The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	0	8945	5054076	tRNA	Pandoravirus(50.0%)	8	NA	NA
WP_001521233.1|780_1302_+	flavodoxin FldB	NA	NA	NA	NA	NA
WP_000244781.1|1341_1749_-	membrane protein	NA	NA	NA	NA	NA
WP_000354046.1|1729_1996_-	FAD assembly factor SdhE	NA	NA	NA	NA	NA
WP_000886050.1|2238_3219_+|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
WP_000250269.1|3295_3955_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_001182949.1|4118_4430_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_001521235.1|4474_5908_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	3.7e-30
WP_001521236.1|6071_8945_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	4.8e-263
>prophage 2
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	17081	18314	5054076		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|17081_18314_-	D-3-phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 3
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	41816	97424	5054076	transposase,integrase,protease,tRNA	Stx2-converting_phage(57.14%)	55	48442:48459	100912:100929
WP_001319878.1|41816_42575_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105566.1|42780_43701_-	agmatinase	NA	NA	NA	NA	NA
WP_001300904.1|43838_45815_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|45823_45955_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001062128.1|46609_47764_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|48199_49594_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
48442:48459	attL	CAAAAAGAGCCTGATGAT	NA	NA	NA	NA
WP_001300769.1|49670_50168_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|50262_50970_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001300912.1|51049_51781_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|51793_52744_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|52852_53416_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017106.1|53415_53832_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001326494.1|54015_54996_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|55013_55718_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|55735_56302_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_000994920.1|56298_56589_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174777.1|56596_57190_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_000239943.1|57182_58319_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000745244.1|58473_59481_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_029701953.1|59597_60644_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|60819_61539_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|61722_62049_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|62048_62768_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001321419.1|62928_63981_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|64008_64284_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001298916.1|64348_65428_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|65629_66886_+	nucleoside permease	NA	NA	NA	NA	NA
WP_000839790.1|66934_69070_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234533.1|69462_70170_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_029701951.1|70548_71814_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	1.8e-76
WP_023147236.1|72643_74029_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	88.5	7.2e-257
WP_023147237.1|74078_74426_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	97.4	1.2e-59
WP_001171554.1|74422_74803_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001221615.1|75157_75592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032153715.1|75579_75981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221544.1|76240_76810_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001547002.1|77009_77207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453333.1|77581_77794_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_077251901.1|78464_78725_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_029976531.1|78811_79414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000250228.1|81390_82308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001339397.1|82403_83081_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|83080_83428_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_029392005.1|83447_85019_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
WP_001322100.1|85099_85972_+	GTPase family protein	NA	NA	NA	NA	NA
WP_000820521.1|86343_89190_+	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_000422741.1|91056_91482_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624718.1|91478_91829_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	2.1e-40
WP_048237919.1|91859_93452_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.6	2.1e-175
WP_000581493.1|94422_94878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001119719.1|94956_95190_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001234642.1|95289_96108_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	1.5e-44
WP_029701480.1|96162_96648_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	34.4	2.0e-12
WP_001347688.1|96663_97140_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692300.1|97202_97424_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.1e-10
100912:100929	attR	CAAAAAGAGCCTGATGAT	NA	NA	NA	NA
>prophage 4
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	101651	102635	5054076		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001298261.1|101651_102635_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.4	1.4e-36
>prophage 5
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	114983	116223	5054076		Hokovirus(50.0%)	2	NA	NA
WP_001542355.1|114983_115379_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.7	2.5e-29
WP_029701466.1|115548_116223_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	7.1e-08
>prophage 6
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	162616	163501	5054076		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018760.1|162616_163501_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 7
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	169577	178928	5054076		Staphylococcus_phage(33.33%)	7	NA	NA
WP_000013149.1|169577_170405_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
WP_000691628.1|170604_171531_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848528.1|171581_171839_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095187.1|171881_174101_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000059388.1|174211_175624_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965722.1|175698_176436_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_001281841.1|176669_178928_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.8e-84
>prophage 8
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	182238	182631	5054076		Stx_converting_phage(100.0%)	1	NA	NA
WP_000712658.1|182238_182631_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 9
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	186458	197421	5054076		Bacillus_virus(20.0%)	12	NA	NA
WP_000195292.1|186458_188351_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.9	7.6e-92
WP_000105733.1|188379_188961_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444747.1|188960_189788_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|189812_190235_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|190235_190865_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735278.1|191069_192551_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|192698_193370_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442860.1|193375_194536_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000188362.1|194573_195389_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_001295627.1|195504_196278_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000469266.1|196335_196506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076997.1|196767_197421_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 10
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	206938	208372	5054076		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|206938_208372_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 11
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	213509	214748	5054076	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708491.1|213509_214748_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	7.7e-93
>prophage 12
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	221050	237188	5054076	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264352.1|221050_222064_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
WP_001144069.1|222301_222517_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918837.1|222627_224373_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.2	2.4e-76
WP_000437371.1|224567_226409_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|226487_226994_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_029701451.1|227247_228012_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018005.1|228288_228912_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000094730.1|229018_230539_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
WP_000633385.1|230845_232336_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	2.4e-32
WP_000450588.1|232377_232710_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212458.1|232928_233912_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_021523277.1|234095_237188_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.2	3.4e-158
>prophage 13
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	248905	249871	5054076		Escherichia_phage(100.0%)	1	NA	NA
WP_001098805.1|248905_249871_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 14
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	271431	273726	5054076		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861720.1|271431_273726_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	1.7e-157
>prophage 15
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	281709	282855	5054076		Streptococcus_phage(100.0%)	1	NA	NA
WP_001521378.1|281709_282855_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	42.0	5.2e-51
>prophage 16
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	300476	308271	5054076		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809258.1|300476_301340_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.6e-50
WP_001521387.1|301404_303441_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_001521388.1|303398_303794_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158035.1|303813_304404_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646047.1|304413_304989_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001521390.1|305101_306142_-	permease	NA	NA	NA	NA	NA
WP_000084526.1|306214_306850_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037605.1|306977_307496_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	5.8e-10
WP_001521391.1|307475_307919_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189309.1|307968_308271_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	6.6e-14
>prophage 17
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	313973	315863	5054076		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|313973_315863_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 18
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	321339	327978	5054076		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133044.1|321339_324012_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031055.1|324036_325524_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|325551_326004_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207680.1|326634_327978_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 19
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	332058	334931	5054076	protease	Pandoravirus(50.0%)	2	NA	NA
WP_001603854.1|332058_332907_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|332996_334931_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 20
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	341559	343037	5054076		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|341559_342531_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445407.1|342758_343037_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	3.4e-17
>prophage 21
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	347105	361899	5054076		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|347105_347915_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922873.1|348124_349102_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|349115_350102_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030006.1|350122_350689_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.5	6.5e-55
WP_000030537.1|350685_351261_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|351229_351787_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|351793_352519_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|352566_354000_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|354022_354310_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183676.1|354427_354919_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|354964_355819_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|355815_356088_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620396.1|356300_356933_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_020233285.1|356929_357658_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001300411.1|357654_358308_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_020233286.1|358537_360874_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.1	5.8e-41
WP_001521402.1|360969_361899_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 22
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	368648	373381	5054076		Salmonella_phage(50.0%)	5	NA	NA
WP_001521407.1|368648_369761_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	4.7e-73
WP_000979887.1|369820_370285_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000209000.1|370281_371157_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000054239.1|371153_371843_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_001521408.1|371890_373381_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.9	3.7e-09
>prophage 23
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	377086	377584	5054076	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366126.1|377086_377584_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
>prophage 24
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	381550	384075	5054076	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001295271.1|381550_382918_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497723.1|383007_384075_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 25
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	400571	401615	5054076		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|400571_401615_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 26
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	412180	413065	5054076		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258942.1|412180_413065_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	29.8	1.6e-23
>prophage 27
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	419569	423723	5054076		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738579.1|419569_420595_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
WP_000019674.1|420662_421844_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001308990.1|421853_422957_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078344.1|422964_423723_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
>prophage 28
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	434230	435702	5054076	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|434230_434740_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004456.1|434754_435702_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 29
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	455579	461153	5054076		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_000031783.1|455579_456764_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124703.1|456834_458949_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.7	1.1e-57
WP_001138043.1|459045_459516_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|459612_459987_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903377.1|460112_460400_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820714.1|460407_460767_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_001209690.1|460766_461153_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.1	3.3e-18
>prophage 30
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	466724	476265	5054076		Tupanvirus(25.0%)	9	NA	NA
WP_020232893.1|466724_468638_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	1.5e-74
WP_001521449.1|468637_469660_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|469653_469872_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274680.1|469925_470795_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|470849_471254_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|471555_472188_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001295162.1|472238_474329_+	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000963771.1|474395_475616_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_001521451.1|475701_476265_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	1.3e-60
>prophage 31
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	495170	496007	5054076		Vibrio_phage(100.0%)	1	NA	NA
WP_000742141.1|495170_496007_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 32
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	512913	517425	5054076		Bacillus_phage(66.67%)	5	NA	NA
WP_001521469.1|512913_514536_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.3	1.2e-141
WP_000493756.1|514652_514970_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000650973.1|515028_515325_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001253707.1|515356_516709_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	4.7e-11
WP_001157751.1|516705_517425_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 33
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	523990	524884	5054076		Sodalis_phage(100.0%)	1	NA	NA
WP_000039100.1|523990_524884_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.5e-69
>prophage 34
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	531044	533438	5054076		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_001521478.1|531044_533438_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 35
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	537828	539055	5054076		Ralstonia_phage(100.0%)	1	NA	NA
WP_001521480.1|537828_539055_-	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	60.2	8.9e-134
>prophage 36
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	548368	550816	5054076		Dickeya_phage(100.0%)	1	NA	NA
WP_000993442.1|548368_550816_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 37
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	570826	572637	5054076		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073586.1|570826_571570_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	24.9	9.9e-11
WP_000907822.1|571566_572637_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 38
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	576179	577662	5054076		Planktothrix_phage(50.0%)	2	NA	NA
WP_001521501.1|576179_576893_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	30.6	2.0e-13
WP_000082101.1|576894_577662_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 39
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	583397	586216	5054076		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|583397_584252_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|584496_585555_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|585547_586216_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 40
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	589222	593355	5054076		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|589222_589849_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_001521507.1|589922_592121_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.5	1.9e-118
WP_000130615.1|592223_592469_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100467.1|592689_593355_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
>prophage 41
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	601248	606851	5054076		Bacillus_virus(50.0%)	3	NA	NA
WP_001521512.1|601248_602055_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	5.9e-17
WP_001190062.1|602059_602461_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_048237751.1|602663_606851_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	43.8	7.5e-23
>prophage 42
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	610792	611452	5054076		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_042045864.1|610792_611452_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	37.8	1.1e-24
>prophage 43
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	615062	617798	5054076		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001586382.1|615062_617798_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 44
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	631208	633251	5054076		Indivirus(100.0%)	1	NA	NA
WP_001298719.1|631208_633251_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	6.8e-46
>prophage 45
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	636599	638735	5054076		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000008965.1|636599_636953_+	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	1.3e-24
WP_001328189.1|637007_638297_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	2.3e-172
WP_000065800.1|638309_638735_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	2.5e-51
>prophage 46
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	651803	653273	5054076		Pithovirus(50.0%)	2	NA	NA
WP_001521540.1|651803_652574_+	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.6	2.3e-18
WP_001296814.1|652625_653273_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 47
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	699774	701759	5054076		Bacillus_virus(50.0%)	2	NA	NA
WP_000103574.1|699774_700779_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
WP_001196487.1|700775_701759_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
>prophage 48
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	711700	714034	5054076		Escherichia_phage(100.0%)	1	NA	NA
WP_001521567.1|711700_714034_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.4	7.0e-71
>prophage 49
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	717688	717901	5054076		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|717688_717901_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 50
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	722524	723520	5054076		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182662.1|722524_723520_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.8	1.6e-11
>prophage 51
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	728837	730379	5054076		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001521578.1|728837_730379_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 52
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	758839	760684	5054076		Tupanvirus(100.0%)	1	NA	NA
WP_020233168.1|758839_760684_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.5e-15
>prophage 53
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	783010	792517	5054076		Rhizobium_phage(16.67%)	9	NA	NA
WP_000024392.1|783010_783262_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|783403_783835_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116566.1|784079_785624_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214156.1|785633_786917_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483830.1|786920_787880_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982100.1|787866_788901_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000646014.1|789139_790165_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213834.1|790174_791371_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000587750.1|791584_792517_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
>prophage 54
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	795871	798482	5054076		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_001052917.1|795871_796645_-	glycosyltransferase family 25 protein	NA	A0A0P0YNC5	Yellowstone_lake_phycodnavirus	33.7	7.6e-06
WP_100190631.1|797756_798482_-	glycosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	26.4	8.1e-10
>prophage 55
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	805920	810483	5054076		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171866.1|805920_806400_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
WP_001114542.1|806438_807248_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.2	5.9e-25
WP_001051798.1|807345_807513_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|807533_807770_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001521609.1|807986_808655_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000050153.1|808826_810047_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	5.0e-44
WP_001298007.1|810027_810483_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
>prophage 56
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	813857	820609	5054076		Morganella_phage(25.0%)	6	NA	NA
WP_001521610.1|813857_814682_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	79.0	1.2e-97
WP_000924289.1|814974_815592_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001521612.1|815588_817271_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	3.9e-23
WP_001521613.1|817528_818152_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.9	7.0e-18
WP_000135058.1|818206_818482_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280473.1|818500_820609_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 57
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	824909	826301	5054076		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|824909_826301_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 58
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	839810	840995	5054076	integrase	Enterobacteria_phage(100.0%)	1	834601:834617	847818:847834
834601:834617	attL	AATGCCGTTAATCAGTA	NA	NA	NA	NA
WP_001218910.1|839810_840995_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	2.6e-162
WP_001218910.1|839810_840995_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	2.6e-162
847818:847834	attR	TACTGATTAACGGCATT	NA	NA	NA	NA
>prophage 59
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	873310	874645	5054076		Moraxella_phage(100.0%)	1	NA	NA
WP_001586450.1|873310_874645_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.2	3.0e-66
>prophage 60
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	885459	893936	5054076		Micromonas_sp._RCC1109_virus(25.0%)	9	NA	NA
WP_001521691.1|885459_887148_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.4	1.3e-55
WP_001300753.1|887253_887352_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000060506.1|887916_888006_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001306726.1|888285_889470_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	6.8e-14
WP_000148043.1|889477_889975_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|889971_890334_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|890323_890671_-	YidH family protein	NA	NA	NA	NA	NA
WP_001521692.1|890730_892224_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.7	6.6e-30
WP_001521693.1|892220_893936_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	4.3e-41
>prophage 61
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	900796	901750	5054076		Synechococcus_phage(50.0%)	2	NA	NA
WP_001243431.1|900796_901225_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|901336_901750_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 62
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	906177	907326	5054076		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|906177_907326_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 63
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	912030	919399	5054076		Bacillus_virus(33.33%)	8	NA	NA
WP_001521708.1|912030_914445_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060112.1|914473_915547_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|915546_916647_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|916651_918055_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_122134670.1|918351_918432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000831330.1|918661_918802_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|918818_919178_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|919141_919399_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 64
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	932778	934116	5054076		Moraxella_phage(100.0%)	1	NA	NA
WP_001316740.1|932778_934116_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 65
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	943119	950634	5054076		Bacillus_phage(25.0%)	6	NA	NA
WP_000063125.1|943119_943893_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251991.1|943983_944874_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|944873_945833_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867151.1|945918_946959_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000334086.1|947272_949102_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	5.6e-132
WP_001521725.1|949263_950634_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	6.9e-34
>prophage 66
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	962586	963579	5054076		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845107.1|962586_963579_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 67
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	966747	973308	5054076	transposase	Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
WP_000102332.1|966747_968616_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	2.3e-64
WP_000526135.1|968799_969258_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_000715936.1|969493_969913_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387770.1|969920_971426_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000211858.1|971430_972396_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_020233744.1|972420_973308_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.7	4.3e-05
>prophage 68
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	986702	988349	5054076		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012630.1|986702_988349_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	32.2	6.7e-68
>prophage 69
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	996677	1002091	5054076		Bacillus_phage(33.33%)	4	NA	NA
WP_001521748.1|996677_998699_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	4.9e-113
WP_001445788.1|998745_1000230_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001521751.1|1000365_1001631_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	5.4e-41
WP_001280776.1|1001761_1002091_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 70
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1006121	1010361	5054076		Catovirus(33.33%)	4	NA	NA
WP_001306792.1|1006121_1007252_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.9e-27
WP_001521756.1|1007248_1008511_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.3e-23
WP_029701885.1|1008551_1009226_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612044.1|1009230_1010361_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 71
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1018378	1020034	5054076		Tetraselmis_virus(100.0%)	1	NA	NA
WP_021523313.1|1018378_1020034_-	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	6.1e-45
>prophage 72
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1030334	1034193	5054076		Bacillus_phage(100.0%)	3	NA	NA
WP_000130691.1|1030334_1031231_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213584.1|1031230_1031947_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383407.1|1032030_1034193_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 73
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1041570	1043400	5054076		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|1041570_1043400_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 74
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1058038	1061325	5054076		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187543.1|1058038_1059679_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	4.8e-42
WP_001295260.1|1059757_1060027_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459600.1|1060030_1060546_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109943.1|1060548_1061325_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 75
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1070106	1070721	5054076		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296979.1|1070106_1070721_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 76
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1078378	1079726	5054076	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_100190636.1|1078378_1079726_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
>prophage 77
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1086558	1089345	5054076		uncultured_virus(100.0%)	1	NA	NA
WP_000250006.1|1086558_1089345_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 78
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1093423	1095894	5054076		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001188777.1|1093423_1094833_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190577.1|1094844_1095894_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 79
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1113602	1116382	5054076		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001521799.1|1113602_1114499_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	89.9	1.8e-59
WP_001521800.1|1114666_1115563_+	sulfofructose kinase	NA	NA	NA	NA	NA
WP_001521801.1|1115596_1116382_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
>prophage 80
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1127893	1130944	5054076		Escherichia_phage(100.0%)	1	NA	NA
WP_011310337.1|1127893_1130944_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 81
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1146692	1151553	5054076		Bacillus_thuringiensis_phage(33.33%)	5	NA	NA
WP_001297064.1|1146692_1147313_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001166043.1|1147572_1148556_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270251.1|1148704_1149379_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580427.1|1149484_1150858_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	26.2	2.9e-16
WP_001033722.1|1150854_1151553_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 82
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1163127	1167630	5054076		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_000084268.1|1163127_1163973_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|1164397_1164643_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|1164727_1165213_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|1165305_1166232_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293344.1|1166298_1167630_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 83
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1173267	1177440	5054076		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_032152781.1|1173267_1177440_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	33.5	4.0e-24
>prophage 84
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1184755	1186309	5054076		Pandoravirus(100.0%)	1	NA	NA
WP_000694075.1|1184755_1186309_+	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	23.8	3.0e-09
>prophage 85
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1193177	1200424	5054076		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424838.1|1193177_1193840_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_001521842.1|1193851_1196353_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001004446.1|1196661_1197741_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001521843.1|1197755_1198076_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001521845.1|1198126_1200424_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 86
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1217410	1219255	5054076		Acinetobacter_phage(100.0%)	1	NA	NA
WP_021523320.1|1217410_1219255_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.6	5.5e-10
>prophage 87
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1227594	1230647	5054076		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023085.1|1227594_1228545_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	1.1e-27
WP_000031784.1|1229462_1230647_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 88
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1234763	1243092	5054076		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|1234763_1238792_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|1238868_1243092_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 89
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1252455	1254219	5054076		Klosneuvirus(50.0%)	3	NA	NA
WP_000362388.1|1252455_1253127_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000940106.1|1253169_1253760_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|1253946_1254219_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 90
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1259608	1261198	5054076		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187540.1|1259608_1261198_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 91
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1277121	1284089	5054076	transposase	Dickeya_phage(50.0%)	3	NA	NA
WP_000096041.1|1277121_1280805_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
WP_000956830.1|1281024_1282656_+	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_100190637.1|1282741_1284089_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
>prophage 92
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1305686	1306802	5054076		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|1305686_1306802_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 93
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1316017	1316626	5054076		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|1316017_1316626_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 94
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1323187	1325735	5054076		Escherichia_phage(50.0%)	2	NA	NA
WP_000918363.1|1323187_1324603_+	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_001147328.1|1324655_1325735_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
>prophage 95
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1329941	1333555	5054076		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357740.1|1329941_1332764_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|1333018_1333555_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 96
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1337372	1338722	5054076		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|1337372_1338722_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 97
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1344331	1346290	5054076		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078214.1|1344331_1346290_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.7	1.1e-90
>prophage 98
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1355574	1357722	5054076		Escherichia_phage(100.0%)	1	NA	NA
WP_100190638.1|1355574_1357722_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	3.1e-33
>prophage 99
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1362967	1364953	5054076		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001522248.1|1362967_1364953_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	45.2	4.6e-148
>prophage 100
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1368835	1370385	5054076		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611392.1|1368835_1369516_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	6.7e-06
WP_001075537.1|1369626_1370385_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	7.9e-16
>prophage 101
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1376009	1376798	5054076		Pithovirus(100.0%)	1	NA	NA
WP_001193403.1|1376009_1376798_-	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.2	3.2e-12
>prophage 102
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1381637	1383140	5054076		Burkholderia_virus(100.0%)	1	NA	NA
WP_001305708.1|1381637_1383140_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	7.0e-56
>prophage 103
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1404337	1407549	5054076	tRNA	Catovirus(50.0%)	2	NA	NA
WP_000003806.1|1404337_1405855_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856827.1|1406091_1407549_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.8	2.3e-48
>prophage 104
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1421824	1423808	5054076		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|1421824_1422118_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|1422161_1423808_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 105
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1428722	1429256	5054076		Morganella_phage(100.0%)	1	NA	NA
WP_001522351.1|1428722_1429256_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.1e-47
>prophage 106
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1434175	1435153	5054076		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|1434175_1435153_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 107
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1442581	1443127	5054076		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|1442581_1443127_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 108
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1447163	1460194	5054076	protease,tRNA	Vibrio_phage(20.0%)	11	NA	NA
WP_020233522.1|1447163_1448501_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122460.1|1448510_1450358_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_001280339.1|1450350_1451301_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|1451386_1451695_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|1451770_1453051_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312481.1|1453136_1454396_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|1454398_1455403_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|1455484_1455682_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|1455785_1457084_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|1457288_1457714_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076315.1|1457752_1460194_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
>prophage 109
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1464037	1465201	5054076		Ralstonia_phage(100.0%)	1	NA	NA
WP_000944019.1|1464037_1465201_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	8.3e-81
>prophage 110
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1479495	1480704	5054076	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_024194431.1|1479495_1480704_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.5	1.0e-206
>prophage 111
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1501851	1508332	5054076		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_000055075.1|1501851_1502382_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_001522398.1|1502691_1503648_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_001522399.1|1503780_1505283_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_001361374.1|1505296_1506319_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596021.1|1506305_1507301_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|1507333_1508332_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 112
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1512791	1516102	5054076		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_000212715.1|1512791_1513034_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	50.0	1.4e-14
WP_001105433.1|1513023_1513314_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	63.8	3.8e-27
WP_001009182.1|1513314_1513779_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	8.5e-53
WP_000187798.1|1513963_1516102_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
>prophage 113
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1519740	1525837	5054076		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_001181324.1|1519740_1520688_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|1520872_1520926_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471850.1|1521066_1523763_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.3	3.4e-45
WP_000047539.1|1523968_1524355_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|1524427_1524889_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|1524901_1525837_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 114
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1534105	1543381	5054076	tRNA	Klosneuvirus(33.33%)	6	NA	NA
WP_000416387.1|1534105_1536961_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786399.1|1536960_1537404_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|1537757_1539269_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|1539535_1540636_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|1540635_1541718_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_021523335.1|1541878_1543381_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	43.9	1.4e-83
>prophage 115
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1548508	1549528	5054076		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_001318460.1|1548508_1549528_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
>prophage 116
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1559179	1567537	5054076	transposase	Shigella_phage(20.0%)	7	NA	NA
WP_085948656.1|1559179_1560346_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.8e-184
WP_000625671.1|1560281_1560695_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001293436.1|1560757_1562755_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_085947616.1|1562908_1564065_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000177057.1|1564998_1565256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|1565812_1566580_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684855.1|1566580_1567537_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	2.4e-17
>prophage 117
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1577712	1579872	5054076	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_000998019.1|1577712_1579098_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000612591.1|1579147_1579495_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171523.1|1579491_1579872_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
>prophage 118
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1592088	1594496	5054076		Yersinia_phage(50.0%)	3	NA	NA
WP_001234656.1|1592088_1592907_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	1.6e-46
WP_001186775.1|1593735_1594212_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|1594274_1594496_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
>prophage 119
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1615759	1620934	5054076	transposase	Stx2-converting_phage(75.0%)	5	NA	NA
WP_048237919.1|1615759_1617352_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.6	2.1e-175
WP_000624718.1|1617382_1617733_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	2.1e-40
WP_000422741.1|1617729_1618155_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_001323209.1|1618384_1619371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991438.1|1619953_1620934_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	56.6	4.7e-101
>prophage 120
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1624296	1625973	5054076		Escherichia_phage(100.0%)	2	NA	NA
WP_000790583.1|1624296_1624899_+	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
WP_000044711.1|1625376_1625973_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 121
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1636239	1637700	5054076		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208176.1|1636239_1637700_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.9	6.2e-49
>prophage 122
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1650768	1651689	5054076	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000181195.1|1650768_1651689_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.7	2.2e-60
>prophage 123
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1666434	1668099	5054076		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000919580.1|1666434_1668099_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	5.3e-12
>prophage 124
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1678724	1680004	5054076		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|1678724_1679462_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_001350779.1|1679464_1680004_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	3.8e-28
>prophage 125
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1687902	1690778	5054076		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175940.1|1687902_1689492_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001295748.1|1689884_1690490_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|1690616_1690778_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 126
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1696365	1697688	5054076		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|1696365_1697688_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 127
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1704405	1705638	5054076		Enterococcus_phage(100.0%)	1	NA	NA
WP_000093813.1|1704405_1705638_+	trifunctional nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase/transcriptional regulator NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
>prophage 128
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1709938	1715163	5054076	transposase	Bacillus_phage(66.67%)	3	NA	NA
WP_100190637.1|1709938_1711286_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
WP_000046749.1|1711347_1713015_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_021523345.1|1713225_1715163_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 129
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1718349	1720463	5054076		Bacillus_phage(50.0%)	2	NA	NA
WP_001188679.1|1718349_1719039_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_021523346.1|1719038_1720463_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.7	4.2e-10
>prophage 130
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1732830	1741897	5054076		Cyanophage(20.0%)	9	NA	NA
WP_000130187.1|1732830_1733784_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
WP_001094685.1|1733898_1734486_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528538.1|1734520_1735087_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001102367.1|1735235_1735949_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843579.1|1735974_1736379_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|1736753_1738670_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|1738758_1739889_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000935262.1|1739992_1740202_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_000681352.1|1740730_1741897_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	1.7e-89
>prophage 131
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1751382	1754199	5054076	tRNA	Moumouvirus(100.0%)	1	NA	NA
WP_001520439.1|1751382_1754199_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2P1ELB8	Moumouvirus	26.3	3.5e-77
>prophage 132
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1758986	1760135	5054076		Halovirus(100.0%)	1	NA	NA
WP_029701411.1|1758986_1760135_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 133
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1765638	1771288	5054076		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001520452.1|1765638_1767192_-	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.1	1.2e-34
WP_000349954.1|1767265_1768483_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|1768600_1769743_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787109.1|1769773_1771288_-	L-carnitine/gamma-butyrobetaine antiporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 134
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1779182	1781143	5054076		Bacillus_phage(50.0%)	4	NA	NA
WP_000624375.1|1779182_1779662_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_001520458.1|1779747_1779981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001520461.1|1779983_1780235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000257196.1|1780294_1781143_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
>prophage 135
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1790231	1795653	5054076		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117011.1|1790231_1793138_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_032152759.1|1793301_1795653_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.2	8.7e-37
>prophage 136
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1801985	1802684	5054076		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916278.1|1801985_1802684_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.1e-23
>prophage 137
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1815173	1816898	5054076		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425672.1|1815173_1816898_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.9e-36
>prophage 138
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1842982	1844026	5054076		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217337.1|1842982_1844026_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 139
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1848271	1848823	5054076		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923726.1|1848271_1848823_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.5e-11
>prophage 140
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1857450	1858875	5054076		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|1857450_1858875_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 141
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1866546	1873008	5054076		Mamastrovirus(33.33%)	5	NA	NA
WP_001550615.1|1866546_1868097_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	4.6e-18
WP_021516789.1|1868143_1870528_-	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|1870733_1871270_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|1871310_1871973_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|1872081_1873008_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 142
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1876270	1877161	5054076	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_021522998.1|1876270_1877161_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	49.8	6.2e-60
>prophage 143
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1886363	1893169	5054076	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_071593646.1|1886363_1887782_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937404.1|1887820_1888747_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|1888783_1889239_-	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
WP_000396050.1|1889416_1890121_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294687.1|1890135_1890666_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001520511.1|1890739_1893169_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	31.4	6.0e-41
>prophage 144
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1898307	1899105	5054076		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|1898307_1899105_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 145
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1905016	1905361	5054076		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|1905016_1905361_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 146
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1909290	1910715	5054076	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001520514.1|1909290_1910715_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
>prophage 147
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1922563	1986503	5054076	transposase,plate,protease,tRNA	Flavobacterium_phage(10.0%)	53	NA	NA
WP_001520518.1|1922563_1923322_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
WP_020233386.1|1923334_1924192_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001520521.1|1924203_1925556_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|1925585_1928018_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|1928139_1928625_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139282.1|1928628_1929654_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|1929758_1930214_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|1930217_1931006_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139675.1|1931005_1932154_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569434.1|1932150_1932747_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
WP_001520523.1|1932783_1936266_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.0	1.7e-209
WP_000055748.1|1936278_1937238_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|1937335_1939477_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|1939533_1939923_+	VOC family protein	NA	NA	NA	NA	NA
WP_001520525.1|1939987_1941286_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062315.1|1941334_1941595_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|1941581_1941782_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185283.1|1941947_1942493_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635534.1|1942489_1942912_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001520527.1|1942925_1943636_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_021523001.1|1943665_1944490_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_020233843.1|1944542_1946261_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094022.1|1946371_1947079_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202321.1|1947075_1947480_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|1947597_1948413_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|1948452_1949106_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|1949098_1950130_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001520530.1|1950317_1950890_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997053.1|1956650_1957454_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	5.4e-39
WP_000648583.1|1957450_1958365_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|1958605_1959406_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_001521855.1|1959483_1960254_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|1960300_1961659_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_021523003.1|1961730_1962486_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001295200.1|1962519_1963242_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|1963238_1963706_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001308374.1|1963770_1964502_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_001086163.1|1965040_1965826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001521857.1|1965974_1966442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908071.1|1966451_1967366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000002621.1|1967409_1967892_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087587.1|1967915_1969268_-	membrane protein	NA	NA	NA	NA	NA
WP_122452236.1|1969278_1972713_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240537.1|1972821_1974234_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088867.1|1974238_1974982_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_029702118.1|1974978_1977942_-	AAA domain-containing protein	NA	A0A1C3S747	Escherichia_phage	28.3	2.3e-74
WP_085970120.1|1978519_1979732_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.3	6.0e-167
WP_000246418.1|1980029_1981361_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|1981363_1981888_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001550643.1|1981884_1983165_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348804.1|1983189_1984272_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001521865.1|1984235_1986086_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001521866.1|1986089_1986503_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 148
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	1990219	1996936	5054076		Ralstonia_phage(50.0%)	2	NA	NA
WP_001550647.1|1990219_1992361_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.8	1.8e-25
WP_021516938.1|1992436_1996936_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.5	4.7e-23
>prophage 149
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2003214	2006437	5054076		Caulobacter_phage(50.0%)	4	NA	NA
WP_000284050.1|2003214_2003793_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|2003908_2004676_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|2004646_2005387_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_016233951.1|2005687_2006437_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
>prophage 150
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2016594	2020306	5054076		Streptococcus_phage(66.67%)	3	NA	NA
WP_000749881.1|2016594_2017650_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|2017937_2019041_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_001521908.1|2019052_2020306_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	2.9e-95
>prophage 151
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2031942	2034141	5054076		Acinetobacter_phage(100.0%)	1	NA	NA
WP_021516944.1|2031942_2034141_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	3.3e-38
>prophage 152
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2052360	2053212	5054076		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001521924.1|2052360_2053212_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.5e-47
>prophage 153
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2059258	2062563	5054076		Staphylococcus_phage(50.0%)	4	NA	NA
WP_021516948.1|2059258_2060128_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	7.1e-53
WP_001521928.1|2060287_2060881_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474077.1|2060892_2061129_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046306.1|2061237_2062563_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
>prophage 154
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2068137	2074057	5054076	holin	Catovirus(50.0%)	4	NA	NA
WP_001521934.1|2068137_2069808_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	2.3e-60
WP_000089090.1|2069821_2071294_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001376735.1|2071307_2071895_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131040.1|2072023_2074057_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 155
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2086738	2091276	5054076		Bacillus_virus(50.0%)	4	NA	NA
WP_021523012.1|2086738_2088223_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	4.7e-12
WP_000818902.1|2088215_2089187_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000750344.1|2089183_2090140_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_100190642.1|2090226_2091276_+	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	44.7	2.4e-71
>prophage 156
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2099656	2105251	5054076		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001521955.1|2099656_2101543_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	1.4e-53
WP_000076233.1|2101779_2103039_+	cytosine permease	NA	NA	NA	NA	NA
WP_000952490.1|2104351_2105251_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	1.9e-16
>prophage 157
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2109776	2114056	5054076		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_001521962.1|2109776_2112851_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	97.7	0.0e+00
WP_000805887.1|2112973_2114056_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	98.9	4.1e-191
>prophage 158
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2119466	2121427	5054076		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_001521966.1|2119466_2120417_+	acetaldehyde dehydrogenase (acetylating)	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	1.9e-35
WP_001013507.1|2120413_2121427_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	3.2e-44
>prophage 159
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2124510	2125620	5054076		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|2124510_2125620_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 160
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2130909	2131677	5054076		Planktothrix_phage(100.0%)	1	NA	NA
WP_001521976.1|2130909_2131677_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.8	2.1e-24
>prophage 161
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2138546	2139704	5054076		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830732.1|2138546_2139704_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
>prophage 162
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2147118	2148234	5054076		Bacillus_phage(100.0%)	1	NA	NA
WP_001521984.1|2147118_2148234_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 163
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2152523	2153435	5054076		Salmonella_phage(100.0%)	1	NA	NA
WP_001298537.1|2152523_2153435_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
>prophage 164
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2156893	2163468	5054076		Bacillus_phage(75.0%)	4	NA	NA
WP_001521993.1|2156893_2160037_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001521994.1|2160033_2161236_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000113933.1|2161425_2162115_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_029702132.1|2162172_2163468_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.4	6.5e-26
>prophage 165
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2172205	2176545	5054076	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
WP_000667319.1|2172205_2173333_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|2173355_2173688_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|2173715_2175563_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|2175573_2176545_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
>prophage 166
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2179856	2183504	5054076	transposase	Escherichia_phage(33.33%)	4	NA	NA
WP_071779335.1|2179856_2181014_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.5	4.0e-200
WP_000543535.1|2181388_2181838_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001522013.1|2181841_2182945_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.8	6.3e-54
WP_001021161.1|2183033_2183504_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 167
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2206860	2211907	5054076	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|2206860_2207484_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|2207609_2208884_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|2209071_2211426_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|2211634_2211907_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 168
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2215047	2215743	5054076		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817227.1|2215047_2215743_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 169
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2225105	2228255	5054076		Leptospira_phage(100.0%)	1	NA	NA
WP_001132480.1|2225105_2228255_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	4.7e-54
>prophage 170
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2235093	2246468	5054076	transposase	Klosneuvirus(20.0%)	10	NA	NA
WP_000127356.1|2235093_2235645_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122011.1|2235773_2237705_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|2237757_2238087_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|2238086_2238692_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678201.1|2238801_2240676_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001220233.1|2240856_2241501_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250117.1|2241632_2242595_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801805.1|2242591_2243551_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	2.5e-14
WP_000671574.1|2243702_2245007_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_100190644.1|2245119_2246468_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
>prophage 171
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2253519	2256024	5054076		uncultured_virus(100.0%)	1	NA	NA
WP_001522043.1|2253519_2256024_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.5	1.0e-115
>prophage 172
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2281095	2283258	5054076		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_020233592.1|2281095_2283258_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	31.5	2.4e-17
>prophage 173
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2288961	2289639	5054076		Bacillus_virus(100.0%)	1	NA	NA
WP_001522056.1|2288961_2289639_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 174
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2292775	2300429	5054076		Planktothrix_phage(50.0%)	3	NA	NA
WP_001110573.1|2292775_2293462_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_001522060.1|2293458_2295873_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_021523019.1|2296301_2300429_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.5	1.1e-23
>prophage 175
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2306537	2308319	5054076		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001309310.1|2306537_2308319_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	7.8e-38
>prophage 176
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2314511	2315657	5054076		Streptococcus_phage(100.0%)	1	NA	NA
WP_001522069.1|2314511_2315657_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	42.3	4.8e-49
>prophage 177
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2327093	2330224	5054076	tRNA	Moumouvirus(50.0%)	4	NA	NA
WP_000912350.1|2327093_2328479_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001522081.1|2328514_2329036_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190286.1|2329143_2329356_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|2329357_2330224_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
>prophage 178
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2346649	2347348	5054076		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001328511.1|2346649_2347348_-	RHS repeat-associated core domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	40.4	3.1e-14
>prophage 179
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2355854	2360614	5054076		Ralstonia_phage(33.33%)	3	NA	NA
WP_001522505.1|2355854_2357756_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	6.6e-27
WP_020233798.1|2358492_2359941_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	3.9e-11
WP_000770953.1|2359930_2360614_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 180
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2363759	2366903	5054076		Leptospira_phage(100.0%)	1	NA	NA
WP_001522511.1|2363759_2366903_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	9.8e-60
>prophage 181
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2378331	2384374	5054076		Tupanvirus(50.0%)	3	NA	NA
WP_001522519.1|2378331_2382213_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.6	4.9e-61
WP_021523039.1|2382428_2383562_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140646.1|2383558_2384374_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 182
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2398664	2400487	5054076		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502941.1|2398664_2399294_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
WP_000029780.1|2399266_2400487_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.3	7.9e-58
>prophage 183
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2403596	2405711	5054076		Bacillus_virus(50.0%)	2	NA	NA
WP_032142912.1|2403596_2405162_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.6	1.7e-44
WP_000278505.1|2405282_2405711_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
>prophage 184
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2419799	2420446	5054076		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|2419799_2420009_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939738.1|2420062_2420446_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 185
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2425264	2427704	5054076		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|2425264_2426476_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231416.1|2426615_2427704_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 186
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2434714	2439838	5054076	tRNA	Staphylococcus_phage(50.0%)	4	NA	NA
WP_001157896.1|2434714_2437297_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	1.2e-183
WP_001044880.1|2437532_2438015_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_020233368.1|2438059_2438995_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631384.1|2439112_2439838_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 187
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2445721	2446801	5054076		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|2445721_2446801_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 188
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2450896	2452561	5054076		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337063.1|2450896_2452561_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.3	6.1e-85
>prophage 189
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2457187	2461713	5054076	transposase,tRNA	Vibrio_phage(50.0%)	3	NA	NA
WP_001522554.1|2457187_2459134_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	9.2e-08
WP_000526135.1|2459357_2459816_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_020233305.1|2460048_2461713_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.7	0.0e+00
>prophage 190
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2465864	2466629	5054076		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773272.1|2465864_2466629_-	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	32.4	5.8e-06
>prophage 191
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2473284	2491590	5054076		Hokovirus(28.57%)	13	NA	NA
WP_000186102.1|2473284_2473962_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	8.9e-27
WP_001522559.1|2473958_2476643_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	6.5e-12
WP_001522564.1|2476635_2477208_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_001522567.1|2477216_2479265_-	potassium-transporting ATPase subunit KdpB	NA	A0A218MNH6	uncultured_virus	27.6	2.3e-25
WP_001522568.1|2479287_2480961_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001365534.1|2480960_2481050_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424926.1|2481361_2481568_+	YbfA family protein	NA	NA	NA	NA	NA
WP_100190646.1|2481815_2485955_+	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	45.5	6.7e-24
WP_000720081.1|2485951_2486455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021523046.1|2486519_2487125_+	RHS repeat-associated core domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	38.3	5.5e-20
WP_001522578.1|2488141_2488651_+	YbgA family protein	NA	NA	NA	NA	NA
WP_021517020.1|2488647_2490066_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.8	4.0e-61
WP_001522583.1|2490108_2491590_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	4.2e-45
>prophage 192
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2494968	2495760	5054076		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114011.1|2494968_2495760_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	27.9	5.8e-09
>prophage 193
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2519516	2520914	5054076		Bordetella_phage(100.0%)	1	NA	NA
WP_001522602.1|2519516_2520914_-	RtcB family protein	NA	A0A291L9X2	Bordetella_phage	32.5	8.8e-37
>prophage 194
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2546928	2550447	5054076		Vibrio_phage(33.33%)	4	NA	NA
WP_001578005.1|2546928_2547648_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	4.1e-22
WP_000951276.1|2547644_2548586_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.9	2.9e-23
WP_000784342.1|2548699_2549080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001109181.1|2549394_2550447_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.1	7.5e-81
>prophage 195
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2554809	2561384	5054076		Tupanvirus(33.33%)	7	NA	NA
WP_001265443.1|2554809_2555826_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
WP_001522634.1|2556088_2557561_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	4.2e-13
WP_001147439.1|2557628_2558417_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|2558545_2558695_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_001522635.1|2558860_2559634_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604037.1|2559633_2560323_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_001522636.1|2560325_2561384_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.1e-20
>prophage 196
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2571575	2572865	5054076		Klosneuvirus(100.0%)	1	NA	NA
WP_001309367.1|2571575_2572865_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
>prophage 197
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2579192	2580101	5054076		Streptococcus_phage(100.0%)	1	NA	NA
WP_001522645.1|2579192_2580101_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	30.7	3.2e-27
>prophage 198
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2591086	2596078	5054076		Anomala_cuprea_entomopoxvirus(50.0%)	4	NA	NA
WP_021551930.1|2591086_2592823_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_128553234.1|2592815_2593811_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001522655.1|2593813_2594485_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_001522656.1|2594713_2596078_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
>prophage 199
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2602157	2606024	5054076		Salmonella_phage(33.33%)	4	NA	NA
WP_000146357.1|2602157_2602424_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_020233042.1|2602497_2603175_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.1e-19
WP_021517034.1|2603216_2605499_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000710619.1|2605763_2606024_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
>prophage 200
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2609564	2614789	5054076		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569080.1|2609564_2610287_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159065.1|2610283_2610943_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|2611081_2611828_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001522673.1|2612231_2612735_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	3.8e-06
WP_001295297.1|2613033_2613921_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|2614155_2614221_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|2614273_2614789_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 201
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2619785	2621381	5054076		Tupanvirus(100.0%)	1	NA	NA
WP_001522676.1|2619785_2621381_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	7.7e-61
>prophage 202
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2628982	2633113	5054076		Citrobacter_phage(50.0%)	3	NA	NA
WP_001522678.1|2628982_2631415_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001522679.1|2631420_2632320_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001522680.1|2632450_2633113_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.6	4.3e-26
>prophage 203
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2636328	2638200	5054076		Planktothrix_phage(100.0%)	1	NA	NA
WP_021523050.1|2636328_2638200_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	30.5	3.6e-17
>prophage 204
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2650489	2651692	5054076		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|2650489_2651692_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 205
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2660257	2669398	5054076		Vibrio_phage(25.0%)	11	NA	NA
WP_001195231.1|2660257_2660515_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_001201580.1|2660674_2660962_+	YbjC family protein	NA	NA	NA	NA	NA
WP_000189134.1|2660945_2661668_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|2661728_2662631_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_001522733.1|2662718_2663195_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126102.1|2663545_2664658_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_001522735.1|2664752_2665886_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_001522736.1|2665895_2666840_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_048237858.1|2666836_2667682_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|2667741_2668230_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001522739.1|2668270_2669398_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	1.8e-27
>prophage 206
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2672523	2673252	5054076		Planktothrix_phage(100.0%)	1	NA	NA
WP_000027208.1|2672523_2673252_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 207
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2676932	2677763	5054076		Roseobacter_phage(100.0%)	1	NA	NA
WP_001255153.1|2676932_2677763_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	4.3e-07
>prophage 208
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2681350	2683069	5054076		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_100190648.1|2681350_2683069_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.4	6.8e-31
>prophage 209
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2692355	2798785	5054076	portal,lysis,holin,capsid,terminase,head,protease,integrase,tail,plate,tRNA	Escherichia_phage(38.71%)	93	2704049:2704066	2750071:2750088
WP_000188187.1|2692355_2694302_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|2694374_2694599_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|2694921_2695242_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|2695272_2697549_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|2698768_2698987_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|2699271_2699976_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001522751.1|2700017_2701739_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.2e-21
WP_001043595.1|2701739_2703506_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_001522752.1|2703628_2704594_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
2704049:2704066	attL	GCGGAAACCGTCACGGCG	NA	NA	NA	NA
WP_000228473.1|2705138_2705633_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_001522753.1|2705767_2709835_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001522754.1|2709993_2710605_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|2710615_2711959_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|2712049_2713342_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850305.1|2713580_2716025_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	5.0e-221
WP_000213098.1|2716035_2716653_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_100190649.1|2716654_2717518_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_001522756.1|2717553_2718180_-	hydrolase	NA	NA	NA	NA	NA
WP_000109288.1|2718494_2719643_+	MFS transporter	NA	NA	NA	NA	NA
WP_000918505.1|2719852_2721283_+	amino acid permease	NA	NA	NA	NA	NA
WP_000067977.1|2721492_2722290_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_000023391.1|2722321_2723317_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.7	7.1e-190
WP_000072552.1|2723410_2723722_-	helix-turn-helix transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	100.0	4.3e-53
WP_000022051.1|2723826_2724183_+	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	100.0	1.1e-63
WP_000217677.1|2724360_2724861_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_000557703.1|2724925_2725150_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277957.1|2725149_2725452_+	hypothetical protein	NA	A0A0F7LDT6	Escherichia_phage	99.0	2.2e-46
WP_023148842.1|2725451_2725676_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	5.0e-35
WP_000027664.1|2725672_2725948_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_023148841.1|2725937_2728226_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.2	0.0e+00
WP_016239054.1|2728834_2729155_+	helix-turn-helix transcriptional regulator	NA	E5E3S9	Burkholderia_phage	38.7	5.9e-13
WP_023148839.1|2729120_2730071_+	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	40.8	4.6e-37
WP_023148838.1|2730179_2731544_-	FRG domain-containing protein	NA	Q9AZ51	Lactococcus_phage	34.1	6.7e-05
WP_048219351.1|2732056_2733091_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	7.1e-201
WP_000156861.1|2733090_2734863_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001085952.1|2735036_2735891_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_023148837.1|2735945_2737019_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.2	7.4e-201
WP_000203438.1|2737022_2737766_+|terminase	terminase endonuclease subunit	terminase	Q94MK6	Enterobacteria_phage	97.6	1.6e-122
WP_033559479.1|2737865_2738375_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	98.8	7.3e-90
WP_000846409.1|2738374_2738578_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123123.1|2738581_2738863_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_023148834.1|2738862_2739360_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.2e-92
WP_000736597.1|2739374_2739800_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	95.0	4.7e-58
WP_032152948.1|2739787_2740213_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	96.5	1.4e-65
WP_001440152.1|2740184_2740358_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_001774102.1|2740320_2740788_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.1	9.7e-81
WP_023148832.1|2740780_2741233_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	99.3	2.4e-76
WP_023148831.1|2741335_2742409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024176299.1|2742495_2743125_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	95.2	1.8e-106
WP_000127163.1|2743121_2743469_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121474.1|2743473_2744382_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
WP_023148828.1|2744374_2744905_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	98.9	3.9e-102
WP_023148827.1|2744915_2746940_+|tail	phage tail fiber repeat-containing domain protein	tail	A0A0A7NV63	Enterobacteria_phage	71.9	6.5e-299
WP_023148826.1|2746941_2747469_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	92.6	8.3e-89
WP_023148825.1|2747759_2748986_+	DUF4263 domain-containing protein	NA	Q858S8	Enterobacteria_phage	99.4	1.1e-181
WP_032152801.1|2749272_2750463_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.1e-224
2750071:2750088	attR	CGCCGTGACGGTTTCCGC	NA	NA	NA	NA
WP_001251408.1|2750475_2750994_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|2751050_2751326_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|2751358_2751478_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_023148822.1|2751470_2753918_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.0	0.0e+00
WP_023140595.1|2753932_2754412_+|tail	phage tail protein	tail	O64315	Escherichia_phage	98.7	2.5e-84
WP_023148821.1|2754411_2755575_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	4.1e-205
WP_000468308.1|2755657_2755876_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001292809.1|2756195_2758478_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
WP_000642546.1|2758532_2759390_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_001328457.1|2759795_2761556_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642852.1|2761685_2762378_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057149.1|2762576_2763665_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_001522761.1|2763735_2765019_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_001313710.1|2765188_2765953_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_001522762.1|2766125_2766809_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000140327.1|2766919_2768593_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000167336.1|2768752_2769037_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_021523053.1|2769243_2771508_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|2771544_2773293_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000570527.1|2773289_2774276_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_001522765.1|2774312_2775545_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000350058.1|2775596_2775779_+	protein YcaR	NA	NA	NA	NA	NA
WP_021523054.1|2775775_2776522_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000436922.1|2776675_2777569_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_001522767.1|2777545_2778325_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_001298300.1|2778460_2779246_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288850.1|2779242_2780565_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001295931.1|2780545_2781250_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_021523055.1|2781249_2785710_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_020232980.1|2785970_2787818_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001295932.1|2787998_2788547_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109449.1|2788573_2789221_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462687.1|2789271_2790462_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000117881.1|2792326_2793727_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001305916.1|2793895_2795098_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193813.1|2795363_2797976_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	9.1e-19
WP_001090506.1|2798017_2798785_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
>prophage 210
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2814705	2816613	5054076		Tupanvirus(100.0%)	1	NA	NA
WP_000053080.1|2814705_2816613_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
>prophage 211
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2829223	2831278	5054076		Bacillus_phage(100.0%)	1	NA	NA
WP_020232990.1|2829223_2831278_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.7e-20
>prophage 212
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2835511	2836171	5054076	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|2835511_2836171_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 213
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2847165	2860856	5054076	transposase	Bacillus_phage(33.33%)	14	NA	NA
WP_000066490.1|2847165_2847378_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|2847388_2847577_+	cold-shock protein	NA	NA	NA	NA	NA
WP_020232998.1|2847551_2847782_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|2847771_2847945_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001522816.1|2847992_2849066_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_071779334.1|2849137_2851882_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.5	9.2e-38
WP_001522818.1|2851964_2852993_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|2852965_2853658_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001522819.1|2853787_2854960_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_020233001.1|2854959_2857506_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.3	1.5e-71
WP_001522821.1|2857502_2858102_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_100190637.1|2858184_2859532_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
WP_000024560.1|2859630_2859936_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420641.1|2859935_2860856_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	2.5e-11
>prophage 214
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2865160	2867260	5054076		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|2865160_2865334_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_021523061.1|2865416_2866745_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.6	6.9e-233
WP_001028095.1|2866765_2867260_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
>prophage 215
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2882148	2883072	5054076		Cronobacter_phage(100.0%)	1	NA	NA
WP_001304747.1|2882148_2883072_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	3.1e-91
>prophage 216
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2889896	2891264	5054076		Bacillus_phage(100.0%)	1	NA	NA
WP_001522838.1|2889896_2891264_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	1.9e-20
>prophage 217
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2894654	2895488	5054076		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|2894654_2895488_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 218
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2899612	2900146	5054076		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|2899612_2900146_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 219
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2909454	2910375	5054076		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|2909454_2910375_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 220
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2915037	2915283	5054076		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|2915037_2915283_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 221
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2931128	2932070	5054076		Brevibacillus_phage(100.0%)	1	NA	NA
WP_048237783.1|2931128_2932070_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	4.7e-10
>prophage 222
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2945243	2946425	5054076		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000007233.1|2945243_2945978_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.7e-15
WP_000103754.1|2946188_2946425_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 223
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2950408	2952051	5054076		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257007.1|2950408_2951050_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	3.4e-28
WP_001267945.1|2951046_2952051_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
>prophage 224
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2964374	2964632	5054076		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|2964374_2964632_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 225
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2971920	2975643	5054076		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033689.1|2971920_2972622_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	39.8	5.4e-35
WP_001251363.1|2972621_2973866_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291248.1|2973894_2974806_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952736.1|2974821_2975643_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
>prophage 226
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	2979084	3044127	5054076	portal,lysis,holin,capsid,terminase,head,integrase,tail,tRNA	Escherichia_phage(36.84%)	81	2972540:2972554	2999680:2999694
2972540:2972554	attL	AACTGGCGAAACGTA	NA	NA	NA	NA
WP_000074983.1|2979084_2980203_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
WP_000003742.1|2980171_2980441_-	excisionase	NA	NA	NA	NA	NA
WP_001542183.1|2980502_2982959_-	exonuclease	NA	V5UQJ3	Shigella_phage	42.6	2.5e-103
WP_001093951.1|2983036_2983240_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450218.1|2983236_2983425_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000935596.1|2983435_2984290_-	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	3.6e-65
WP_000394557.1|2984820_2985195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379564.1|2985206_2985359_-	DUF1391 domain-containing protein	NA	NA	NA	NA	NA
WP_000787428.1|2985565_2985973_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912294.1|2986049_2986277_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705383.1|2986260_2986812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020541.1|2986783_2987824_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	1.0e-90
WP_001403041.1|2987855_2988278_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	89.3	2.8e-71
WP_000450706.1|2988311_2989082_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.4	1.1e-86
WP_001141099.1|2989097_2989490_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_001266130.1|2989486_2989783_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001209475.1|2989779_2990241_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	2.6e-38
WP_000403791.1|2990218_2990575_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	1.1e-57
WP_000137948.1|2990670_2991078_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	60.4	1.0e-22
WP_001229301.1|2991079_2991445_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	99.2	1.9e-68
WP_000208092.1|2991441_2992428_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	41.5	1.8e-44
WP_000813254.1|2992986_2993142_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001309416.1|2993358_2993610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309417.1|2993676_2993955_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.3	6.3e-11
WP_001265256.1|2993956_2995015_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.3	1.8e-90
WP_000140038.1|2995015_2995384_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	2.4e-34
WP_001064909.1|2995376_2996066_+	antiterminator	NA	I6PDF8	Cronobacter_phage	48.1	7.1e-56
WP_001309418.1|2996278_2996476_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	93.8	1.7e-26
WP_000871291.1|2996845_2997181_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_001309419.1|2997426_2997630_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	96.8	2.7e-27
WP_000284506.1|2997937_2998153_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001037014.1|2998157_2999048_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	70.9	2.1e-108
WP_001092866.1|2999084_2999618_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	6.7e-102
WP_001446668.1|2999774_2999957_+	hypothetical protein	NA	NA	NA	NA	NA
2999680:2999694	attR	AACTGGCGAAACGTA	NA	NA	NA	NA
WP_001280932.1|2999971_3000103_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
WP_032142285.1|3000105_3000573_+|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	84.4	6.7e-66
WP_000830178.1|3000883_3001210_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001322427.1|3001332_3001686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235436.1|3002168_3002678_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001309424.1|3002649_3004578_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	1.4e-261
WP_000258993.1|3004561_3004768_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_001322425.1|3004764_3006357_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	4.9e-185
WP_001253888.1|3006346_3007852_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	1.0e-99
WP_000256814.1|3007888_3008236_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	59.1	6.8e-23
WP_000522603.1|3008293_3009322_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.4e-116
WP_000201530.1|3009373_3009748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204533.1|3009740_3010094_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_000975005.1|3010109_3010685_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	56.8	1.6e-48
WP_000683079.1|3010681_3011077_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235111.1|3011084_3011837_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	2.7e-133
WP_000479111.1|3011850_3012282_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	1.8e-41
WP_000533402.1|3012308_3012722_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082417.1|3012702_3015264_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.5	0.0e+00
WP_000847298.1|3015260_3015590_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001328631.1|3015589_3016288_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	3.2e-128
WP_000194723.1|3016298_3017042_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_032300536.1|3016987_3017620_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	4.2e-103
WP_000514726.1|3017963_3021656_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	86.0	0.0e+00
WP_001233148.1|3021723_3022323_+	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
WP_000216486.1|3022474_3025501_+	membrane protein	NA	A0A0K2FIZ6	Escherichia_phage	54.6	1.4e-55
WP_000885577.1|3025500_3026085_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_000240999.1|3026139_3026808_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937481.1|3026864_3027131_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.8	1.5e-17
WP_000799406.1|3027362_3028226_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|3028209_3029346_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_001522887.1|3029595_3030822_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|3030870_3031992_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000735412.1|3032067_3033528_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|3033527_3034199_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|3034368_3035739_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|3035742_3036384_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000004751.1|3036419_3037526_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001522894.1|3037579_3038041_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_000873387.1|3038050_3038689_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000246191.1|3039021_3039357_-	DUF1493 family protein	NA	NA	NA	NA	NA
WP_000381622.1|3039356_3039806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001522898.1|3040388_3041639_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.1	6.5e-23
WP_020232865.1|3041741_3042065_-	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	62.6	6.3e-39
WP_019842521.1|3042607_3042718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001522899.1|3042770_3043175_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332298.1|3043395_3044127_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.5	3.5e-53
>prophage 227
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3049672	3052336	5054076		Escherichia_phage(100.0%)	1	NA	NA
WP_001522908.1|3049672_3052336_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	42.0	2.2e-84
>prophage 228
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3063952	3065640	5054076		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|3063952_3064372_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001522918.1|3064371_3065640_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.2	8.7e-209
>prophage 229
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3083596	3084355	5054076		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_029701750.1|3083596_3084355_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.9	2.0e-14
>prophage 230
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3100223	3102975	5054076		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033363.1|3100223_3101903_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	7.9e-24
WP_001298109.1|3102027_3102975_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 231
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3106111	3110119	5054076		Pseudomonas_phage(50.0%)	5	NA	NA
WP_000804726.1|3106111_3107194_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456570.1|3107193_3108027_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200377.1|3108023_3108416_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|3108419_3109229_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|3109264_3110119_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
>prophage 232
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3113395	3113626	5054076		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_001146444.1|3113395_3113626_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 233
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3124760	3135483	5054076		Escherichia_phage(25.0%)	10	NA	NA
WP_000702660.1|3124760_3126299_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571694.1|3126295_3127006_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|3127005_3127683_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555849.1|3129120_3129963_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001314642.1|3130012_3130471_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|3130583_3131489_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193447.1|3131580_3132594_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|3132795_3133704_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|3133848_3134262_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068076.1|3134865_3135483_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	7.8e-54
>prophage 234
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3143894	3145909	5054076		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110954.1|3143894_3144908_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|3144904_3145909_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 235
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3157573	3160531	5054076		Acinetobacter_phage(100.0%)	2	NA	NA
WP_001523118.1|3157573_3158932_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	1.7e-37
WP_000763524.1|3158935_3160531_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
>prophage 236
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3168992	3174995	5054076	transposase,protease	Chrysochromulina_ericina_virus(33.33%)	5	NA	NA
WP_000559277.1|3168992_3169751_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_001523120.1|3169970_3171020_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000526135.1|3171199_3171658_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_001031530.1|3171766_3172018_-	YciN family protein	NA	NA	NA	NA	NA
WP_001295576.1|3172397_3174995_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
>prophage 237
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3179919	3180510	5054076		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|3179919_3180510_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 238
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3188322	3190257	5054076		Lactococcus_phage(100.0%)	1	NA	NA
WP_000484983.1|3188322_3190257_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
>prophage 239
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3199190	3201210	5054076		Salmonella_phage(50.0%)	2	NA	NA
WP_001523129.1|3199190_3200354_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	27.2	9.6e-29
WP_000573407.1|3200403_3201210_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 240
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3214000	3215266	5054076		Klosneuvirus(100.0%)	1	NA	NA
WP_000069237.1|3214000_3215266_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.8	2.7e-24
>prophage 241
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3230708	3231791	5054076		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057972.1|3230708_3231791_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 242
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3249074	3249590	5054076		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945046.1|3249074_3249590_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 243
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3259405	3312621	5054076	lysis,holin,terminase,integrase,tail,tRNA	Escherichia_phage(53.06%)	61	3250301:3250316	3293285:3293300
3250301:3250316	attL	ATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_100190652.1|3259405_3260353_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	2.4e-17
WP_000387388.1|3261669_3262653_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123748.1|3263130_3264504_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001523172.1|3264632_3265568_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040839.1|3265619_3266855_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_000079604.1|3266856_3267072_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|3267171_3267360_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_001443846.1|3267397_3267547_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_000166313.1|3267602_3268412_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_000105140.1|3268404_3271005_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_001344816.1|3271106_3271382_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_001352098.1|3271456_3271627_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|3271626_3271848_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|3272289_3272778_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|3272774_3272930_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000233809.1|3272940_3273075_-	phage protein	NA	NA	NA	NA	NA
WP_000233319.1|3273362_3273782_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|3273861_3274116_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693803.1|3274112_3274535_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001396581.1|3274612_3275401_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_020233967.1|3275407_3276154_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	1.1e-110
WP_000450716.1|3276176_3276938_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.4	3.4e-115
WP_029702111.1|3276953_3277376_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	7.4e-64
WP_000137958.1|3277537_3278041_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	39.7	4.3e-18
WP_000200358.1|3278161_3278935_-	KilA-N domain-containing protein	NA	A0A1L2BWW1	Bacteriophage	42.6	9.6e-09
WP_001445775.1|3279457_3279583_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	90.2	4.0e-10
WP_001445776.1|3279665_3280007_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000940344.1|3280874_3281474_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	2.9e-106
WP_000228032.1|3281473_3281764_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	7.4e-47
WP_000640106.1|3281760_3282303_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	76.3	5.8e-77
WP_001208722.1|3282524_3283094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001328752.1|3283062_3283365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000781775.1|3283441_3283783_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	90.1	6.2e-53
WP_023153991.1|3283786_3284263_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	5.0e-85
WP_001228696.1|3284479_3284665_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|3284861_3286319_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001291105.1|3286456_3287248_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_020233805.1|3287240_3288173_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.1e-83
WP_000126788.1|3288150_3288360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000089448.1|3288363_3289458_+	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	80.5	4.5e-113
WP_000625348.1|3289438_3290740_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_000763701.1|3290742_3292149_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	3.0e-186
WP_001363932.1|3292132_3293245_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	7.1e-114
WP_029702112.1|3293349_3294114_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	9.0e-84
3293285:3293300	attR	TTTTTATTGCTGCGAT	NA	NA	NA	NA
WP_020233804.1|3294212_3295352_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	9.7e-159
WP_000634214.1|3295574_3295970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000524260.1|3295969_3296353_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_001029815.1|3296353_3296734_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_000673077.1|3296730_3297123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001328756.1|3297149_3298112_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	38.6	8.4e-55
WP_122452218.1|3298262_3298622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032139919.1|3298729_3298930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023153989.1|3299093_3302327_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.0	7.4e-103
WP_000024051.1|3302319_3302658_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_001152432.1|3302657_3303356_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
WP_001351716.1|3303361_3304105_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	1.0e-145
WP_021523093.1|3304703_3308183_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_001542091.1|3308250_3308850_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	9.8e-102
WP_042099016.1|3308914_3311290_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.0	1.8e-167
WP_000654155.1|3311289_3311571_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	1.4e-18
WP_001314683.1|3311580_3312621_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.9	2.9e-125
>prophage 244
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3316477	3320512	5054076		Planktothrix_phage(33.33%)	4	NA	NA
WP_000983718.1|3316477_3317305_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	G9BWD6	Planktothrix_phage	28.5	3.8e-11
WP_000286865.1|3317304_3318219_-	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_001295593.1|3318803_3319238_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837924.1|3319378_3320512_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
>prophage 245
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3325472	3326462	5054076		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|3325472_3326462_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 246
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3345352	3349255	5054076		Klosneuvirus(100.0%)	1	NA	NA
WP_021517100.1|3345352_3349255_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 247
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3354594	3355543	5054076		Escherichia_phage(50.0%)	2	NA	NA
WP_001390056.1|3354594_3355125_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	43.9	2.0e-18
WP_000731851.1|3355369_3355543_+	hypothetical protein	NA	A0A0R6PI25	Moraxella_phage	59.6	4.4e-07
>prophage 248
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3369435	3376485	5054076		Phage_TP(25.0%)	7	NA	NA
WP_024166512.1|3369435_3371397_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	27.9	1.6e-23
WP_000494241.1|3371488_3371719_-	YncJ family protein	NA	NA	NA	NA	NA
WP_001306887.1|3371940_3372117_+	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	2.1e-12
WP_001270286.1|3372162_3372579_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_001523229.1|3372657_3374064_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_020233879.1|3374308_3375454_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001523231.1|3375471_3376485_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
>prophage 249
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3383618	3385721	5054076		Salmonella_phage(100.0%)	1	NA	NA
WP_001523241.1|3383618_3385721_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	66.2	9.6e-136
>prophage 250
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3390616	3401471	5054076		Ralstonia_phage(25.0%)	5	NA	NA
WP_001523247.1|3390616_3392725_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.6	5.3e-25
WP_021523076.1|3392791_3397021_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.9	4.9e-22
WP_021523077.1|3397021_3397420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020233927.1|3398350_3399400_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	38.0	3.1e-18
WP_001523249.1|3399494_3401471_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	44.1	1.5e-159
>prophage 251
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3406059	3407604	5054076		Escherichia_phage(100.0%)	1	NA	NA
WP_001523255.1|3406059_3407604_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 252
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3422091	3423532	5054076		Escherichia_phage(50.0%)	2	NA	NA
WP_000781370.1|3422091_3422376_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000642407.1|3422521_3423532_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
>prophage 253
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3426805	3428711	5054076		Planktothrix_phage(100.0%)	2	NA	NA
WP_001523264.1|3426805_3427732_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.2	5.9e-13
WP_001523266.1|3427724_3428711_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	3.8e-18
>prophage 254
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3433027	3436834	5054076		Klosneuvirus(50.0%)	2	NA	NA
WP_001523271.1|3433027_3435427_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.2e-09
WP_000426279.1|3435451_3436834_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 255
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3442113	3449049	5054076		Powai_lake_megavirus(50.0%)	2	NA	NA
WP_023153758.1|3442113_3444909_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.8	1.7e-18
WP_001523278.1|3447363_3449049_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.8	2.2e-10
>prophage 256
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3471739	3475837	5054076		Lactococcus_phage(50.0%)	4	NA	NA
WP_001551127.1|3471739_3473092_+	SIR2 family protein	NA	Q38324	Lactococcus_phage	30.6	5.6e-20
WP_021523084.1|3473291_3473987_-	protein hipA	NA	NA	NA	NA	NA
WP_001296726.1|3473986_3474253_-	type II toxin-antitoxin system antitoxin HipB	NA	NA	NA	NA	NA
WP_032142974.1|3474436_3475837_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.8	5.6e-108
>prophage 257
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3489315	3490734	5054076		Bacillus_phage(100.0%)	1	NA	NA
WP_021523089.1|3489315_3490734_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.7	6.5e-19
>prophage 258
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3498481	3500611	5054076		Streptococcus_phage(50.0%)	3	NA	NA
WP_000091199.1|3498481_3498865_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803518.1|3498896_3499115_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_001523317.1|3499171_3500611_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	3.7e-30
>prophage 259
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3508115	3509006	5054076		Bacillus_phage(100.0%)	1	NA	NA
WP_001523326.1|3508115_3509006_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.0	1.1e-19
>prophage 260
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3513898	3582039	5054076	portal,lysis,transposase,capsid,terminase,head,integrase,tail	Enterobacteria_phage(38.98%)	87	3544991:3545006	3582110:3582125
WP_000214712.1|3513898_3514102_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527786.1|3514137_3515598_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.7	5.1e-43
WP_029701979.1|3515686_3516970_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|3517573_3517687_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|3517755_3517989_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|3518305_3518896_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000355609.1|3519123_3519417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235967.1|3519427_3520132_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
WP_000654154.1|3520141_3520423_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.2e-17
WP_032152843.1|3520419_3522819_-|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	55.3	3.9e-133
WP_001542091.1|3522883_3523483_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	9.8e-102
WP_021523093.1|3523550_3527030_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_049286672.1|3527090_3527693_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	8.1e-88
WP_032153655.1|3527629_3528373_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	9.5e-147
WP_001551186.1|3528378_3529077_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	8.9e-131
WP_000847345.1|3529076_3529406_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_032153656.1|3529402_3531964_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	95.9	0.0e+00
WP_000459457.1|3531956_3532391_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479153.1|3532372_3532795_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001349920.1|3532810_3533551_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000683128.1|3533558_3533954_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_000975070.1|3533950_3534529_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000752979.1|3534540_3534894_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_020233914.1|3534905_3535304_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	2.3e-62
WP_000063277.1|3535345_3536371_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.7	2.7e-192
WP_001708751.1|3536425_3536758_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_020233915.1|3536767_3538087_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	2.2e-231
WP_001356819.1|3538067_3539669_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
WP_000198149.1|3539665_3539872_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027269.1|3539868_3541794_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000453587.1|3541768_3542314_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001368374.1|3542702_3542936_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|3542993_3543404_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|3543555_3543729_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|3543900_3544056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|3544135_3544201_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|3544203_3544392_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|3544402_3544615_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|3544977_3545475_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
3544991:3545006	attL	TTTTTATCTCTTAAAG	NA	NA	NA	NA
WP_001092971.1|3545471_3546005_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|3546001_3546313_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|3546317_3546533_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000526135.1|3547089_3547548_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_000066484.1|3547998_3548214_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|3548514_3548727_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|3548781_3548871_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|3549148_3549901_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265199.1|3549914_3550964_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
WP_012304870.1|3550965_3551244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|3551310_3551562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|3551778_3551934_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|3552005_3552293_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|3552292_3552532_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|3552556_3552862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|3553064_3553397_+	protein FlxA	NA	NA	NA	NA	NA
WP_000589005.1|3553833_3555147_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001345551.1|3555630_3556659_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_001265627.1|3556655_3557270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021523102.1|3557478_3558144_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001151242.1|3558346_3558745_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.9	7.7e-63
WP_000054487.1|3558785_3559751_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_000705355.1|3559731_3560253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000921596.1|3560236_3560464_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000381212.1|3560544_3560952_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000379575.1|3561120_3561276_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000344950.1|3561277_3561853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|3562339_3562528_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083276.1|3562524_3562716_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048363.1|3562809_3565281_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	1.2e-57
WP_001296941.1|3565368_3565605_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001339397.1|3565675_3566353_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|3566352_3566700_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_029392005.1|3566719_3568291_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
WP_021523105.1|3568346_3569627_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	3.9e-156
WP_001389342.1|3569628_3569757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836037.1|3569814_3570834_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|3570845_3572060_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_001314753.1|3572265_3572592_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.2e-23
WP_000705205.1|3572726_3573068_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|3573102_3573663_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001445899.1|3573665_3574376_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|3574483_3574789_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001551145.1|3574987_3577414_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
WP_072170800.1|3577474_3579898_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.5	3.7e-208
WP_001520568.1|3579908_3580526_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.1	2.5e-76
WP_020233477.1|3580527_3581382_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_001520571.1|3581424_3582039_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.8	4.3e-28
3582110:3582125	attR	TTTTTATCTCTTAAAG	NA	NA	NA	NA
>prophage 261
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3599800	3601102	5054076		Bacillus_phage(100.0%)	1	NA	NA
WP_001520578.1|3599800_3601102_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.6	4.2e-17
>prophage 262
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3610999	3612811	5054076		Vaccinia_virus(100.0%)	1	NA	NA
WP_001520590.1|3610999_3612811_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.5	0.0e+00
>prophage 263
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3632716	3633991	5054076	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|3632716_3633991_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 264
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3640906	3642405	5054076		Salmonella_phage(50.0%)	2	NA	NA
WP_001296937.1|3640906_3641428_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
WP_000250656.1|3641508_3642405_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
>prophage 265
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3651208	3660012	5054076		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101181.1|3651208_3652036_+	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|3652163_3652745_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_001520605.1|3652890_3654060_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|3654225_3654315_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|3654613_3655639_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000269493.1|3655635_3656568_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182362.1|3656680_3657892_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_100190653.1|3658182_3659331_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.2	6.1e-84
WP_000493947.1|3659370_3660012_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 266
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3665518	3667785	5054076		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587571.1|3665518_3666331_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	6.5e-08
WP_020233101.1|3666334_3667120_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001309532.1|3667116_3667785_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.8	4.5e-23
>prophage 267
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3676075	3681159	5054076		environmental_halophage(33.33%)	5	NA	NA
WP_001520612.1|3676075_3677296_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
WP_001520613.1|3677292_3678564_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948865.1|3678538_3679285_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	3.8e-10
WP_001314771.1|3679294_3680782_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367171.1|3680790_3681159_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	5.6e-15
>prophage 268
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3699750	3719200	5054076	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_023144643.1|3699750_3701451_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	2.1e-32
WP_000069375.1|3701507_3703886_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000368046.1|3704218_3705052_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001520625.1|3705208_3706255_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.4	1.2e-83
WP_001270810.1|3706386_3706578_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_029701352.1|3706581_3708018_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001520627.1|3708080_3708794_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209784.1|3709040_3709505_-	endopeptidase	NA	A0A217EQL1	Bacillus_phage	35.3	8.6e-13
WP_000029466.1|3709582_3710332_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154187.1|3710331_3710883_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_001520628.1|3710945_3711926_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|3712026_3712326_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672359.1|3712330_3714718_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018588.1|3714732_3715716_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|3715854_3715899_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
WP_000124850.1|3716021_3716378_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|3716431_3716629_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|3716725_3717268_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|3717271_3719200_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
>prophage 269
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3730488	3732750	5054076		Tupanvirus(100.0%)	1	NA	NA
WP_001520636.1|3730488_3732750_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.8e-143
>prophage 270
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3738877	3739705	5054076		Bacillus_virus(100.0%)	1	NA	NA
WP_000175037.1|3738877_3739705_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 271
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3747180	3748401	5054076		Klosneuvirus(100.0%)	1	NA	NA
WP_000082004.1|3747180_3748401_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.3	2.5e-27
>prophage 272
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3755165	3755819	5054076		Planktothrix_phage(100.0%)	1	NA	NA
WP_001520652.1|3755165_3755819_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.7	4.4e-15
>prophage 273
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3760208	3762164	5054076		Streptococcus_phage(100.0%)	1	NA	NA
WP_021523123.1|3760208_3762164_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	2.4e-40
>prophage 274
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3767089	3771175	5054076		Tupanvirus(50.0%)	4	NA	NA
WP_001135079.1|3767089_3767731_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	35.4	3.8e-19
WP_000438819.1|3767823_3769182_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719088.1|3769299_3770058_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000723698.1|3770194_3771175_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	1.0e-07
>prophage 275
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3779988	3780843	5054076		Indivirus(100.0%)	1	NA	NA
WP_001520673.1|3779988_3780843_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.1e-10
>prophage 276
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3784162	3788739	5054076		Bacillus_phage(100.0%)	3	NA	NA
WP_000219686.1|3784162_3785446_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000621404.1|3785592_3787068_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000766137.1|3787248_3788739_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 277
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3803485	3811590	5054076	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|3803485_3805171_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_001520692.1|3805375_3805957_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220972.1|3805995_3806691_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|3806748_3808659_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_014639208.1|3808790_3809135_+	RidA family protein	NA	NA	NA	NA	NA
WP_001322969.1|3809496_3809856_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|3809975_3810155_-	YoaH family protein	NA	NA	NA	NA	NA
WP_001520695.1|3810228_3811590_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.7	1.8e-42
>prophage 278
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3815452	3817009	5054076		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|3815452_3817009_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 279
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3822649	3822859	5054076		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|3822649_3822859_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 280
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3828191	3830240	5054076		Moraxella_phage(100.0%)	1	NA	NA
WP_001055785.1|3828191_3830240_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 281
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3837736	3842202	5054076		Escherichia_phage(33.33%)	7	NA	NA
WP_001520704.1|3837736_3838393_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	2.8e-57
WP_001520705.1|3838784_3839126_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879330.1|3839138_3840011_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204705.1|3840014_3840389_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|3840527_3840758_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011653.1|3840859_3841516_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|3841539_3842202_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 282
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3850257	3851733	5054076		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|3850257_3851733_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 283
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3855731	3862798	5054076		Bacillus_virus(50.0%)	9	NA	NA
WP_001184045.1|3855731_3857054_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_011076428.1|3857069_3858002_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202987.1|3858080_3858836_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001520716.1|3858832_3859618_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568522.1|3859767_3860778_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|3860786_3861398_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072146566.1|3861536_3861602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001520719.1|3861672_3862275_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|3862276_3862798_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 284
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3866816	3868867	5054076		Escherichia_coli_phage(50.0%)	3	NA	NA
WP_001563891.1|3866816_3867635_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	96.9	4.6e-70
WP_000252980.1|3867687_3868083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019591.1|3868123_3868867_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
>prophage 285
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3875351	3877085	5054076	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025322.1|3875351_3877085_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
>prophage 286
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3881605	3887249	5054076		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_000763867.1|3881605_3881995_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036371.1|3882009_3883059_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204344.1|3883061_3883922_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483203.1|3883940_3885542_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.3	1.6e-13
WP_001306742.1|3885587_3887249_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
>prophage 287
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3897337	3898852	5054076		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001187819.1|3897337_3898852_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 288
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3910831	3911584	5054076		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|3910831_3911584_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 289
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3923589	3924845	5054076	transposase	uncultured_Caudovirales_phage(33.33%)	3	NA	NA
WP_000334576.1|3923589_3924087_+	hypothetical protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	65.2	5.9e-52
WP_001336494.1|3923968_3924298_-	helix-turn-helix domain-containing protein	NA	A0A1B0VCD8	Salmonella_phage	86.6	8.1e-42
WP_001347174.1|3924320_3924845_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.0	2.2e-33
>prophage 290
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3940828	3951028	5054076		Bacillus_phage(40.0%)	8	NA	NA
WP_020233536.1|3940828_3942523_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|3942760_3942943_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922682.1|3943021_3943939_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212225.1|3944111_3945032_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000228683.1|3945020_3945491_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	49.0	1.8e-34
WP_001157256.1|3945471_3946890_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	4.0e-101
WP_000826783.1|3948998_3950357_-	heavy metal sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	19.4	5.1e-05
WP_001339045.1|3950356_3951028_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
>prophage 291
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	3959931	3980526	5054076		Bacillus_phage(50.0%)	5	NA	NA
WP_001334858.1|3959931_3961734_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
WP_000098398.1|3961720_3963523_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.6	1.4e-31
WP_000970688.1|3963689_3964649_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_000623056.1|3964839_3970947_+	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	4.0e-33
WP_000369516.1|3971034_3980526_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
>prophage 292
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4016658	4018460	5054076	transposase	Escherichia_phage(100.0%)	2	NA	NA
WP_001300609.1|4016658_4017441_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	2.0e-139
WP_000255926.1|4017437_4018460_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	7.0e-201
>prophage 293
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4028238	4030397	5054076		Yersinia_phage(33.33%)	4	NA	NA
WP_021523139.1|4028238_4029060_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	8.0e-46
WP_001703514.1|4029141_4029621_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	6.8e-13
WP_001186773.1|4029636_4030113_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|4030175_4030397_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 294
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4034738	4035905	5054076		Stx2-converting_phage(100.0%)	1	NA	NA
WP_021523140.1|4034738_4035905_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.0	4.2e-226
>prophage 295
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4043549	4044449	5054076		Cellulophaga_phage(100.0%)	1	NA	NA
WP_021523143.1|4043549_4044449_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 296
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4051803	4059212	5054076	transposase	Paramecium_bursaria_Chlorella_virus(25.0%)	7	NA	NA
WP_021523146.1|4051803_4052970_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.4	1.3e-110
WP_000526135.1|4053272_4053731_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_021523147.1|4053930_4055337_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	4.7e-38
WP_021523148.1|4055431_4056451_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	49.5	1.5e-89
WP_032142977.1|4056489_4057200_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_021523150.1|4057230_4058283_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_021523151.1|4058279_4059212_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	37.3	2.4e-14
>prophage 297
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4062598	4070116	5054076		Escherichia_phage(42.86%)	7	NA	NA
WP_021523155.1|4062598_4063147_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	4.4e-48
WP_021523156.1|4063151_4064030_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	64.5	1.9e-106
WP_021523157.1|4064087_4064987_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.1	1.7e-28
WP_001515524.1|4064986_4066072_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.3e-101
WP_021523158.1|4066443_4067337_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_021523159.1|4067568_4068564_-	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.0	2.5e-09
WP_021523160.1|4068721_4070116_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	9.8e-20
>prophage 298
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4075908	4082702	5054076		Bacillus_phage(25.0%)	6	NA	NA
WP_021523164.1|4075908_4077279_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	1.7e-32
WP_000079285.1|4077471_4078908_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.3e-46
WP_021523165.1|4078910_4080134_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_024166508.1|4080130_4080610_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_021523167.1|4080609_4081578_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.5	3.8e-87
WP_000048190.1|4081580_4082702_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 299
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4086945	4097336	5054076		uncultured_marine_virus(20.0%)	8	NA	NA
WP_000654503.1|4086945_4087785_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
WP_021523170.1|4087877_4090040_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482901.1|4090042_4090486_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|4090491_4091631_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_021523171.1|4092289_4093873_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_021523172.1|4094146_4096000_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234777.1|4096021_4096603_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.8e-31
WP_001295424.1|4096694_4097336_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 300
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4101999	4103352	5054076		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001520814.1|4101999_4103352_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	7.1e-07
>prophage 301
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4117521	4181897	5054076	portal,lysis,holin,capsid,terminase,head,integrase,tail,plate,tRNA	Escherichia_phage(40.0%)	71	4121810:4121836	4154689:4154715
WP_000675148.1|4117521_4118925_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	2.7e-33
WP_000137877.1|4118921_4119644_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|4119823_4120156_+	YegP family protein	NA	NA	NA	NA	NA
WP_001520824.1|4120303_4121665_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.2	1.6e-216
4121810:4121836	attL	AATCTCCCTTACACGGGCTTATTTTTT	NA	NA	NA	NA
WP_000468308.1|4121937_4122156_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882966.1|4122237_4123401_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	1.8e-205
WP_001565024.1|4123400_4123880_-|tail	phage tail protein	tail	O64315	Escherichia_phage	98.1	9.6e-84
WP_021523174.1|4123894_4126342_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.7	0.0e+00
WP_000785970.1|4126334_4126454_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_020233494.1|4126486_4126762_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001251412.1|4126818_4127337_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	3.2e-93
WP_020233495.1|4127349_4128540_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	9.0e-224
WP_032142943.1|4128869_4129463_-	hypothetical protein	NA	Q858S7	Enterobacteria_phage	99.0	1.0e-106
WP_021523177.1|4129684_4130212_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	92.6	4.9e-89
WP_021523178.1|4130213_4132235_-|tail	tail fiber protein	tail	A0A0A7NV63	Enterobacteria_phage	64.5	2.7e-260
WP_001285325.1|4132245_4132776_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_001121453.1|4132768_4133677_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	4.4e-162
WP_000127164.1|4133681_4134029_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_020233499.1|4134025_4134661_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.5	1.2e-113
WP_100190656.1|4134744_4135530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001001802.1|4135601_4136054_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.0	1.5e-75
WP_000917186.1|4136046_4136514_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	2.5e-81
WP_072174950.1|4136476_4136650_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	91.2	9.8e-23
WP_001512906.1|4136621_4137047_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	98.6	1.9e-67
WP_000736608.1|4137034_4137460_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	95.7	2.3e-57
WP_001144101.1|4137474_4137972_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|4137971_4138253_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846399.1|4138256_4138460_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988636.1|4138459_4138969_-|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	100.0	8.6e-91
WP_064503035.1|4139068_4139812_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LDU4	Escherichia_phage	99.6	1.0e-124
WP_020233501.1|4139815_4140889_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.2	2.5e-201
WP_020233502.1|4140947_4141802_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	98.2	8.1e-134
WP_000156847.1|4141975_4143748_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	100.0	0.0e+00
WP_001533791.1|4143747_4144782_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	2.7e-200
WP_029401227.1|4145168_4146593_+	histidine kinase	NA	NA	NA	NA	NA
WP_029401228.1|4146589_4147582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029401229.1|4147532_4148684_-	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	31.2	1.4e-32
WP_029701698.1|4151019_4151295_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	1.5e-44
WP_029701699.1|4151291_4151516_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	98.6	3.8e-35
WP_001754915.1|4151515_4151818_-	hypothetical protein	NA	A0A0F7LCL4	Escherichia_phage	100.0	3.5e-47
WP_000557703.1|4151817_4152042_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_029701701.1|4152105_4152606_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	98.8	1.9e-90
WP_029701703.1|4152783_4153059_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	98.9	2.2e-48
WP_000020919.1|4153180_4153480_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_000985261.1|4153595_4154609_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
WP_001303579.1|4154885_4155203_-	hypothetical protein	NA	NA	NA	NA	NA
4154689:4154715	attR	AATCTCCCTTACACGGGCTTATTTTTT	NA	NA	NA	NA
WP_100190657.1|4155617_4156517_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	6.3e-12
WP_000178552.1|4156598_4157378_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_001520826.1|4157477_4158518_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490663.1|4158565_4159921_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000823282.1|4159924_4160209_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182900.1|4160239_4160692_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_001308759.1|4161987_4162842_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|4163071_4164124_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858471.1|4164380_4165658_+	MFS transporter	NA	NA	NA	NA	NA
WP_001520828.1|4165654_4166659_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.7	4.4e-14
WP_001520829.1|4166655_4167621_+	kinase	NA	NA	NA	NA	NA
WP_000434044.1|4167594_4168341_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020233504.1|4168392_4169211_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.1e-23
WP_000822277.1|4169275_4170076_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195594.1|4170072_4170861_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|4171083_4171356_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134572.1|4171476_4172301_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153067.1|4172519_4172858_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000702203.1|4172939_4173974_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_001520833.1|4173989_4176470_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677340.1|4176485_4177160_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830468.1|4177240_4177783_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001328276.1|4178078_4178360_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|4178622_4179732_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001520834.1|4179863_4181897_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.3	2.3e-54
>prophage 302
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4193336	4202779	5054076		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001520842.1|4193336_4194473_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	2.5e-162
WP_021523183.1|4194469_4196470_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001295429.1|4196594_4197056_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|4197097_4197568_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|4197614_4198334_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001309587.1|4198330_4200016_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
WP_001240398.1|4200237_4200969_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001216963.1|4201028_4201136_+	protein YohO	NA	NA	NA	NA	NA
WP_000783145.1|4201116_4201848_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569374.1|4201852_4202779_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 303
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4223033	4224554	5054076		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255032.1|4223033_4224554_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 304
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4228248	4232021	5054076		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|4228248_4228917_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_021517208.1|4229174_4230011_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001578658.1|4230041_4232021_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	1.9e-13
>prophage 305
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4236089	4236947	5054076		Catovirus(100.0%)	1	NA	NA
WP_000873880.1|4236089_4236947_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	35.0	3.1e-24
>prophage 306
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4251441	4255742	5054076		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_001520864.1|4251441_4252908_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.8	1.1e-42
WP_001520865.1|4253025_4254012_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_001297918.1|4254050_4254764_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|4255175_4255742_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 307
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4261496	4269145	5054076		Vibrio_phage(50.0%)	7	NA	NA
WP_000194914.1|4261496_4263086_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
WP_000202798.1|4263089_4263434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001595981.1|4263766_4264957_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	3.8e-20
WP_001234850.1|4264984_4265680_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578079.1|4265829_4267590_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_000494186.1|4267714_4267999_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_020233566.1|4268137_4269145_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	2.0e-83
>prophage 308
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4280842	4281460	5054076		Bacillus_virus(100.0%)	1	NA	NA
WP_001328413.1|4280842_4281460_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 309
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4290226	4293660	5054076		Bacillus_phage(33.33%)	3	NA	NA
WP_000422190.1|4290226_4291870_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.6	2.8e-13
WP_000884972.1|4291945_4292596_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000786358.1|4292595_4293660_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
>prophage 310
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4300158	4305001	5054076		Hokovirus(50.0%)	2	NA	NA
WP_001520877.1|4300158_4303008_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.9	4.9e-42
WP_000559127.1|4303174_4305001_+	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	27.3	4.4e-20
>prophage 311
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4319924	4331751	5054076		Pseudomonas_phage(40.0%)	6	NA	NA
WP_029701249.1|4319924_4322552_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.3	4.2e-88
WP_000990765.1|4322698_4323421_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_021517215.1|4323481_4327240_-	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	26.7	7.7e-19
WP_001075170.1|4327935_4330221_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_000332037.1|4330366_4331497_+	ribonucleoside-diphosphate reductase 1 subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
WP_021523189.1|4331496_4331751_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	63.1	1.5e-24
>prophage 312
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4334797	4335874	5054076		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000779071.1|4334797_4335874_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.9e-08
>prophage 313
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4341766	4346324	5054076	transposase	Sodalis_phage(50.0%)	4	NA	NA
WP_000140566.1|4341766_4342726_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.1e-69
WP_000992991.1|4342952_4343756_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_001328560.1|4343772_4345062_-	MFS transporter	NA	NA	NA	NA	NA
WP_021523190.1|4345118_4346324_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.2e-26
>prophage 314
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4349926	4354930	5054076		Tupanvirus(50.0%)	4	NA	NA
WP_001306469.1|4349926_4350529_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	4.4e-09
WP_024166496.1|4350836_4351976_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	30.1	2.2e-30
WP_000461642.1|4351979_4352948_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	4.0e-36
WP_001551384.1|4352947_4354930_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.1e-19
>prophage 315
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4389738	4392966	5054076		Salmonella_phage(50.0%)	3	NA	NA
WP_000813860.1|4389738_4390338_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012889.1|4390396_4392229_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203403.1|4392315_4392966_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.5	2.8e-09
>prophage 316
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4403529	4405402	5054076	transposase	Sodalis_phage(50.0%)	2	NA	NA
WP_001520932.1|4403529_4404432_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	44.2	2.4e-67
WP_001293612.1|4404628_4405402_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 317
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4409613	4411131	5054076		Mollivirus(100.0%)	1	NA	NA
WP_000334221.1|4409613_4411131_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
>prophage 318
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4417595	4418732	5054076		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699144.1|4417595_4418732_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	2.0e-23
>prophage 319
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4427214	4428300	5054076		Pandoravirus(100.0%)	1	NA	NA
WP_001297933.1|4427214_4428300_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
>prophage 320
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4446323	4449953	5054076		Enterobacteria_phage(50.0%)	3	NA	NA
WP_000368131.1|4446323_4447256_+	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_001706457.1|4448858_4449605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000749077.1|4449761_4449953_+	AlpA family transcriptional regulator	NA	E5E3Y1	Burkholderia_phage	49.0	4.2e-06
>prophage 321
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4456930	4457557	5054076		Clostridium_phage(100.0%)	1	NA	NA
WP_001102877.1|4456930_4457557_+	recombinase family protein	NA	A0A0A8WJD4	Clostridium_phage	28.7	1.0e-08
>prophage 322
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4460602	4462036	5054076		Bacillus_phage(100.0%)	1	NA	NA
WP_001520960.1|4460602_4462036_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.0	4.1e-29
>prophage 323
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4468689	4476265	5054076		Bacillus_phage(50.0%)	4	NA	NA
WP_021523193.1|4468689_4472283_+	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	6.2e-10
WP_020233686.1|4472338_4473484_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|4473557_4474502_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283480.1|4474570_4476265_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.8	8.0e-24
>prophage 324
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4479955	4480876	5054076		Morganella_phage(100.0%)	1	NA	NA
WP_000484013.1|4479955_4480876_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	6.4e-76
>prophage 325
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4484694	4485429	5054076		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|4484694_4485429_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 326
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4512813	4528195	5054076		Streptococcus_phage(33.33%)	15	NA	NA
WP_001520978.1|4512813_4514829_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	3.8e-150
WP_001520979.1|4514899_4515898_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254839.1|4516127_4516889_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|4517073_4518045_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|4518428_4518686_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623136.1|4518730_4520458_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522247.1|4520498_4521008_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096660.1|4521049_4521901_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_001520980.1|4522005_4522374_+	YfeK family protein	NA	NA	NA	NA	NA
WP_001306253.1|4522376_4523288_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.3	2.9e-57
WP_000021036.1|4523421_4524519_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_000852686.1|4524508_4525384_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458420.1|4525383_4526217_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290240.1|4526216_4527233_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000517443.1|4527403_4528195_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	6.8e-18
>prophage 327
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4531673	4537319	5054076	transposase	Mycobacterium_phage(33.33%)	7	NA	NA
WP_020233887.1|4531673_4532975_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
WP_000526135.1|4533085_4533544_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_000084590.1|4533743_4534643_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_001520984.1|4534738_4535314_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001296281.1|4535374_4535824_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|4535810_4536236_-	acetyltransferase YpeA	NA	NA	NA	NA	NA
WP_021523195.1|4536449_4537319_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
>prophage 328
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4555926	4556877	5054076		Cyanophage(100.0%)	1	NA	NA
WP_001003734.1|4555926_4556877_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 329
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4574144	4574858	5054076		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|4574144_4574858_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 330
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4596125	4600127	5054076		Enterobacteria_phage(33.33%)	4	NA	NA
WP_001309646.1|4596125_4597415_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.1	6.6e-63
WP_001295473.1|4597500_4598127_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295474.1|4598451_4599489_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_020233339.1|4599488_4600127_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.3	1.2e-28
>prophage 331
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4606561	4608119	5054076		Escherichia_phage(100.0%)	3	NA	NA
WP_001344399.1|4606561_4606735_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
WP_000669412.1|4607048_4607564_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_001521044.1|4607579_4608119_+	hypothetical protein	NA	G9L6F0	Escherichia_phage	96.6	1.6e-42
>prophage 332
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4620876	4627044	5054076	integrase	Escherichia_phage(33.33%)	4	4619180:4619194	4622320:4622334
4619180:4619194	attL	GAAAAAAGCCCGCAA	NA	NA	NA	NA
WP_001297323.1|4620876_4622085_-|integrase	site-specific integrase	integrase	G9L697	Escherichia_phage	53.7	5.5e-120
WP_000138282.1|4622393_4623971_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
4622320:4622334	attR	GAAAAAAGCCCGCAA	NA	NA	NA	NA
WP_001296289.1|4624039_4625506_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
WP_021551967.1|4625667_4627044_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	5.3e-42
>prophage 333
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4647512	4647944	5054076		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|4647512_4647944_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 334
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4658070	4664408	5054076		Mycoplasma_phage(20.0%)	8	NA	NA
WP_001521059.1|4658070_4659354_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	1.7e-34
WP_000523616.1|4659412_4659613_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124471.1|4659624_4659960_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196617.1|4659961_4661812_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_001357290.1|4661828_4662344_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|4662439_4662763_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|4662779_4663166_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|4663193_4664408_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 335
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4679544	4681056	5054076		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001521073.1|4679544_4681056_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
>prophage 336
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4686814	4698104	5054076		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|4686814_4688068_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_001521077.1|4688396_4689587_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|4689631_4689970_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001298983.1|4690030_4691365_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001590522.1|4691354_4692068_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001309666.1|4692232_4693660_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	2.3e-16
WP_021523225.1|4694216_4698104_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	1.0e-130
>prophage 337
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4702223	4702484	5054076		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196285.1|4702223_4702484_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	8.4e-18
>prophage 338
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4705943	4709686	5054076		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|4705943_4706624_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|4706896_4707871_-	signal peptidase I	NA	NA	NA	NA	NA
WP_001521085.1|4707886_4709686_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 339
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4715457	4721546	5054076	tRNA	Cafeteria_roenbergensis_virus(25.0%)	7	NA	NA
WP_000219193.1|4715457_4716792_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001521087.1|4716824_4717706_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001521088.1|4717808_4718396_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|4718457_4718841_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262721.1|4719145_4719835_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	9.3e-56
WP_001521090.1|4719882_4720920_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|4721126_4721546_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 340
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4726839	4729795	5054076	transposase	Burkholderia_virus(50.0%)	2	NA	NA
WP_000841103.1|4726839_4728138_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_100190661.1|4728446_4729795_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.1	5.1e-74
>prophage 341
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4735375	4737949	5054076		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|4735375_4737949_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 342
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4743855	4744926	5054076		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168045.1|4743855_4744926_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 343
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4758672	4759155	5054076		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001520337.1|4758672_4759155_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	5.2e-29
>prophage 344
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4774586	4778638	5054076		Klosneuvirus(50.0%)	4	NA	NA
WP_000097652.1|4774586_4775867_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.9	2.1e-32
WP_001295173.1|4776104_4777505_+	GABA permease	NA	NA	NA	NA	NA
WP_000156814.1|4777525_4778188_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522417.1|4778188_4778638_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.6e-06
>prophage 345
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4782572	4787870	5054076		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|4782572_4782818_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_001521113.1|4782814_4783216_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	3.4e-18
WP_020233016.1|4783197_4785342_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	2.2e-196
WP_001521117.1|4785351_4786311_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	7.0e-134
WP_000985494.1|4786667_4787870_+	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 346
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4800915	4806302	5054076	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|4800915_4801101_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047170.1|4801335_4803966_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140506.1|4804094_4804595_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|4804663_4805725_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132231.1|4805804_4806302_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 347
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4811769	4812735	5054076		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287415.1|4811769_4812735_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 348
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4820148	4821162	5054076		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001521133.1|4820148_4821162_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	1.3e-26
>prophage 349
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4840267	4847407	5054076		Escherichia_phage(83.33%)	6	NA	NA
WP_001272917.1|4840267_4842829_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	9.2e-32
WP_001141345.1|4842934_4843591_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
WP_001295181.1|4843641_4844409_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_000847993.1|4844604_4845513_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.1e-117
WP_001521147.1|4845509_4846772_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|4846768_4847407_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 350
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4852621	4856337	5054076		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000081550.1|4852621_4853614_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|4853676_4854816_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|4854955_4855582_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|4855575_4856337_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 351
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4859449	4861482	5054076		Tupanvirus(50.0%)	2	NA	NA
WP_001173673.1|4859449_4860055_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
WP_001090361.1|4860054_4861482_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
>prophage 352
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4880936	4882284	5054076	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_100190663.1|4880936_4882284_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	5.1e-74
>prophage 353
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4886953	4887739	5054076		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_021523232.1|4886953_4887739_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	8.5e-21
>prophage 354
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4892149	4897069	5054076		Vibrio_phage(33.33%)	4	NA	NA
WP_001199973.1|4892149_4892821_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
WP_020232912.1|4893114_4893987_+	YgcG family protein	NA	NA	NA	NA	NA
WP_000036723.1|4894046_4895345_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|4895431_4897069_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 355
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4901102	4908149	5054076		Erysipelothrix_phage(33.33%)	4	NA	NA
WP_001521172.1|4901102_4902404_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.4	1.5e-38
WP_000186450.1|4902460_4905217_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
WP_000098243.1|4905447_4906788_-	glucarate dehydratase	NA	NA	NA	NA	NA
WP_001521173.1|4906808_4908149_-	glucarate dehydratase-related protein	NA	Q6A202	Oenococcus_phage	23.8	3.5e-06
>prophage 356
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4912750	4913599	5054076		Vibrio_phage(100.0%)	1	NA	NA
WP_000100411.1|4912750_4913599_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	3.6e-41
>prophage 357
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4918455	4919211	5054076		Bacillus_phage(100.0%)	1	NA	NA
WP_001309702.1|4918455_4919211_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	3.8e-10
>prophage 358
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4925979	4927479	5054076		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001521178.1|4925979_4927479_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.0	1.5e-21
>prophage 359
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4935701	4956578	5054076	tRNA	Bacillus_phage(22.22%)	14	NA	NA
WP_001521181.1|4935701_4936907_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	1.7e-73
WP_001521182.1|4936906_4937350_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117728.1|4937400_4938207_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000678646.1|4938282_4939380_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_001328930.1|4939964_4940912_-	phosphoglycerate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	26.2	2.0e-16
WP_001065576.1|4940983_4941580_-	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	33.0	4.0e-23
WP_001100456.1|4941572_4942757_-	putative C-S lyase	NA	NA	NA	NA	NA
WP_000810566.1|4942756_4944337_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	35.7	1.6e-05
WP_100190667.1|4944368_4945193_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_000016907.1|4945450_4946704_-	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237938.1|4946935_4948267_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775943.1|4948328_4950155_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	5.9e-25
WP_001521185.1|4950154_4953697_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.8	1.5e-08
WP_021523235.1|4953689_4956578_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	9.0e-68
>prophage 360
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4962056	4968829	5054076		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|4962056_4962851_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|4962857_4963733_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957911.1|4963883_4966130_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|4966142_4966673_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082188.1|4967357_4968047_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_001521193.1|4968115_4968829_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.7	2.0e-45
>prophage 361
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	4978460	4980955	5054076		Aichi_virus(50.0%)	2	NA	NA
WP_001521196.1|4978460_4979879_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	27.1	2.7e-25
WP_000603518.1|4980193_4980955_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 362
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	5013542	5014295	5054076		Clostridium_phage(100.0%)	1	NA	NA
WP_001309712.1|5013542_5014295_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 363
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	5038576	5042714	5054076		environmental_Halophage(50.0%)	3	NA	NA
WP_020232943.1|5038576_5039977_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001469293.1|5039994_5041311_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012178.1|5041346_5042714_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.8e-160
>prophage 364
NZ_CP024851	Escherichia coli strain AR_0006, complete genome	5054076	5046369	5053108	5054076	tRNA	Enterobacteria_phage(25.0%)	7	NA	NA
WP_001295374.1|5046369_5047818_+	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001050745.1|5047819_5047945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|5047941_5048013_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192809.1|5048067_5048616_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003071.1|5048658_5050176_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_099004485.1|5050185_5051284_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_021523238.1|5051374_5053108_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	1.1e-60
>prophage 1
NZ_CP024852	Escherichia coli strain AR_0006 plasmid tig00000164, complete sequence	167974	11813	62169	167974	protease,transposase,integrase	Escherichia_phage(33.33%)	50	22894:22953	37023:37682
WP_001067855.1|11813_12518_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_012579081.1|14120_15044_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
WP_001617865.1|15123_15999_-	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
WP_000608644.1|16248_17511_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000679427.1|19134_19482_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001256776.1|19673_20933_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	1.7e-26
WP_032488579.1|21199_21754_-	aminoglycoside N-acetyltransferase AAC(6')-Ib3	NA	NA	NA	NA	NA
WP_015057121.1|21933_22893_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
WP_001067855.1|22783_23488_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
22894:22953	attL	TGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCA	NA	NA	NA	NA
WP_002063889.1|24499_25042_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557452.1|25054_25915_-	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
WP_001067855.1|26021_26726_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|26847_27753_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_100190668.1|27749_28988_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|28987_29572_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|30064_30829_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000130000.1|31055_31361_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|31371_32577_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|32732_32936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|33063_33903_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|33896_34244_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000503573.1|34449_35238_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|35368_35842_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_100190669.1|35999_37022_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	42.2	4.0e-55
WP_001067855.1|36912_37617_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|38277_39138_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
37023:37682	attR	TGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGG	NA	NA	NA	NA
WP_001262765.1|39414_40725_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001398199.1|41009_41411_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|41343_41601_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|41693_42347_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_032152935.1|43285_44143_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001365705.1|44135_44210_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083821.1|44444_44702_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_000156883.1|45106_46129_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000005489.1|46600_46954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032152936.1|47366_47945_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_085970120.1|48244_49458_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.3	6.0e-167
WP_059330006.1|50096_50459_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	88.5	9.0e-34
WP_000624725.1|50455_50806_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080227.1|50836_51058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001496175.1|51414_51894_-	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000514417.1|51974_53378_-	YfcC family protein	NA	NA	NA	NA	NA
WP_000154545.1|53425_54430_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000440183.1|54514_55426_-	carbamate kinase	NA	NA	NA	NA	NA
WP_000410951.1|55436_56657_-	arginine deiminase	NA	NA	NA	NA	NA
WP_032336874.1|58416_58491_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083833.1|58726_58984_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001312851.1|59267_59417_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_072142979.1|59660_59894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100190670.1|60597_62169_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
