The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024830	Escherichia coli strain CREC-532 chromosome, complete genome	4837992	1840396	1913240	4837992	plate,tRNA,protease,transposase	uncultured_Caudovirales_phage(20.0%)	59	NA	NA
WP_001295561.1|1840396_1841749_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|1841778_1844211_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|1844332_1844818_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|1844821_1845847_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|1845951_1846407_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|1846410_1847199_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139654.1|1847198_1848347_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|1848343_1848940_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|1848976_1852459_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|1852471_1853431_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|1853529_1855671_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901099.1|1855727_1856117_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176549.1|1856181_1857480_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|1857528_1857789_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|1857775_1857976_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|1858141_1858687_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635537.1|1858683_1859106_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239163.1|1859119_1859830_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001336393.1|1860029_1860854_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260712.1|1860907_1862626_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|1862737_1863445_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|1863441_1863846_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874226.1|1863963_1864779_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|1864818_1865472_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000594006.1|1865464_1866496_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
WP_001140187.1|1866683_1867259_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997010.1|1873019_1873823_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_000648572.1|1873819_1874734_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|1874974_1875775_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000016007.1|1875778_1876402_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000644685.1|1876449_1877808_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|1877879_1878635_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001326702.1|1878668_1879391_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|1879387_1879855_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001340895.1|1879919_1880651_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
WP_001086141.1|1881187_1881973_+	lipoprotein	NA	NA	NA	NA	NA
WP_100183864.1|1882109_1882589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908066.1|1882598_1883513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|1883556_1884039_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087741.1|1884062_1885415_-	membrane protein	NA	NA	NA	NA	NA
WP_122545204.1|1885425_1888860_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240525.1|1888968_1890381_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088852.1|1890385_1891129_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614325.1|1891125_1893891_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_000343289.1|1893899_1894661_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246443.1|1894665_1895997_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|1895999_1896524_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113709.1|1896520_1897801_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|1897825_1898908_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393852.1|1898871_1900722_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611744.1|1900725_1901139_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056989.1|1901145_1902621_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|1902671_1902896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037397.1|1902930_1903431_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|1904125_1904644_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_032329316.1|1904853_1906995_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
WP_000508724.1|1907070_1911303_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_001101839.1|1911280_1911673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420818.1|1912103_1913240_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP024830	Escherichia coli strain CREC-532 chromosome, complete genome	4837992	1921498	2039740	4837992	terminase,portal,capsid,transposase,tail,head,lysis,integrase	Enterobacteria_phage(33.9%)	106	1935987:1936045	1982246:1982304
WP_000006255.1|1921498_1921996_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|1922219_1923959_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_001333407.1|1923918_1924689_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|1924759_1925815_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|1925866_1926160_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|1926162_1926561_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|1926570_1927023_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_100183863.1|1927328_1927595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326471.1|1927527_1928064_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|1928120_1929578_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|1929838_1930297_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|1930388_1931633_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174677.1|1931690_1932092_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_039023169.1|1932130_1933186_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
WP_001285288.1|1933473_1934577_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|1934588_1935842_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
1935987:1936045	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTTAAATCAATAA	NA	NA	NA	NA
WP_023149751.1|1936046_1937210_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.2	7.7e-228
WP_077873866.1|1937086_1937521_-	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	6.4e-79
WP_023149750.1|1937436_1937742_-	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	3.4e-50
WP_001242749.1|1937741_1938104_-	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000008200.1|1938094_1938631_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_000081287.1|1938758_1939583_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135682.1|1939648_1940011_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000559922.1|1940480_1940996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450738.1|1941223_1941850_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	2.5e-47
WP_000205494.1|1941947_1942148_+	cell division protein	NA	NA	NA	NA	NA
WP_100183866.1|1942185_1942737_+	hypothetical protein	NA	U5P4K1	Shigella_phage	97.8	3.8e-100
WP_001250269.1|1942912_1943092_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_023149745.1|1943081_1944023_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.7	3.9e-153
WP_001407082.1|1944019_1944514_+	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	100.0	2.7e-89
WP_000210173.1|1944513_1944840_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.0e-53
WP_000767111.1|1944836_1945226_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	3.5e-68
WP_023149744.1|1945245_1946043_+	KilA-N domain-containing protein	NA	S5FM84	Shigella_phage	98.1	3.2e-148
WP_001420253.1|1946050_1947040_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	5.6e-195
WP_077908626.1|1947055_1947421_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	90.0	6.4e-56
WP_000750482.1|1947433_1948297_-	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	40.8	2.4e-40
WP_000917730.1|1948697_1948901_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	98.5	1.8e-31
WP_000799656.1|1949051_1950104_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000839596.1|1950174_1950390_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000193264.1|1950394_1950745_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000992100.1|1950808_1951342_+	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
WP_089590786.1|1951338_1951806_+|lysis	lysis protein	lysis	K7PH77	Enterobacteria_phage	99.4	1.1e-76
WP_001139681.1|1951793_1951946_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	4.7e-21
WP_024176377.1|1952297_1952708_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.3	1.2e-55
WP_032336848.1|1952764_1952998_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.1	1.5e-21
WP_000453611.1|1953386_1953932_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_023149688.1|1953906_1955832_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198149.1|1955828_1956035_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_100183862.1|1956031_1957633_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	6.1e-308
WP_000123234.1|1957613_1958933_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	1.1e-233
WP_012304872.1|1958942_1959275_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	96.4	4.6e-53
WP_000063273.1|1959330_1960356_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	2.9e-186
WP_024176376.1|1960397_1960793_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	90.9	2.1e-52
WP_000753001.1|1960804_1961158_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	4.4e-62
WP_000975067.1|1961169_1961748_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	3.5e-80
WP_000683106.1|1961744_1962140_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.2e-70
WP_024176375.1|1962147_1962888_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	2.8e-130
WP_000479155.1|1962903_1963326_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	1.9e-72
WP_000459457.1|1963307_1963742_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_023149684.1|1963734_1966314_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	92.0	0.0e+00
WP_023149683.1|1966310_1966640_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	95.4	1.7e-55
WP_069903524.1|1966639_1967338_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.4e-131
WP_097474844.1|1967342_1968086_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	9.5e-147
WP_000090891.1|1968022_1968655_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_100183861.1|1968715_1972129_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.5	0.0e+00
WP_097474846.1|1972199_1972799_+	Ail/Lom family outer membrane beta-barrel protein	NA	K7PJP9	Enterobacteria_phage	99.0	5.7e-110
WP_024176455.1|1976038_1976866_+	hypothetical protein	NA	A0A0S1S106	Klebsiella_phage	52.3	3.1e-74
WP_023150044.1|1977849_1978665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032336984.1|1979141_1980083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023150042.1|1980335_1981706_-	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_070749884.1|1983289_1984921_-	hypothetical protein	NA	NA	NA	NA	NA
1982246:1982304	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTTAAATCAATAA	NA	NA	NA	NA
WP_000266638.1|1985611_1985839_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000120391.1|1985944_1986172_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000335705.1|1986420_1987854_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000282095.1|1988819_1989383_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_032142224.1|1991345_1991717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000108720.1|1994247_1999983_-	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_000995975.1|2000169_2002212_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000443938.1|2002204_2003656_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000149676.1|2006282_2009399_-	HsdR family type I site-specific deoxyribonuclease	NA	NA	NA	NA	NA
WP_001293044.1|2009520_2010735_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000200813.1|2010731_2012288_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	2.2e-105
WP_070751363.1|2012551_2013424_+	GTPase family protein	NA	NA	NA	NA	NA
WP_023149781.1|2016763_2019280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000581506.1|2019355_2019811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234565.1|2020220_2021042_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.1	4.0e-45
WP_000855059.1|2021383_2021857_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.5e-12
WP_001424026.1|2021872_2022349_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|2022417_2022639_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_000086755.1|2022657_2023302_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.0	5.2e-24
WP_077249034.1|2023405_2023711_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_001094398.1|2023731_2024100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001111348.1|2024420_2024831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121359.1|2024809_2025766_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667026.1|2025775_2027974_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000643333.1|2027970_2028927_-	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000070700.1|2028923_2029613_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001019920.1|2030030_2030645_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|2030892_2031222_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001350485.1|2031534_2032245_-	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001310578.1|2032213_2033857_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001131096.1|2033846_2036372_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000716398.1|2036397_2037066_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730972.1|2037123_2037711_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_001301257.1|2037785_2038328_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001310555.1|2038723_2039740_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
>prophage 3
NZ_CP024830	Escherichia coli strain CREC-532 chromosome, complete genome	4837992	2646279	2662172	4837992	terminase,capsid,protease,head,integrase	uncultured_Caudovirales_phage(20.0%)	19	2635672:2635686	2659607:2659621
2635672:2635686	attL	GCTAAAACCGCCATC	NA	NA	NA	NA
WP_000188144.1|2646279_2648226_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|2648298_2648523_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_072652362.1|2648927_2650166_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	53.0	6.9e-126
WP_001206971.1|2650585_2650795_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	69.6	3.4e-17
WP_000039771.1|2650909_2651119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000201462.1|2651176_2651356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077890993.1|2651555_2652095_+	host cell division inhibitor Icd-like protein	NA	Q8SBF3	Shigella_phage	69.9	1.4e-27
WP_085693332.1|2652087_2652408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085693330.1|2652414_2652708_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_085693328.1|2652704_2654522_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	47.9	6.3e-128
WP_000125509.1|2654809_2655055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069723201.1|2655051_2655474_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000228106.1|2655691_2656732_+|capsid	phage capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.2	3.0e-66
WP_000190771.1|2656741_2657083_+|head	head decoration protein	head	NA	NA	NA	NA
WP_085693326.1|2657094_2657478_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_047634587.1|2657679_2658222_+|terminase	terminase	terminase	O64316	Escherichia_phage	45.7	3.5e-34
WP_001595598.1|2658467_2658758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000520781.1|2659544_2659865_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
2659607:2659621	attR	GCTAAAACCGCCATC	NA	NA	NA	NA
WP_000934041.1|2659895_2662172_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
>prophage 4
NZ_CP024830	Escherichia coli strain CREC-532 chromosome, complete genome	4837992	2920238	2999821	4837992	terminase,portal,capsid,tRNA,transposase,tail,head,holin,integrase	Escherichia_phage(42.31%)	90	2907979:2907994	2945688:2945703
2907979:2907994	attL	ATAAACCTGTCCTCCG	NA	NA	NA	NA
WP_000074971.1|2920238_2921357_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	1.6e-84
WP_000003742.1|2921325_2921595_-	excisionase	NA	NA	NA	NA	NA
WP_000102136.1|2921656_2924098_-	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
WP_001070255.1|2924191_2924383_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854558.1|2924379_2924568_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001517906.1|2924968_2925172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|2925136_2925355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092153.1|2925447_2925648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001420344.1|2926079_2926418_-	peptidase S24	NA	H9C160	Pectobacterium_phage	32.0	2.5e-06
WP_000747951.1|2926809_2927052_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693850.1|2927035_2927461_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262390.1|2927532_2928603_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_001151150.1|2928643_2929066_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_000403785.1|2929123_2929480_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001224662.1|2929573_2929756_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_001013636.1|2930790_2931003_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_032155008.1|2931170_2931449_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001221526.1|2931450_2932509_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
WP_000139999.1|2932509_2932890_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.3e-35
WP_000762879.1|2932886_2933708_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	5.1e-77
WP_106104550.1|2934102_2934189_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_001333559.1|2934677_2934890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001333560.1|2934960_2935296_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
WP_000874243.1|2935556_2935745_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_000372595.1|2936052_2936268_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000193264.1|2936272_2936623_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000992097.1|2936686_2937220_+	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
WP_075202333.1|2937436_2937619_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000738421.1|2937709_2938003_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001135104.1|2938528_2938879_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	8.0e-64
WP_001333563.1|2939026_2939509_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_001140892.1|2939508_2941266_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_000923134.1|2941413_2942640_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.3	3.7e-204
WP_100183845.1|2943245_2944463_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	7.7e-162
WP_000719064.1|2944539_2944857_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	5.3e-22
WP_001147814.1|2944865_2945204_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000968644.1|2945200_2945650_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001206700.1|2945646_2945991_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	5.1e-55
2945688:2945703	attR	CGGAGGACAGGTTTAT	NA	NA	NA	NA
WP_100183844.1|2946051_2946756_+|tail	phage tail protein	tail	A0A1B5FP82	Escherichia_phage	92.3	1.2e-111
WP_001324129.1|2946755_2947142_+|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
WP_077253127.1|2947183_2947444_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	95.3	2.3e-39
WP_000224003.1|2947490_2950718_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
WP_001330090.1|2950695_2951052_+|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_001152457.1|2951051_2951750_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	3.4e-130
WP_001333568.1|2951755_2952499_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	4.5e-149
WP_000090843.1|2952435_2953044_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	1.9e-100
WP_000515345.1|2953104_2956584_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_001233546.1|2956651_2957251_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	1.6e-107
WP_001189123.1|2961204_2962713_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_032143699.1|2963021_2963393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042047081.1|2964126_2964657_+	chaperone of endosialidase	NA	A0A2D1UII2	Escherichia_phage	85.2	2.5e-69
WP_000241001.1|2964894_2965563_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000799406.1|2966117_2966981_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|2966964_2968101_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359434.1|2968350_2969577_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|2969625_2970747_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000735412.1|2970822_2972283_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265471.1|2972282_2972954_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|2973122_2974493_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|2974496_2975138_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|2975173_2976280_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|2976333_2976795_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248681.1|2976804_2977458_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444488.1|2977629_2978880_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	3.2e-22
WP_001295666.1|2978982_2979306_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_032082692.1|2979842_2979953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|2980005_2980410_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|2980630_2981362_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_001299269.1|2981566_2982778_-	blue light-responsive regulator BluF	NA	NA	NA	NA	NA
WP_000554140.1|2983091_2983328_+	two-component-system connector protein YcgZ	NA	NA	NA	NA	NA
WP_000858002.1|2983370_2983643_+	two-component-system connector protein YmgA	NA	NA	NA	NA	NA
WP_000888772.1|2983671_2983938_+	biofilm/acid-resistance regulator AriR	NA	NA	NA	NA	NA
WP_001065752.1|2984050_2984299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001246498.1|2984630_2986154_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_001065861.1|2986285_2986504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100183843.1|2986903_2988424_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_071524883.1|2988436_2989525_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	41.9	8.3e-75
WP_000726974.1|2989946_2990291_-	glycine zipper family protein	NA	NA	NA	NA	NA
WP_000122462.1|2990292_2990466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001325005.1|2990566_2990752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001131446.1|2990712_2990832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001185665.1|2991581_2991848_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000101055.1|2991851_2992664_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001301105.1|2992687_2993383_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_001056840.1|2993902_2994271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000695215.1|2994373_2994775_-	inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
WP_000608644.1|2995092_2996355_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_001339197.1|2996489_2997698_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_001617865.1|2997942_2998818_+	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
WP_012579081.1|2998897_2999821_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
>prophage 5
NZ_CP024830	Escherichia coli strain CREC-532 chromosome, complete genome	4837992	3381170	3429292	4837992	transposase,tail,protease,lysis,integrase	Enterobacteria_phage(26.47%)	60	3391605:3391620	3421702:3421717
WP_000527809.1|3381170_3382631_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
WP_000347482.1|3382719_3384003_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|3384607_3384721_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|3384789_3385023_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|3385339_3385930_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|3386027_3386603_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_049254577.1|3386602_3388408_-	hypothetical protein	NA	A0A0K2FJ14	Enterobacteria_phage	99.1	1.3e-213
WP_000453611.1|3388382_3388928_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001368374.1|3389316_3389550_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|3389607_3390018_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|3390169_3390343_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|3390514_3390670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|3390749_3390815_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|3390817_3391006_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|3391016_3391229_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|3391591_3392089_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
3391605:3391620	attL	TTTTTATCTCTTAAAG	NA	NA	NA	NA
WP_001092971.1|3392085_3392619_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|3392615_3392927_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|3392931_3393147_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|3393900_3394116_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|3394416_3394629_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|3394683_3394773_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|3395050_3395803_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265199.1|3395816_3396866_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
WP_012304870.1|3396867_3397146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|3397212_3397464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|3397680_3397836_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|3397907_3398195_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|3398194_3398434_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|3398458_3398764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|3398966_3399299_+	protein FlxA	NA	NA	NA	NA	NA
WP_000589005.1|3399735_3401049_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000955178.1|3401226_3401409_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_001341330.1|3402472_3402706_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	7.8e-39
WP_001333339.1|3402754_3404290_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
WP_001310834.1|3404809_3405166_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
WP_001151262.1|3405162_3405585_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_001296941.1|3407667_3407904_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000876958.1|3407938_3409219_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	3.3e-155
WP_001360138.1|3409238_3409349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836066.1|3409406_3410426_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|3410437_3411652_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|3411857_3412184_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|3412318_3412660_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|3412694_3413255_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|3413257_3413968_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001300836.1|3414075_3414381_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041675.1|3414579_3417006_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
WP_001340362.1|3417066_3419490_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000213028.1|3419500_3420118_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_049254808.1|3420119_3420974_+	dimethyl sulfoxide reductase	NA	NA	NA	NA	NA
WP_000148710.1|3421016_3421631_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_001315626.1|3421789_3423082_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
3421702:3421717	attR	TTTTTATCTCTTAAAG	NA	NA	NA	NA
WP_000919231.1|3423034_3423730_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000225262.1|3423854_3425075_-	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_001019525.1|3425209_3426103_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091840.1|3426209_3427463_+	MFS transporter	NA	NA	NA	NA	NA
WP_000743957.1|3427859_3428195_+	acid shock protein	NA	NA	NA	NA	NA
WP_000233090.1|3428287_3428371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260865.1|3428470_3429292_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 6
NZ_CP024830	Escherichia coli strain CREC-532 chromosome, complete genome	4837992	3995904	4005345	4837992		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001333512.1|3995904_3997041_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
WP_001375261.1|3997037_3999038_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001295429.1|3999162_3999624_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|3999663_4000134_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|4000180_4000900_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|4000896_4002582_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|4002803_4003535_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|4003594_4003702_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|4003682_4004414_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569357.1|4004418_4005345_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 7
NZ_CP024830	Escherichia coli strain CREC-532 chromosome, complete genome	4837992	4607647	4620830	4837992		Escherichia_phage(50.0%)	12	NA	NA
WP_001272928.1|4607647_4610209_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141322.1|4610314_4610971_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001300386.1|4611021_4611789_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000847984.1|4611984_4612893_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	5.1e-118
WP_100183824.1|4612889_4614152_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	7.5e-136
WP_001278994.1|4614148_4614787_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136934.1|4614791_4615568_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104441.1|4615656_4617021_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|4617114_4618107_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|4618169_4619309_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|4619448_4620075_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|4620068_4620830_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 1
NZ_CP024831	Escherichia coli strain CREC-532 plasmid pCREC-532_1, complete sequence	216181	11947	54222	216181	transposase,integrase	Escherichia_phage(50.0%)	43	36694:36753	48966:49785
WP_001553854.1|11947_15064_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	3.7e-27
WP_048266692.1|15185_16457_-	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	27.6	6.9e-12
WP_001553856.1|16453_18010_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.5	7.1e-104
WP_001190712.1|18192_18414_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216034.1|18413_18794_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001513661.1|18798_18978_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001513660.1|19005_19365_+	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
WP_001513659.1|19651_19969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012372828.1|20196_21213_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	4.9e-186
WP_001373486.1|21420_22824_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|22810_23743_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_157787287.1|26829_26985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|26990_27695_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_100183871.1|27730_28702_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.0	4.5e-96
WP_001066942.1|28986_29727_-	site-specific recombinase	NA	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_032156742.1|29847_29973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072355.1|31172_32342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001105060.1|32537_32831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421272.1|32936_33212_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001387467.1|33211_33496_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000562172.1|34100_34853_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001022265.1|34898_35864_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_000710783.1|35896_36277_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
36694:36753	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|36756_37461_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_157787290.1|37406_38003_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|37971_38985_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001389366.1|39142_39616_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000503573.1|39746_40535_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_000679427.1|40740_41088_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|41081_41921_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|42048_42252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|42407_43613_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|43623_43929_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|44155_44920_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|45412_45997_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219391.1|47230_48136_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|48257_48962_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_013362819.1|49096_49192_+	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_013362818.1|49317_50055_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	6.3e-135
48966:49785	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCAAATTTTGTATAATAGGAATTGAAGTTAAATTAGATGCTAAAAATTTGTAATTAAGAAGGAGGGATTCGTCATGTTGGTATTCCAAATGCGTTATCAAATGCGTTATGTAGATAAAACATCTACTGTTTTGAAACAGACTAAAAAAAGTGATTACGCAGATAAATAAATACGTTAGATTAATTCCTGCCAGTGACTAATCTTATGACTTTTTAAACAGATAACTAAAATTACAAACAAATCGTTTAACTTCTGTATTTGTTTATAGATGTAATCACTTCAGGAGTAAATTACATGAACAAAAATATAAAATATTCTCAAAACTTTTTAACGAGTGAAAAAGTACTCAACCAAATAATAAAACAATTGAATTTAAAAGAAACCGATACCGTTTACGAAATTGGAACAGGTAAAGGGCATTTAACGACGAAACTGGCTAAAATAAGTAAACAGGTAACGTCTATTGAATTAGACAGTCATCTATTCAACTTATCGTCAGAAAAATTAAAACTGAATACTCGTGTCACTTTAATTCACCAAGATATTCTACAGTTTCAATTCCCTAACAAACAGAGGTATAAAATTGTTGGGAATATTCCTTACCATTTAAGCACACAAATTATTAAAAAAGTGGTTTTTGAAAGCCATGCGTCTGACATCTATCTGATTGTTGAAGAAGGATTCTACAAGCGTACCTTGGATATTCACCGAACACTAGGGTTGCTCTTGCACACTCAAGTCTCGATTCAGCAATTGCTTAAG	NA	NA	NA	NA
WP_100249774.1|50059_50170_+	hypothetical protein	NA	E4ZFP9	Streptococcus_phage	88.6	1.9e-08
WP_013362817.1|50684_51134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013362816.1|51662_53195_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067834.1|53517_54222_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
>prophage 2
NZ_CP024831	Escherichia coli strain CREC-532 plasmid pCREC-532_1, complete sequence	216181	188220	195637	216181		Escherichia_phage(66.67%)	6	NA	NA
WP_001553854.1|188220_191337_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	3.7e-27
WP_001553856.1|192725_194282_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.5	7.1e-104
WP_001190712.1|194464_194686_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216034.1|194685_195066_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001513661.1|195070_195250_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001513660.1|195277_195637_+	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
>prophage 1
NZ_CP024832	Escherichia coli strain CREC-532 plasmid pCREC-532_2, complete sequence	96987	1789	96647	96987	integrase,holin,transposase,terminase	Escherichia_phage(58.33%)	101	40500:40515	94667:94682
WP_062914756.1|1789_8557_-	N-6 DNA methylase	NA	Q1MVN7	Enterobacteria_phage	98.7	0.0e+00
WP_023153801.1|8632_10342_+	hypothetical protein	NA	Q1MVN6	Enterobacteria_phage	99.6	0.0e+00
WP_023352830.1|10334_11354_+	hypothetical protein	NA	Q71TR6	Escherichia_phage	89.7	7.6e-163
WP_001345478.1|11645_12203_-	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
WP_023352831.1|12371_12860_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	87.7	1.1e-74
WP_023351931.1|13062_13851_+	hypothetical protein	NA	A0A077SK34	Escherichia_phage	99.2	8.0e-144
WP_023352832.1|13843_14938_+	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	36.7	6.7e-40
WP_001165936.1|14969_15278_-	hypothetical protein	NA	O21974	Escherichia_phage	97.1	5.4e-48
WP_062914757.1|15267_18255_-	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	99.5	0.0e+00
WP_048218295.1|18354_19563_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	99.8	4.1e-224
WP_000175491.1|19602_19968_-	hypothetical protein	NA	A0A1B0V846	Salmonella_phage	98.3	9.3e-47
WP_048218296.1|19964_21884_-	defense against restriction protein A	NA	A0A1B0V7H1	Salmonella_phage	98.4	0.0e+00
WP_001345482.1|21885_22488_-	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	100.0	5.4e-100
WP_000580776.1|22474_22918_-	hypothetical protein	NA	A0A077SK09	Escherichia_phage	100.0	1.3e-82
WP_000887652.1|22914_23244_-|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_048218298.1|23318_23582_-	hypothetical protein	NA	Q71TD9	Escherichia_phage	62.4	4.0e-23
WP_023351542.1|24017_24590_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.6	1.5e-83
WP_100193649.1|24620_25127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100193648.1|26116_29320_-	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	44.7	4.1e-13
WP_001286326.1|29331_29766_-	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	100.0	3.3e-75
WP_048218248.1|29844_30681_-	hypothetical protein	NA	A0A1B0V7F2	Salmonella_phage	98.2	8.4e-152
WP_062914759.1|30680_32114_-	hypothetical protein	NA	A0A1B0VAD6	Salmonella_phage	99.8	8.2e-272
WP_000002800.1|32110_32467_-	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_100183872.1|32466_36162_-	transglycosylase SLT domain-containing protein	NA	A0A1B0VDM8	Salmonella_phage	85.9	0.0e+00
WP_000926342.1|36243_37125_-	hypothetical protein	NA	Q71TC9	Escherichia_phage	98.6	2.7e-172
WP_000523980.1|37139_37751_-	hypothetical protein	NA	Q71TN8	Escherichia_phage	99.5	2.9e-109
WP_023153778.1|37761_38328_-	hypothetical protein	NA	Q1MVL0	Enterobacteria_phage	99.5	1.1e-99
WP_032192786.1|38558_39452_+	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	30.3	3.4e-26
WP_001057312.1|39503_39980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000093548.1|40002_40353_-	hypothetical protein	NA	NA	NA	NA	NA
40500:40515	attL	ATTGCTCTAATTATTT	NA	NA	NA	NA
WP_001396852.1|40711_40831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071550046.1|40849_41071_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	80.3	9.3e-26
WP_033560573.1|41067_42159_+	antirepressor	NA	A0A077SLR9	Escherichia_phage	79.8	7.1e-159
WP_001187875.1|42323_43124_+	protein kilA	NA	Q1MVK4	Enterobacteria_phage	100.0	1.9e-148
WP_062914760.1|43153_43999_+	hypothetical protein	NA	Q1MVK3	Enterobacteria_phage	97.5	1.8e-149
WP_052761440.1|44263_45319_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	70.8	9.0e-143
WP_001561122.1|45388_45676_-	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_053896077.1|45965_46562_-	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	100.0	6.3e-109
WP_000509939.1|46733_47243_-	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
WP_000035251.1|47254_47836_-	hypothetical protein	NA	Q71TM4	Escherichia_phage	99.5	3.8e-103
WP_062914761.1|47871_48687_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	98.9	9.8e-113
WP_062914762.1|48696_50286_-	hypothetical protein	NA	Q71TB2	Escherichia_phage	98.5	1.9e-301
WP_023153705.1|50346_52053_-	hypothetical protein	NA	Q1MVJ5	Enterobacteria_phage	94.4	4.7e-311
WP_053903354.1|52279_53281_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	99.7	4.8e-178
WP_001285362.1|53297_54494_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_001076427.1|55051_55912_-	replication protein RepA	NA	Q71TL8	Escherichia_phage	100.0	4.7e-158
WP_000458377.1|56238_56640_-	hypothetical protein	NA	Q71TL7	Escherichia_phage	54.0	5.5e-32
WP_001281923.1|56710_57070_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	69.1	4.6e-38
WP_000336811.1|57081_57222_-	hypothetical protein	NA	Q71TL6	Escherichia_phage	97.8	3.1e-19
WP_000007769.1|57247_57670_-	hypothetical protein	NA	A0A1B0VCB0	Salmonella_phage	100.0	2.7e-58
WP_048218262.1|57709_58498_-	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	96.9	1.7e-117
WP_001369296.1|58506_58686_-	hypothetical protein	NA	A0A1B0V758	Salmonella_phage	98.3	6.8e-27
WP_001177862.1|58959_59244_+	hypothetical protein	NA	Q71TA2	Escherichia_phage	97.9	2.5e-47
WP_000472529.1|59236_60142_+	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.7	1.6e-159
WP_062914763.1|60138_62403_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	66.8	0.0e+00
WP_000751808.1|64377_65205_+	hypothetical protein	NA	A0A077SLJ6	Escherichia_phage	100.0	1.6e-131
WP_001276603.1|65594_66959_+	replicative DNA helicase	NA	O80281	Escherichia_phage	99.8	1.6e-253
WP_062914764.1|66958_67957_+	hypothetical protein	NA	Q71TK3	Escherichia_phage	99.1	8.1e-194
WP_000535208.1|68003_68636_-	hypothetical protein	NA	Q1MVH8	Enterobacteria_phage	100.0	9.0e-90
WP_023153696.1|68628_69645_-	hypothetical protein	NA	A0A077SLQ1	Escherichia_phage	99.7	4.5e-192
WP_000602719.1|69646_70432_-	hypothetical protein	NA	A0A1B0V7N6	Salmonella_phage	99.6	3.6e-144
WP_000896801.1|70418_71147_-	hypothetical protein	NA	A0A077SK19	Escherichia_phage	100.0	9.3e-139
WP_001141908.1|71150_72368_-	hypothetical protein	NA	A0A077SL53	Escherichia_phage	100.0	1.1e-224
WP_000235786.1|72377_72755_-	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_000840931.1|72901_73147_+	hypothetical protein	NA	Q71T86	Escherichia_phage	100.0	5.7e-40
WP_000943607.1|73149_73728_+	norphogenetic protein	NA	Q71T85	Escherichia_phage	99.5	5.7e-107
WP_000096174.1|73794_73950_+	hypothetical protein	NA	Q71TJ4	Escherichia_phage	100.0	7.0e-20
WP_012817939.1|73891_74554_+	hypothetical protein	NA	Q71T83	Escherichia_phage	100.0	4.5e-124
WP_000484110.1|74451_75078_+	norphogenetic protein	NA	Q71T82	Escherichia_phage	100.0	6.1e-123
WP_023352819.1|75074_75752_+	hypothetical protein	NA	Q71TJ1	Escherichia_phage	99.6	1.1e-133
WP_000684868.1|75748_76450_+	hypothetical protein	NA	Q71TJ0	Escherichia_phage	99.6	2.1e-143
WP_023153718.1|76751_78014_+	hypothetical protein	NA	Q71TI8	Escherichia_phage	99.8	9.2e-235
WP_000021768.1|78086_78593_+	hypothetical protein	NA	A0A1B0VAK0	Salmonella_phage	99.4	1.8e-93
WP_023153717.1|78787_79516_+	hypothetical protein	NA	Q71T76	Escherichia_phage	99.1	1.7e-140
WP_000158004.1|79599_79803_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	95.5	5.2e-31
WP_023352820.1|79795_80035_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	97.5	1.3e-36
WP_023154014.1|80031_80757_+	ead/Ea22-like family protein	NA	A0A0U2QW67	Escherichia_phage	49.8	7.5e-48
WP_000118152.1|80753_81053_+	hypothetical protein	NA	Q716F3	Shigella_phage	100.0	1.5e-58
WP_033550033.1|81054_81612_+	ead/Ea22-like family protein	NA	A0A0N7BYR8	Escherichia_phage	62.8	5.1e-36
WP_000224220.1|81613_81877_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	6.7e-31
WP_053903357.1|81887_82487_+	DUF551 domain-containing protein	NA	A0A1B0V865	Salmonella_phage	92.6	7.5e-78
WP_000516537.1|82569_82803_+	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	97.4	1.6e-36
WP_001677496.1|82981_83275_+	hypothetical protein	NA	A0A077SK23	Escherichia_phage	91.8	9.1e-45
WP_023154376.1|83281_83656_+	hypothetical protein	NA	A0A1B0VBU7	Salmonella_phage	97.6	1.1e-66
WP_077780118.1|83637_84570_+	hypothetical protein	NA	A0A1B0VDS6	Salmonella_phage	97.7	2.6e-178
WP_001261544.1|84566_84929_+	hypothetical protein	NA	Q71TI4	Escherichia_phage	100.0	2.2e-56
WP_001377386.1|85590_85842_+	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	94.0	4.6e-37
WP_000506726.1|85965_86355_+	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	99.2	1.4e-69
WP_001190712.1|86427_86649_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216045.1|86648_87029_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	100.0	1.9e-63
WP_000113019.1|87033_87213_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	2.7e-23
WP_000648823.1|87240_88284_+	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	98.8	2.2e-205
WP_001369802.1|88372_88825_+	hypothetical protein	NA	Q71T63	Escherichia_phage	98.7	1.1e-78
WP_000219605.1|88911_90105_+|terminase	terminase	terminase	Q5QBP3	Enterobacteria_phage	99.0	4.1e-208
WP_000124155.1|90104_91589_+	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	100.0	2.5e-292
WP_000611656.1|91613_92465_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	6.1e-158
WP_000874154.1|92575_92785_-	hypothetical protein	NA	Q5XLQ8	Enterobacteria_phage	100.0	4.8e-32
WP_000542336.1|93388_93610_+	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	100.0	4.5e-36
WP_000067534.1|93617_94649_+|integrase	site-specific integrase	integrase	Q71TG5	Escherichia_phage	99.7	2.2e-194
WP_023156637.1|95256_95817_+	Ref family protein	NA	Q5QBN4	Enterobacteria_phage	95.7	2.3e-97
94667:94682	attR	ATTGCTCTAATTATTT	NA	NA	NA	NA
WP_023156639.1|96005_96647_+	hypothetical protein	NA	A0A077SK30	Escherichia_phage	98.1	1.6e-113
