71.2	5.7e-77
WP_001080014.1|1210097_1210562_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	81.7	6.3e-56
WP_001113128.1|1210769_1210952_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_001668530.1|1210981_1211224_+	DUF2514 family protein	NA	NA	NA	NA	NA
WP_000877749.1|1211249_1211810_-	YfbU family protein	NA	NA	NA	NA	NA
WP_001118129.1|1211897_1212524_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	98.1	2.3e-106
WP_001130804.1|1212526_1214146_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	81.4	3.9e-262
WP_000266184.1|1214145_1215666_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	43.3	1.2e-103
WP_000552017.1|1215706_1216396_+|head	head morphogenesis protein	head	H9C0V1	Aeromonas_phage	49.6	4.5e-58
WP_000587354.1|1216392_1217739_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	36.4	9.3e-68
WP_001091401.1|1217740_1218223_+	hypothetical protein	NA	K4HYQ5	Acinetobacter_phage	40.6	2.2e-19
WP_001031913.1|1218222_1219251_+	hypothetical protein	NA	A0A219YBB0	Aeromonas_phage	48.7	2.3e-82
WP_000829560.1|1219254_1219602_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	3.9e-10
WP_000537614.1|1219608_1220055_+	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	40.6	2.3e-15
WP_000247613.1|1220048_1220633_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.3	2.1e-16
WP_001048637.1|1220629_1220995_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	40.5	3.0e-21
WP_000094504.1|1220979_1221525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001122278.1|1221505_1222990_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	41.0	5.2e-96
WP_000016414.1|1222990_1223437_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
WP_000101348.1|1223436_1223841_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
1223563:1223577	attR	GGGCGTGGCGGCGTG	NA	NA	NA	NA
WP_000228831.1|1223882_1224065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000741779.1|1224048_1226220_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
WP_001011706.1|1226216_1226927_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.3	4.7e-26
WP_000890115.1|1226926_1227229_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
WP_000122818.1|1227225_1228095_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
WP_000068499.1|1228075_1228753_+	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	36.4	5.4e-32
WP_001191865.1|1228765_1229122_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	1.6e-19
WP_001293657.1|1229118_1230360_+|plate	baseplate J/gp47 family protein	plate	A0A077KGW9	Edwardsiella_phage	49.9	1.2e-101
WP_001181747.1|1230361_1230964_+	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	38.9	3.3e-33
WP_000772812.1|1230953_1232408_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	74.5	2.2e-46
WP_000143177.1|1232407_1232986_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	92.6	6.3e-98
WP_001123018.1|1233927_1237293_+	DUF4765 family protein	NA	A0A0N7KZG3	Stx2-converting_phage	50.5	1.6e-310
>prophage 3
NZ_CP017719	Salmonella enterica subsp. enterica serovar Hayindogo strain FDA957831-1-1 chromosome, complete genome	4765719	1689620	1698791	4765719	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1689620_1690568_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824854.1|1690551_1691283_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1691263_1691371_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1691430_1692162_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_023243038.1|1692384_1694070_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.9e-278
WP_000598637.1|1694066_1694786_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1694832_1695300_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|1695356_1695887_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1696058_1696517_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1696757_1698791_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
NZ_CP017719	Salmonella enterica subsp. enterica serovar Hayindogo strain FDA957831-1-1 chromosome, complete genome	4765719	1766882	1773179	4765719		Enterobacteria_phage(50.0%)	6	NA	NA
WP_023244537.1|1766882_1768286_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|1768463_1769357_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1769733_1770819_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023662.1|1770818_1771718_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_023243995.1|1771765_1772644_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.3e-107
WP_001100808.1|1772648_1773179_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.1	4.8e-52
>prophage 5
NZ_CP017719	Salmonella enterica subsp. enterica serovar Hayindogo strain FDA957831-1-1 chromosome, complete genome	4765719	1883469	1890718	4765719		Morganella_phage(33.33%)	8	NA	NA
WP_023243860.1|1883469_1883889_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457663.1|1883891_1885160_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000208509.1|1885614_1885827_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|1885837_1886026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080661.1|1886285_1887479_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.2	3.0e-110
WP_000107435.1|1888127_1888439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023243859.1|1888518_1889214_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_023243858.1|1889287_1890718_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
NZ_CP017719	Salmonella enterica subsp. enterica serovar Hayindogo strain FDA957831-1-1 chromosome, complete genome	4765719	1993979	2001742	4765719	integrase	Enterobacteria_phage(28.57%)	12	1996189:1996211	2008312:2008334
WP_000856224.1|1993979_1994210_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|1994347_1994722_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_072101102.1|1994722_1995598_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|1995614_1995968_+	YebY family protein	NA	NA	NA	NA	NA
1996189:1996211	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_020438172.1|1996339_1997419_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	6.3e-99
WP_023244250.1|1997415_1998522_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	Q9QF34	Lambdoid_phage	65.0	1.4e-53
WP_001013467.1|1998552_1998783_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050883.1|1998836_1999370_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_000789530.1|1999626_1999794_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|1999858_2000047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348541.1|2000101_2000593_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
WP_023244117.1|2001145_2001742_+	hypothetical protein	NA	Q1MVL8	Enterobacteria_phage	43.1	7.8e-35
2008312:2008334	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 7
NZ_CP017719	Salmonella enterica subsp. enterica serovar Hayindogo strain FDA957831-1-1 chromosome, complete genome	4765719	2607744	2695054	4765719	lysis,tRNA,terminase,protease,head,integrase,tail,holin,portal,capsid	Salmonella_phage(38.18%)	106	2628382:2628398	2694573:2694589
WP_023893413.1|2607744_2608263_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_000272239.1|2608259_2608367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460698.1|2608572_2609019_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_000579793.1|2608998_2609793_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000205341.1|2609893_2611078_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_001222527.1|2611196_2611544_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_000487135.1|2611529_2611841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000673492.1|2611909_2612161_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001589065.1|2612356_2612455_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_000512149.1|2612593_2612842_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_001532438.1|2613155_2613797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000513733.1|2614026_2614209_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_001248993.1|2614211_2614574_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000457190.1|2614746_2615385_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_000617985.1|2615580_2616126_-	chorismate mutase	NA	NA	NA	NA	NA
WP_000908466.1|2616208_2616364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000208086.1|2616442_2616691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000190263.1|2616945_2617794_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001682351.1|2617862_2618456_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000175797.1|2618600_2619389_-	cryptic aminoglycoside nucleotidyltransferase ANT(3'')/ANT(9)	NA	NA	NA	NA	NA
WP_001537483.1|2619496_2620144_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001183699.1|2620340_2620667_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_001618317.1|2620860_2621994_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000947459.1|2622075_2622666_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000950212.1|2622659_2623457_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_000966637.1|2623450_2624263_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001748353.1|2624252_2625227_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000946091.1|2625226_2626861_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000182479.1|2627542_2627857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929973.1|2628005_2628536_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	2.8e-36
2628382:2628398	attL	CAGATAGCGCCCTAAAA	NA	NA	NA	NA
WP_021000256.1|2628618_2629662_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_001218120.1|2630000_2630468_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_000927827.1|2630620_2630893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000977725.1|2631596_2631941_+	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000789471.1|2633162_2633720_-	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	33.0	1.0e-15
WP_001535993.1|2634531_2634795_+	virulence protein PagD	NA	NA	NA	NA	NA
WP_001537306.1|2634926_2635139_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_001520581.1|2635553_2636075_+	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_000497451.1|2636265_2636505_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_001033398.1|2636994_2637783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021000253.1|2638778_2639903_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_012218897.1|2640350_2640563_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	2.5e-20
WP_000334551.1|2640816_2641488_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	1.1e-80
WP_001520226.1|2641807_2643919_-	type III secretion system effector E3 ubiquitin transferase SspH1	NA	Q9MBL9	Phage_Gifsy-2	46.9	2.1e-26
WP_031609383.1|2646147_2646348_+	phage virulence factor PagK family protein	NA	NA	NA	NA	NA
WP_000143179.1|2646444_2647029_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	84.8	1.7e-87
WP_001521136.1|2647028_2649470_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	61.8	9.5e-87
WP_000178851.1|2649523_2649766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514901.1|2649804_2653167_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	80.6	0.0e+00
WP_065304541.1|2653229_2653877_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.2	1.3e-88
WP_000662740.1|2653774_2654512_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	84.6	1.2e-128
WP_001152688.1|2654518_2655217_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	75.0	1.8e-102
WP_000447370.1|2655226_2655556_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	71.3	7.3e-43
WP_000372079.1|2655558_2658600_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	65.0	8.0e-293
WP_010989052.1|2658571_2658910_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2658906_2659302_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971845.1|2659352_2660099_-	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.5	5.7e-99
WP_000033885.1|2660106_2660508_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000677089.1|2660504_2661083_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083293.1|2661069_2661447_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	1.5e-28
WP_000201486.1|2661457_2661817_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522566.1|2661874_2662903_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2662957_2663305_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189495.1|2663317_2664814_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.9	3.3e-98
WP_000831820.1|2664803_2666384_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	1.2e-188
WP_000201416.1|2666380_2666584_-	gpW family protein	NA	K7PM10	Enterobacteria_phage	70.8	2.1e-16
WP_000623090.1|2666567_2668499_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	2.4e-258
WP_001102153.1|2668470_2669016_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669693.1|2669301_2669703_+	PPC domain-containing protein	NA	NA	NA	NA	NA
WP_031607976.1|2669939_2670386_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	90.4	9.3e-65
WP_000984587.1|2670403_2670856_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	5.1e-79
WP_001574216.1|2670839_2671169_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110785.1|2671444_2672131_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	99.6	3.6e-132
WP_000798706.1|2672491_2672941_+	lipoprotein	NA	NA	NA	NA	NA
WP_001534733.1|2673076_2673202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047630.1|2673600_2674398_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	4.0e-151
WP_001617856.1|2674387_2674534_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096558.1|2674530_2675142_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	98.0	2.7e-91
WP_000929790.1|2675350_2675953_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_014343878.1|2675987_2676236_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|2676352_2676586_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_000802853.1|2676833_2677160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107251218.1|2677253_2677322_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_000132543.1|2677302_2678520_-	hypothetical protein	NA	J9Q803	Salmonella_phage	53.3	3.1e-118
WP_000974174.1|2678830_2679076_-	hypothetical protein	NA	Q5G8U9	Enterobacteria_phage	88.9	3.0e-33
WP_000065089.1|2679075_2679396_-	hypothetical protein	NA	H6WRY0	Salmonella_phage	65.5	6.7e-25
WP_000113626.1|2679392_2679740_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	100.0	4.5e-59
WP_000800015.1|2679750_2680500_-	ATP-binding protein	NA	H6WRX8	Salmonella_phage	99.6	2.5e-139
WP_001520662.1|2680502_2681486_-	replication protein	NA	H6WRX7	Salmonella_phage	99.7	5.6e-163
WP_010835408.1|2681570_2681945_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_001274939.1|2681904_2682147_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	67.9	5.6e-24
WP_024133227.1|2682219_2682633_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	78.0	8.9e-46
WP_000106861.1|2682775_2683885_+	AAA family ATPase	NA	E7C9Q8	Salmonella_phage	58.4	1.6e-118
WP_000551854.1|2684365_2684536_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	51.0	3.3e-07
WP_022742800.1|2684557_2684908_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	98.3	6.4e-61
WP_068938196.1|2685034_2687473_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	68.3	6.7e-258
WP_001126032.1|2687465_2688296_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.0e-104
WP_001033922.1|2688331_2688652_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	59.2	1.8e-33
WP_023221268.1|2688972_2689476_+	hypothetical protein	NA	A0A075B8H2	Enterobacteria_phage	92.3	6.0e-36
WP_000089141.1|2689525_2689762_+	excisionase	NA	NA	NA	NA	NA
WP_000741325.1|2689751_2690894_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21929	Phage_21	80.3	8.2e-174
WP_000444509.1|2691007_2692258_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
WP_001249412.1|2692429_2693095_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000825957.1|2693091_2693421_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_023227248.1|2693432_2693894_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000004540.1|2693947_2695054_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
2694573:2694589	attR	TTTTAGGGCGCTATCTG	NA	NA	NA	NA
>prophage 8
NZ_CP017719	Salmonella enterica subsp. enterica serovar Hayindogo strain FDA957831-1-1 chromosome, complete genome	4765719	2964453	2973534	4765719	protease,integrase	Ralstonia_phage(16.67%)	8	2962846:2962858	2982030:2982042
2962846:2962858	attL	CTGTTTTACCTTA	NA	NA	NA	NA
WP_024155556.1|2964453_2965695_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	40.7	2.5e-75
WP_023243338.1|2966222_2966600_+|integrase	phage integrase	integrase	NA	NA	NA	NA
WP_001117984.1|2966761_2966959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|2967170_2969447_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2969477_2969798_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2970121_2970343_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125893.1|2970472_2972419_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_023202044.1|2972415_2973534_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
2982030:2982042	attR	TAAGGTAAAACAG	NA	NA	NA	NA
>prophage 9
NZ_CP017719	Salmonella enterica subsp. enterica serovar Hayindogo strain FDA957831-1-1 chromosome, complete genome	4765719	3330884	3370796	4765719	lysis,terminase,protease,integrase,tail,holin,coat,portal	Salmonella_phage(63.33%)	60	3330305:3330351	3370810:3370856
3330305:3330351	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGAAG	NA	NA	NA	NA
WP_024155479.1|3330884_3332807_+	acyltransferase	NA	C6ZR20	Salmonella_phage	99.2	0.0e+00
WP_023972031.1|3333148_3335266_-|tail	tail protein	tail	C6ZR19	Salmonella_phage	97.0	0.0e+00
WP_024155480.1|3335421_3337332_-	hypothetical protein	NA	I1TEJ6	Salmonella_phage	89.7	0.0e+00
WP_000190215.1|3337331_3338702_-	phage DNA ejection protein	NA	A0A1R3Y5Q4	Salmonella_virus	97.4	3.1e-244
WP_000964903.1|3338711_3339401_-	hypothetical protein	NA	B9UDK9	Salmonella_phage	91.3	8.9e-91
WP_000627698.1|3339403_3339859_-	DUF2824 family protein	NA	A0A192Y6V9	Salmonella_phage	98.7	4.4e-86
WP_000774925.1|3339858_3340560_-	hypothetical protein	NA	A0A192Y6T9	Salmonella_phage	98.7	7.5e-77
WP_023972029.1|3340563_3341982_-	packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	98.3	3.0e-274
WP_001166096.1|3341941_3342442_-	packaged DNA stabilization gp4 family protein	NA	I6RSF6	Salmonella_phage	100.0	2.5e-90
WP_023972028.1|3342425_3342986_-	hypothetical protein	NA	I6S1J7	Salmonella_phage	98.9	1.1e-102
WP_024155481.1|3343026_3344319_-|coat	coat protein	coat	A0A192Y6V4	Salmonella_phage	99.8	1.2e-242
WP_000433852.1|3344318_3345230_-	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_024155482.1|3345243_3347421_-|portal	portal protein	portal	A0A0M4RCZ3	Salmonella_phage	98.5	0.0e+00
WP_000736482.1|3347469_3347970_+	HNH endonuclease	NA	A0A0M4R2Z1	Salmonella_phage	100.0	2.5e-95
WP_024155483.1|3347973_3349434_-	hypothetical protein	NA	W6MW26	Pseudomonas_phage	76.0	8.2e-219
WP_038805832.1|3349433_3349892_-|terminase	terminase	terminase	A0A2P1MXF5	Escherichia_phage	65.5	4.7e-48
WP_024155485.1|3349904_3350309_-	hypothetical protein	NA	C6ZR73	Salmonella_phage	97.8	2.6e-66
WP_044783375.1|3350308_3350698_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	96.9	2.8e-73
WP_024155486.1|3350701_3350944_-	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	100.0	3.0e-33
WP_001028469.1|3351267_3351789_-	KilA-N domain-containing protein	NA	H6WRZ8	Salmonella_phage	100.0	1.9e-101
WP_011233123.1|3352001_3352451_-|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	87.8	3.0e-63
WP_001167374.1|3352468_3352906_-	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.9	6.3e-74
WP_000738703.1|3352889_3353216_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
WP_001235452.1|3353650_3354274_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	87.0	8.3e-96
WP_000994515.1|3354270_3354459_-	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
WP_023210747.1|3354455_3354818_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	97.5	5.0e-61
WP_000002244.1|3354814_3355105_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	100.0	1.0e-51
WP_001286918.1|3355097_3355310_-	hypothetical protein	NA	K7PK10	Enterobacteria_phage	98.6	4.7e-35
WP_000950962.1|3355302_3355479_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
WP_001532927.1|3355471_3355813_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
WP_023210746.1|3355815_3355992_-	NinE family protein	NA	C6ZR57	Salmonella_phage	98.3	3.0e-27
WP_024150884.1|3355973_3356132_-	hypothetical protein	NA	Q8HAF7	Salmonella_phage	94.2	6.0e-27
WP_023210745.1|3356128_3356575_-	recombination protein NinB	NA	I6R0N7	Salmonella_phage	99.3	1.2e-80
WP_024150883.1|3356531_3356828_-	hypothetical protein	NA	E7C9R7	Salmonella_phage	99.0	2.6e-47
WP_023210744.1|3356830_3357079_-	hypothetical protein	NA	A0A220NQX3	Salmonella_phage	98.8	1.5e-40
WP_006819448.1|3357309_3357582_-	DUF4752 family protein	NA	A0A220NQX8	Salmonella_phage	100.0	4.2e-44
WP_023210742.1|3357656_3359093_-	AAA family ATPase	NA	E7C9R5	Salmonella_phage	98.5	1.7e-272
WP_006789497.1|3359082_3359982_-	hypothetical protein	NA	A0A220NQX5	Salmonella_phage	99.3	1.5e-154
WP_001125981.1|3359974_3360121_-	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_023210741.1|3360155_3360434_-	lambda phage CII family protein	NA	A0A220NRS4	Escherichia_phage	92.4	3.8e-40
WP_000276884.1|3360540_3360726_-	Cro/Cl family transcriptional regulator	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
WP_100097536.1|3360806_3361457_+	LexA family transcriptional regulator	NA	B1B6L9	Salmonella_phage	99.1	7.8e-121
WP_023216151.1|3361795_3362098_+	hypothetical protein	NA	I6S5Z3	Salmonella_phage	95.0	1.6e-47
WP_100097537.1|3362176_3363160_+	hypothetical protein	NA	Q5G8T6	Enterobacteria_phage	82.0	1.7e-74
WP_001670815.1|3363354_3363528_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	I6R987	Salmonella_phage	100.0	8.9e-24
WP_000156731.1|3363508_3363697_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_000902091.1|3363686_3363830_+	hypothetical protein	NA	I6S1M5	Salmonella_phage	100.0	4.2e-19
WP_024155544.1|3363826_3364534_+	recombinase	NA	Q716E7	Shigella_phage	97.0	1.1e-133
WP_024155543.1|3364534_3365041_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	97.0	2.1e-89
WP_024155542.1|3365049_3365598_+	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	98.4	1.2e-103
WP_001111322.1|3365613_3365907_+	DUF2856 family protein	NA	I6R984	Salmonella_phage	96.9	2.7e-49
WP_071604629.1|3365917_3366085_+	DUF2737 family protein	NA	A0A1V0E5L8	Salmonella_phage	96.4	5.0e-24
WP_024155541.1|3366081_3366327_+	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	96.2	1.7e-36
WP_100097538.1|3366323_3366725_+	ParB/RepB/Spo0J family partition protein	NA	S4TTI6	Salmonella_phage	97.0	7.0e-72
WP_100097550.1|3366718_3367117_+	ead/Ea22-like family protein	NA	B9UDM4	Salmonella_phage	50.0	2.4e-32
WP_024155538.1|3367118_3367589_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.5e-68
WP_100097539.1|3367592_3368261_+	DUF550 domain-containing protein	NA	A0A075B8H2	Enterobacteria_phage	93.5	2.9e-78
WP_024155536.1|3368257_3368608_+	DUF551 domain-containing protein	NA	Q5G8V3	Enterobacteria_phage	66.9	6.6e-34
WP_024155534.1|3368923_3369190_+	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	96.6	2.4e-44
WP_068938189.1|3369632_3370796_+|integrase	site-specific integrase	integrase	B9UDL9	Salmonella_phage	97.9	3.0e-224
3370810:3370856	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGAAG	NA	NA	NA	NA
>prophage 10
NZ_CP017719	Salmonella enterica subsp. enterica serovar Hayindogo strain FDA957831-1-1 chromosome, complete genome	4765719	4358329	4403107	4765719	tRNA,plate,tail,holin	Burkholderia_phage(40.91%)	47	NA	NA
WP_001182228.1|4358329_4359328_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_023242904.1|4359415_4360726_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4360972_4361488_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4361587_4361797_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4361818_4361932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128113.1|4361928_4363254_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4363432_4364041_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|4364149_4364518_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4364688_4367109_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4367207_4368080_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4368093_4368591_-	chorismate lyase	NA	NA	NA	NA	NA
WP_001749156.1|4368771_4369689_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973681.1|4369852_4371211_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4371299_4372409_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|4372770_4373961_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_023242906.1|4374092_4375637_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_020845801.1|4375651_4376542_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982752.1|4376707_4377118_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750805.1|4377260_4379357_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977959.1|4379356_4380094_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_122821798.1|4380090_4380759_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4380792_4381035_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790028.1|4381478_4383128_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|4383472_4384822_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4384952_4385300_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226440.1|4385875_4386163_+|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
WP_001270438.1|4386165_4386771_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.4	6.5e-61
WP_000777266.1|4386783_4387098_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4387257_4387713_+	Gp37 family protein	NA	NA	NA	NA	NA
WP_023242908.1|4387709_4387907_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	6.6e-07
WP_023242909.1|4387896_4389324_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	8.1e-195
WP_000907495.1|4389323_4389848_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003640.1|4389899_4390217_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4390176_4390305_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_023242910.1|4390401_4392756_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	3.1e-66
WP_023242911.1|4392755_4393709_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	51.5	7.9e-37
WP_001269716.1|4393708_4393918_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_023244444.1|4393905_4394949_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	4.2e-76
WP_000679393.1|4394958_4395681_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593182.1|4396008_4396371_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703633.1|4396367_4397297_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000632053.1|4397296_4398844_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_001093501.1|4399007_4399367_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001749150.1|4399357_4400473_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.0	4.1e-101
WP_001749149.1|4400465_4401098_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	55.6	1.9e-23
WP_000368203.1|4401100_4402582_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
WP_001177097.1|4402591_4403107_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	3.4e-34
