The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024826	Escherichia coli strain CREC-544 chromosome, complete genome	4903571	422766	434943	4903571	tail,plate	Burkholderia_phage(30.77%)	15	NA	NA
WP_061092773.1|422766_423558_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	2.0e-46
WP_061092772.1|423572_424028_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	42.7	2.3e-26
WP_061092771.1|424024_424732_-	DUF4376 domain-containing protein	NA	A0A0E3JQ06	Enterobacteria_phage	42.4	4.1e-14
WP_000135569.1|424728_426309_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	40.8	1.3e-84
WP_000359520.1|426311_427028_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	37.2	1.8e-22
WP_000951744.1|427020_428136_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	51.4	6.9e-101
WP_001093498.1|428126_428486_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	4.7e-35
WP_000679401.1|428584_429286_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	36.3	4.9e-12
WP_001361462.1|429295_430336_-	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	44.8	4.4e-73
WP_001269711.1|430323_430533_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	1.3e-16
WP_000271436.1|430532_431486_-	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	3.3e-35
WP_001262479.1|431485_433861_-|tail	tail protein	tail	A4JWL0	Burkholderia_virus	26.1	5.9e-57
WP_015674804.1|433962_434091_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000658214.1|434050_434368_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907502.1|434418_434943_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	9.5e-69
>prophage 2
NZ_CP024826	Escherichia coli strain CREC-544 chromosome, complete genome	4903571	1360740	1427291	4903571	portal,transposase,protease,capsid,integrase,terminase,head,tail,lysis,tRNA,holin	Enterobacteria_phage(47.37%)	81	1370891:1370937	1419591:1419637
WP_000912345.1|1360740_1362126_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143508.1|1362161_1362683_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1362790_1363003_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|1363004_1363871_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|1364342_1364885_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988384.1|1365103_1365796_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001361257.1|1365826_1368436_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691076.1|1368448_1369456_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255235.1|1369466_1369982_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805414.1|1369984_1370617_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
1370891:1370937	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_061092788.1|1370950_1372114_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.0	3.7e-198
WP_000446905.1|1371969_1372341_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000488407.1|1372312_1372591_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763385.1|1372638_1372857_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_001386642.1|1372955_1373237_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_032255841.1|1373247_1373805_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.9	3.2e-62
WP_045173744.1|1373801_1373960_-	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.1	1.8e-23
WP_024228451.1|1373956_1374637_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_052953584.1|1374633_1375419_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	2.4e-148
WP_000995439.1|1375424_1375721_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_061092790.1|1375796_1376003_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.3	4.2e-28
WP_061092791.1|1376534_1376852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061092792.1|1376983_1377253_-	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	75.3	4.8e-32
WP_064767403.1|1377333_1378023_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.4	1.2e-92
WP_001067459.1|1378127_1378358_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	8.5e-22
WP_061092794.1|1378439_1378979_+	regulator	NA	M9NZI6	Enterobacteria_phage	65.6	7.5e-61
WP_061092802.1|1379065_1379995_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	68.4	4.7e-111
WP_001566186.1|1379991_1380693_+	replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	97.0	7.9e-127
WP_000145912.1|1380689_1380992_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	94.6	2.6e-42
WP_001070442.1|1381059_1381392_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_032139864.1|1381483_1381591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709069.1|1381648_1383175_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.7	6.1e-31
WP_001567061.1|1383286_1383604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000068668.1|1383808_1384738_+	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	40.0	3.0e-57
WP_001309322.1|1384836_1384938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053033.1|1384934_1385390_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.7e-61
WP_000224919.1|1385389_1385560_+	NinE family protein	NA	NA	NA	NA	NA
WP_000774488.1|1385552_1385843_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_001099712.1|1385839_1386202_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_032139865.1|1386198_1386339_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001205470.1|1386423_1386780_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	92.0	2.3e-58
WP_000150292.1|1386759_1387974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000355468.1|1387976_1389152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120496.1|1389443_1389770_+|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
WP_001518397.1|1389773_1390250_+	glycoside hydrolase family protein	NA	K7PKX1	Enterobacterial_phage	96.1	9.5e-84
WP_001228695.1|1390466_1390649_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|1390739_1391033_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001307652.1|1391395_1391590_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000453566.1|1391978_1392524_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001518400.1|1392498_1394424_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000198149.1|1394420_1394627_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001518401.1|1394623_1396225_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	1.1e-309
WP_001518402.1|1396205_1397525_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	98.6	4.8e-234
WP_001299443.1|1397534_1397867_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000063252.1|1397922_1398948_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.1	3.9e-191
WP_001518405.1|1398989_1399388_+	hypothetical protein	NA	A0A0K2FIR1	Enterobacteria_phage	84.1	5.2e-51
WP_000752994.1|1399399_1399753_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000683145.1|1400338_1400734_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_001518408.1|1400741_1401482_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.5	2.4e-126
WP_001518409.1|1401497_1401920_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.0	7.7e-69
WP_001518410.1|1401946_1402336_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.1	3.4e-55
WP_001567091.1|1402328_1404890_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	99.2	0.0e+00
WP_000847401.1|1404886_1405216_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
WP_001518412.1|1405215_1405914_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	9.9e-130
WP_024177847.1|1405918_1406662_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	1.8e-145
WP_000090882.1|1406598_1407201_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_061092795.1|1407261_1410741_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
WP_001228252.1|1410808_1411408_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	3.4e-102
WP_061092796.1|1411472_1413845_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	68.8	7.9e-163
WP_061092797.1|1413844_1414126_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	2.7e-17
WP_000235975.1|1414135_1414840_+	hypothetical protein	NA	A0A1X7QGH6	Escherichia_phage	62.3	5.4e-59
WP_016245272.1|1414850_1415144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000239881.1|1415336_1416005_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001226375.1|1416543_1418028_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_061092798.1|1418214_1419168_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177457.1|1419680_1420442_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
1419591:1419637	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224581.1|1420624_1421515_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_100183572.1|1421515_1424365_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001393253.1|1424518_1424851_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_015387340.1|1424897_1425773_-	class A extended-spectrum beta-lactamase CTX-M-55	NA	A0A1B0VBP7	Salmonella_phage	82.1	2.4e-125
WP_000608644.1|1426028_1427291_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
>prophage 3
NZ_CP024826	Escherichia coli strain CREC-544 chromosome, complete genome	4903571	1776445	1785887	4903571		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569365.1|1776445_1777372_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783133.1|1777376_1778108_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1778088_1778196_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|1778255_1778987_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001334139.1|1779208_1780894_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	9.5e-304
WP_001308766.1|1780890_1781610_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001361590.1|1781656_1782127_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	1.5e-81
WP_001296231.1|1782167_1782629_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001361589.1|1782753_1784754_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	94.9	0.0e+00
WP_001292746.1|1784750_1785887_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	98.4	5.9e-164
>prophage 4
NZ_CP024826	Escherichia coli strain CREC-544 chromosome, complete genome	4903571	1898028	1909285	4903571		Acanthocystis_turfacea_Chlorella_virus(25.0%)	9	NA	NA
WP_000026026.1|1898028_1899045_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	44.3	6.3e-77
WP_000335121.1|1900130_1901252_+	GDP-mannose 4,6-dehydratase	NA	M1HVG7	Acanthocystis_turfacea_Chlorella_virus	64.7	2.2e-131
WP_000163129.1|1901255_1902221_+	GDP-L-fucose synthase	NA	M1I5W5	Acanthocystis_turfacea_Chlorella_virus	51.7	9.9e-88
WP_001042472.1|1902223_1902679_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_001361571.1|1902690_1904076_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.5	1.9e-47
WP_000868618.1|1904159_1904906_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	41.6	2.1e-08
WP_000736848.1|1904930_1906301_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	28.4	6.4e-32
WP_000043484.1|1906464_1907871_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
WP_000704860.1|1908118_1909285_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	1.7e-110
>prophage 5
NZ_CP024826	Escherichia coli strain CREC-544 chromosome, complete genome	4903571	1958081	2067950	4903571	transposase,plate,integrase	uncultured_Caudovirales_phage(31.25%)	83	1949926:1949985	2069767:2069782
1949926:1949985	attL	AATTTGGCTCCTCTGACTGGACTCGAACCAGTGACATACGGATTAACAGTCCGCCGTTCT	NA	NA	NA	NA
WP_085949836.1|1958081_1959295_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
1949926:1949985	attL	AATTTGGCTCCTCTGACTGGACTCGAACCAGTGACATACGGATTAACAGTCCGCCGTTCT	NA	NA	NA	NA
WP_063117468.1|1959808_1960243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063117471.1|1961744_1962260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063117478.1|1962433_1962829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300609.1|1966023_1966806_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	2.0e-139
WP_000255946.1|1966802_1967825_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	4.6e-200
WP_063117473.1|1970234_1970642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063117474.1|1970638_1971556_-	radical SAM protein	NA	NA	NA	NA	NA
WP_000532923.1|1972271_1972988_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060216.1|1973329_1974784_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378562.1|1974885_1976202_-	shikimate transporter	NA	NA	NA	NA	NA
WP_063117475.1|1976516_1977569_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_130090963.1|1977829_1985809_-	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_077249116.1|1986335_1986599_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_063117479.1|1986626_1987193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085949836.1|1987808_1989022_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
WP_077252459.1|1989169_1993258_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	35.6	1.5e-23
WP_061093069.1|1993268_1993610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077249107.1|1993654_1994368_+	RHS repeat-associated core domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	35.5	8.2e-23
WP_052895708.1|1994370_1994664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016248851.1|1994786_1995095_-	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_021550960.1|1995098_1995416_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	41.9	9.3e-11
WP_072693178.1|1995539_1996802_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	38.8	2.5e-70
WP_061093028.1|1997368_1998286_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
1996965:1997046	attR	AATTTGGCTCCTCTGACTGGACTCGAACCAGTGACATACGGATTAACAGTCCGCCGTTCTACCGACTGAACTACAGAGGAAT	NA	NA	NA	NA
WP_001011018.1|1998387_1999338_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
1996965:1997046	attR	AATTTGGCTCCTCTGACTGGACTCGAACCAGTGACATACGGATTAACAGTCCGCCGTTCTACCGACTGAACTACAGAGGAAT	NA	NA	NA	NA
WP_061093029.1|2003405_2004239_-	DUF4225 domain-containing protein	NA	A0A140XBD0	Dickeya_phage	43.3	3.0e-24
WP_061093030.1|2004408_2005545_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_115314324.1|2005652_2006027_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_061093031.1|2006172_2006730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061102077.1|2006742_2008275_-	hypothetical protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	34.0	4.0e-22
WP_061093078.1|2008498_2009026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061093033.1|2010778_2011072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077249119.1|2011091_2015510_-	DUF4150 domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	33.7	6.0e-23
WP_061093034.1|2015512_2016694_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_061093035.1|2016704_2018693_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_016159310.1|2018906_2019425_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_061093036.1|2020107_2020614_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_061093037.1|2020633_2022118_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_061093038.1|2022120_2022543_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_061093039.1|2022547_2024371_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_061093053.1|2024337_2025381_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_061093052.1|2025397_2026684_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_061093040.1|2026680_2027214_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_061093041.1|2027216_2028560_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_123056339.1|2028642_2029383_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_061093042.1|2029394_2032133_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.1	2.9e-84
WP_061093043.1|2032129_2032873_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_061093044.1|2032877_2034305_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_123056338.1|2034413_2037845_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_061093046.1|2037855_2039211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061093047.1|2039232_2039712_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_061093048.1|2039764_2040064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061093049.1|2040272_2041064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061093050.1|2041343_2042072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096427310.1|2042092_2043305_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.1	1.1e-102
WP_072652861.1|2043606_2044869_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	37.3	3.8e-71
WP_001302302.1|2045211_2046009_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_021524272.1|2046470_2047307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021580845.1|2047522_2047741_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	51.9	1.2e-09
WP_059256365.1|2047822_2048113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032283297.1|2048157_2048454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001519860.1|2048527_2048770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000505227.1|2048874_2049225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061093068.1|2049288_2049693_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_061093067.1|2049850_2050330_-	DUF4756 family protein	NA	NA	NA	NA	NA
WP_001519857.1|2050484_2051030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021513673.1|2052296_2052683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001519853.1|2053986_2055423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001519852.1|2055439_2056051_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_001519851.1|2056100_2056478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061093011.1|2056509_2056983_-	DUF4755 domain-containing protein	NA	NA	NA	NA	NA
WP_021513669.1|2057417_2057948_+	lipoprotein	NA	NA	NA	NA	NA
WP_000177655.1|2058041_2058614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001142313.1|2058672_2059155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061093010.1|2059233_2060715_-	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_001608347.1|2061364_2061673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001608346.1|2061676_2062555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061093009.1|2062859_2063225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061093008.1|2063221_2063527_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_000243502.1|2063922_2064480_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_100183574.1|2064532_2065996_+	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
WP_061093006.1|2066138_2066528_-	glyoxalase	NA	NA	NA	NA	NA
WP_061093005.1|2066729_2067950_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.3	6.2e-79
2069767:2069782	attR	TTATACCGTAAGGCTA	NA	NA	NA	NA
>prophage 6
NZ_CP024826	Escherichia coli strain CREC-544 chromosome, complete genome	4903571	3365977	3378905	4903571	integrase	Escherichia_phage(83.33%)	6	3371480:3371493	3379950:3379963
WP_100183582.1|3365977_3366910_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.4	4.6e-167
WP_000100042.1|3367497_3368028_-	hypothetical protein	NA	A0A2L1IV11	Escherichia_phage	97.7	3.3e-85
WP_001361862.1|3368075_3375995_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV38	Escherichia_phage	97.9	0.0e+00
3371480:3371493	attL	TATCAAAAATCAGG	NA	NA	NA	NA
WP_000243052.1|3376019_3376640_-	LuxR family transcriptional regulator	NA	A0A2L1IV08	Escherichia_phage	99.0	1.3e-117
WP_001181154.1|3376957_3377587_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	99.0	5.4e-119
WP_001224627.1|3378335_3378905_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.2	9.1e-49
3379950:3379963	attR	CCTGATTTTTGATA	NA	NA	NA	NA
>prophage 7
NZ_CP024826	Escherichia coli strain CREC-544 chromosome, complete genome	4903571	3602988	3631456	4903571	terminase,head,tail,tRNA,holin	Salmonella_phage(65.62%)	40	NA	NA
WP_001298403.1|3602988_3603525_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_100183583.1|3603549_3604185_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001296301.1|3604393_3605242_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042043823.1|3605597_3605924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042043824.1|3605850_3606402_+	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_042043825.1|3606494_3606656_+	hypothetical protein	NA	G9L6D9	Escherichia_phage	98.1	4.7e-19
WP_042043827.1|3606743_3607298_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	87.3	3.7e-87
WP_072075255.1|3607324_3607882_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	50.3	8.9e-41
WP_016234458.1|3607881_3608496_+|tail	tail assembly chaperone	tail	Q9MCR5	Enterobacteria_phage	60.5	1.1e-60
WP_050190118.1|3608502_3609306_-|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	40.1	1.1e-36
WP_100183584.1|3609305_3609986_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.3	5.9e-103
WP_050188012.1|3609982_3611182_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	83.4	3.2e-184
WP_001270634.1|3611181_3611535_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	90.6	3.1e-55
WP_100183585.1|3611534_3612287_-	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	66.7	4.5e-88
WP_089643999.1|3612352_3613078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100183586.1|3613080_3614145_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	81.4	3.2e-156
WP_000155114.1|3614147_3614450_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	91.0	4.8e-49
WP_016233441.1|3614449_3615037_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	89.1	3.1e-84
WP_100183587.1|3615036_3617025_-	lytic transglycosylase	NA	A0A0M4REK7	Salmonella_phage	74.7	3.0e-272
WP_000393954.1|3617202_3617655_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.7	4.7e-56
WP_000109249.1|3617658_3618099_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_100183588.1|3618109_3619255_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.5	1.4e-160
WP_000503647.1|3619258_3619822_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.7	1.3e-79
WP_021529139.1|3619796_3620186_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	95.3	2.1e-65
WP_021529140.1|3620172_3620727_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	82.1	7.0e-78
WP_100183589.1|3620723_3621131_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.8	8.7e-70
WP_100183590.1|3621096_3621465_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	90.2	9.4e-55
WP_050188015.1|3621505_3622447_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	87.2	2.9e-156
WP_050188016.1|3622458_3622962_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	82.6	1.4e-72
WP_100183591.1|3622966_3624199_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	95.1	7.6e-218
WP_157787427.1|3624213_3624948_-|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	83.7	8.3e-95
WP_000113486.1|3624838_3626305_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	91.8	1.0e-261
WP_050187976.1|3626304_3627927_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.0	6.0e-311
WP_050187977.1|3627929_3628481_-|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	69.8	1.2e-66
WP_001050348.1|3628503_3628959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113283.1|3629096_3629282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001408436.1|3629425_3629818_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	84.5	2.3e-51
WP_100183593.1|3629801_3630278_-	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	96.2	3.5e-86
WP_000781776.1|3630281_3630623_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	91.9	2.8e-53
WP_100183594.1|3631033_3631456_-	antitermination protein Q	NA	U5P0A5	Shigella_phage	34.7	7.8e-13
>prophage 8
NZ_CP024826	Escherichia coli strain CREC-544 chromosome, complete genome	4903571	3634840	3646623	4903571		Bacteriophage(44.44%)	14	NA	NA
WP_001046700.1|3634840_3635470_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	42.2	1.4e-34
WP_032317021.1|3636786_3637689_+	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
WP_100183595.1|3637691_3638993_+	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	55.9	8.0e-133
WP_000769005.1|3639008_3639557_+	DUF2815 family protein	NA	Q775A5	Bordetella_phage	65.9	2.1e-66
WP_053901690.1|3639608_3640247_+	hypothetical protein	NA	H6WRY3	Salmonella_phage	69.3	3.9e-72
WP_000490740.1|3640314_3640584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100183596.1|3640640_3642704_+	DNA polymerase	NA	Q775A3	Bordetella_phage	67.4	1.1e-274
WP_000008820.1|3642709_3642925_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000637724.1|3642921_3643221_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	63.2	2.7e-28
WP_000312947.1|3643210_3643480_+	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	65.9	5.1e-26
WP_032194263.1|3643484_3644054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000559954.1|3644007_3644256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000199789.1|3644279_3645158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000384174.1|3645225_3646623_+	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	73.3	3.2e-212
>prophage 9
NZ_CP024826	Escherichia coli strain CREC-544 chromosome, complete genome	4903571	4008233	4049740	4903571	transposase,protease,tRNA,integrase	Escherichia_phage(66.67%)	41	3994181:3994195	4041144:4041158
3994181:3994195	attL	CGCAGCTTATCCAGC	NA	NA	NA	NA
WP_023908971.1|4008233_4008731_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|4008825_4009533_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001300912.1|4009612_4010344_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_022646102.1|4010356_4011307_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001350133.1|4011415_4011979_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|4011978_4012395_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_100183598.1|4012607_4013588_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997798.1|4013605_4014310_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|4014327_4014894_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|4014890_4015181_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174738.1|4015188_4015782_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239941.1|4015774_4016911_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000784004.1|4017223_4018210_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000577034.1|4018254_4018758_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000378954.1|4018757_4020059_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_022646104.1|4020114_4021122_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394132.1|4021238_4022285_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|4022460_4023180_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001178590.1|4023200_4023341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001107566.1|4023363_4023690_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|4023689_4024409_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001361244.1|4024569_4025622_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|4025649_4025925_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|4025989_4027069_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|4027270_4028527_+	nucleoside permease	NA	NA	NA	NA	NA
WP_022646105.1|4028575_4030711_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234532.1|4031103_4031811_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_100183599.1|4032189_4033452_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	1.6e-77
WP_001301088.1|4036506_4037007_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001605858.1|4037139_4038759_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_000466879.1|4039489_4040191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071600693.1|4040245_4040428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100183600.1|4040536_4040755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|4040809_4042022_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
4041144:4041158	attR	GCTGGATAAGCTGCG	NA	NA	NA	NA
WP_100183601.1|4041988_4042105_+	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	96.0	3.3e-06
WP_001013324.1|4042888_4043314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001605860.1|4043310_4043694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001300609.1|4043813_4044596_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	2.0e-139
WP_000255946.1|4044592_4045615_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	4.6e-200
WP_072146520.1|4046854_4047004_-	hemolysin activation protein	NA	NA	NA	NA	NA
WP_085947771.1|4048577_4049740_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 1
NZ_CP024827	Escherichia coli strain CREC-544 plasmid pCREC-544_1, complete sequence	122937	15697	67854	122937	bacteriocin,transposase,integrase	Escherichia_phage(43.48%)	48	44873:44932	67085:67906
WP_001066954.1|15697_16438_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_014640565.1|16558_16747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001259759.1|18555_18759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014640552.1|18736_18973_-	colicin V immunity protein	NA	NA	NA	NA	NA
WP_001105066.1|19436_19718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000203272.1|20075_20603_-	colicin B immunity protein	NA	NA	NA	NA	NA
WP_001312845.1|20846_21662_+|bacteriocin	lipid II-degrading bacteriocin colicin M	bacteriocin	NA	NA	NA	NA
WP_000864812.1|21711_22065_-	colicin M immunity protein	NA	NA	NA	NA	NA
WP_000016493.1|22242_23034_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	2.7e-51
WP_000796228.1|23030_23720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493379.1|23763_24114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000952217.1|24658_25747_+	transcriptional repressor PifC	NA	NA	NA	NA	NA
WP_001300609.1|27351_28134_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	2.0e-139
WP_000255946.1|28130_29153_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	4.6e-200
WP_000963206.1|29982_30882_-	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_000111771.1|30871_31162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261287.1|31457_31688_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044768.1|31684_32101_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_000350638.1|32262_34401_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000343085.1|34754_35012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194575.1|35011_35602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000521603.1|37612_38230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001089727.1|38522_39602_-	permease	NA	NA	NA	NA	NA
WP_001175594.1|39706_40030_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071819239.1|40190_40673_+	hypothetical protein	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.5	2.9e-40
WP_001067834.1|40563_41268_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_001067834.1|42727_43432_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000018329.1|43971_44787_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
44873:44932	attL	AGGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGC	NA	NA	NA	NA
WP_001067855.1|44937_45642_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001011939.1|45785_46427_-	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
WP_001239317.1|46576_47077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|47156_47861_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845048.1|48308_49322_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|49477_49951_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001067855.1|50020_50725_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_072794601.1|51095_54062_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.8	0.0e+00
WP_000427619.1|54140_55145_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000954592.1|55326_55503_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001043260.1|55832_56648_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001082320.1|56708_57512_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480972.1|57511_58348_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000027057.1|58578_59439_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|59621_60179_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000608644.1|60742_62005_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_015387340.1|62260_63136_+	class A extended-spectrum beta-lactamase CTX-M-55	NA	A0A1B0VBP7	Salmonella_phage	82.1	2.4e-125
WP_001393253.1|63182_63515_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_085948178.1|65512_66726_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001067855.1|67149_67854_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
67085:67906	attR	AGGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
>prophage 1
NZ_CP024828	Escherichia coli strain CREC-544 plasmid pCREC-544_2, complete sequence	51455	30132	39879	51455	transposase	Escherichia_phage(62.5%)	9	NA	NA
WP_001067855.1|30132_30837_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002903955.1|32483_33386_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|33647_34409_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002904004.1|34429_35290_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_001067855.1|35426_36131_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001549892.1|36523_36763_-	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
WP_000343760.1|36864_38085_+|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_001549893.1|38173_38836_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
WP_000516402.1|39216_39879_+	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
>prophage 1
NZ_CP024829	Escherichia coli strain CREC-544 plasmid pCREC-544_3, complete sequence	32182	4964	30665	32182	tail,plate,capsid,protease,portal	Vibrio_phage(55.0%)	28	NA	NA
WP_000424604.1|4964_5228_-	hypothetical protein	NA	H6WRY4	Salmonella_phage	46.2	9.8e-14
WP_000356589.1|5251_5539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024189035.1|6182_7019_-	replication initiator protein RepA	NA	NA	NA	NA	NA
WP_100183613.1|7344_7899_-	recombinase family protein	NA	A0A1B0VBM1	Salmonella_phage	86.7	1.2e-85
WP_024133807.1|8034_8877_+|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	60.6	1.3e-38
WP_000972114.1|8878_9406_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	84.6	1.9e-80
WP_100183614.1|9434_9968_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	96.6	2.5e-93
WP_096942616.1|9970_12247_-|tail	phage tail protein	tail	Q1MVL8	Enterobacteria_phage	53.9	2.4e-177
WP_000763347.1|12277_12859_-|tail	phage tail protein I	tail	A0A0C5AJ63	Bacteriophage	40.0	7.2e-17
WP_001406393.1|13971_14292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000635200.1|14288_14756_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000998645.1|14752_15373_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	51.6	1.8e-29
WP_000944893.1|15375_16377_-	hypothetical protein	NA	A0A067ZG47	Vibrio_phage	42.5	1.3e-69
WP_001406394.1|16577_18710_-|tail	phage tail tape measure protein	tail	A0A097P6S4	Vibrio_phage	39.6	3.7e-18
WP_000450805.1|19524_19806_-	hypothetical protein	NA	A0A0C5AEP1	Bacteriophage	37.4	1.0e-05
WP_000070729.1|19815_20337_-|tail	phage major tail tube protein	tail	A0A067ZJA9	Vibrio_phage	57.8	1.5e-50
WP_000542267.1|20353_21817_-|tail	phage tail protein	tail	A0A059WKP9	Vibrio_phage	53.6	5.4e-146
WP_001284547.1|21816_22107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609133.1|22107_22593_-	hypothetical protein	NA	A0A067ZIL8	Vibrio_phage	37.4	3.0e-16
WP_001083980.1|22589_22934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001523066.1|22933_23326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100183615.1|23326_24370_-|capsid	major capsid protein	capsid	A0A059WRQ2	Vibrio_phage	47.9	6.7e-74
WP_001209256.1|24390_24774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032322647.1|24783_25851_-|protease	Clp protease ClpP	protease	A0A067ZG37	Vibrio_phage	48.0	1.6e-78
WP_024227017.1|25840_27415_-|portal	phage portal protein	portal	A0A067ZJA4	Vibrio_phage	65.9	7.0e-192
WP_100183616.1|27411_27651_-	hypothetical protein	NA	A0A067ZJ01	Vibrio_phage	50.7	4.4e-13
WP_001019009.1|29523_30075_-	hypothetical protein	NA	K4ICN8	Acidithiobacillus_phage	29.4	1.7e-07
WP_001185429.1|30074_30665_-	ParB N-terminal domain-containing protein	NA	A0A067ZI74	Vibrio_phage	58.5	1.6e-40
