The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024821	Escherichia coli strain CREC-591 chromosome, complete genome	5125266	18431	51761	5125266	head,terminase,capsid,plate,portal,integrase,holin,tail	Enterobacteria_phage(82.93%)	46	16316:16375	51868:51991
16316:16375	attL	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGA	NA	NA	NA	NA
WP_000078916.1|18431_18572_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488108.1|18762_19023_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_032152528.1|19065_20175_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	3.7e-195
WP_021575716.1|20331_21516_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.5	1.5e-223
WP_000290462.1|21515_22028_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000651572.1|22083_22458_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_000333503.1|22466_22622_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_100183873.1|22608_25416_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.2	0.0e+00
WP_033869895.1|25428_25917_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	4.0e-85
WP_033869893.1|25943_26543_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	86.3	3.4e-86
WP_100183874.1|26573_26984_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	89.5	4.1e-59
WP_000071724.1|29553_30162_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.5e-86
WP_001111959.1|30154_31051_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.7	3.5e-156
WP_000213447.1|31054_31405_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_024203873.1|31401_31983_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	99.0	5.0e-103
WP_000356339.1|31979_32615_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_000920594.1|32607_33075_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000780548.1|33212_33620_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	5.5e-64
WP_000072327.1|33616_34009_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000104350.1|34005_34329_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864901.1|34331_34532_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_089614667.1|34531_35026_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.8	7.8e-89
WP_000632329.1|35128_35929_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	90.6	7.3e-129
WP_001055112.1|35974_37027_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.4	2.9e-194
WP_001262688.1|37050_37887_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.6	1.5e-119
WP_001756260.1|38041_39793_+|terminase	ATPase subunit of terminase	terminase	A0A0A7NV54	Enterobacteria_phage	98.3	0.0e+00
WP_000087812.1|39792_40839_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_096129503.1|41330_41672_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	88.6	4.5e-27
WP_122998051.1|41668_41878_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	98.6	4.2e-36
WP_100183875.1|41879_42194_-	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	98.1	3.1e-51
WP_001163782.1|42190_42523_-	carboxylate--amine ligase	NA	A0A0A7NV51	Enterobacteria_phage	96.4	5.5e-54
WP_000211251.1|42586_42898_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	4.2e-48
WP_100183876.1|42902_43862_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	2.7e-178
WP_100183877.1|43938_46779_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	87.9	0.0e+00
WP_000564235.1|46775_47165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000985152.1|47488_47692_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	9.5e-25
WP_000021671.1|47779_47893_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	2.4e-09
WP_000514284.1|47889_48132_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	5.2e-38
WP_000158977.1|48143_48422_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	81.5	1.6e-35
WP_000716033.1|48432_48783_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	80.2	2.1e-48
WP_000014504.1|48804_49008_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|49079_49217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786772.1|49306_49711_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.2e-23
WP_000290343.1|49726_50377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100183879.1|50406_50754_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|50759_51761_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
51868:51991	attR	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTTTGT	NA	NA	NA	NA
>prophage 2
NZ_CP024821	Escherichia coli strain CREC-591 chromosome, complete genome	5125266	234431	274312	5125266	tRNA,terminase,capsid,portal,integrase,tail,transposase	Enterobacteria_phage(76.67%)	44	241767:241791	271886:271910
WP_001144192.1|234431_236360_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
WP_001700733.1|236363_236906_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|237002_237200_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|237252_237609_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|237731_237776_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018596.1|238059_239043_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_000672359.1|239057_241445_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|241449_241749_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
241767:241791	attL	GGCCGCTCTGCGGCCTTTTTTCTTT	NA	NA	NA	NA
WP_000078916.1|242052_242193_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488101.1|242383_242644_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_100183881.1|243233_244506_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	1.4e-169
WP_000132830.1|244989_246099_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000005367.1|246256_247441_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.2	4.7e-225
WP_000290450.1|247440_247953_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665308.1|248007_248373_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000763327.1|248408_248537_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_033544764.1|248523_251331_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	97.1	0.0e+00
WP_072644854.1|251343_251832_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	6.8e-85
WP_001100987.1|251928_253107_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_060615039.1|253201_253801_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	1.3e-101
WP_069067388.1|253800_255912_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	96.7	9.1e-110
WP_071549942.1|255914_256889_-|tail	phage tail protein I	tail	A0A0A7NQ82	Enterobacteria_phage	100.0	1.3e-92
WP_033544761.1|256912_257749_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.6	1.9e-119
WP_000613796.1|257903_259655_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.6	0.0e+00
WP_000087812.1|259654_260701_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_001603073.1|261233_261752_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_033544760.1|261741_262887_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000211261.1|263068_263380_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	97.1	1.0e-49
WP_033544759.1|263384_264344_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	9.9e-181
WP_033544758.1|264420_267246_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	86.8	0.0e+00
WP_021549223.1|267242_267632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000985152.1|267955_268159_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	9.5e-25
WP_000021664.1|268246_268360_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	3.1e-09
WP_000514277.1|268356_268599_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159459.1|268610_268889_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	78.3	1.5e-33
WP_000917801.1|268899_269238_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	82.8	5.1e-47
WP_000163908.1|269252_269531_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000094527.1|269622_269934_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	55.9	8.8e-22
WP_021529551.1|270022_270961_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.5	6.7e-81
WP_032157285.1|270993_271326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997174.1|271430_271760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000956529.1|271968_272949_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
271886:271910	attR	GGCCGCTCTGCGGCCTTTTTTCTTT	NA	NA	NA	NA
WP_001154187.1|273011_273563_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029466.1|273562_274312_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
>prophage 3
NZ_CP024821	Escherichia coli strain CREC-591 chromosome, complete genome	5125266	394150	441640	5125266	terminase,lysis,integrase,tail,protease,transposase	Escherichia_phage(34.78%)	52	407454:407468	413953:413967
WP_001260855.1|394150_394972_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|395071_395155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|395247_395583_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091835.1|395979_397233_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|397339_398233_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225275.1|398367_399588_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|399712_400408_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|400360_401653_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|401812_402427_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|402469_403324_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|403325_403943_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001340362.1|403953_406377_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_077627936.1|406437_407547_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	46.9	1.1e-85
407454:407468	attL	AGTTCCAGATGAACT	NA	NA	NA	NA
WP_001249849.1|407772_409128_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000113586.1|409650_410019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001020819.1|410415_411507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095383.1|411834_412344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039025924.1|412430_413420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000041533.1|413884_415363_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	49.9	5.2e-120
413953:413967	attR	AGTTCCAGATGAACT	NA	NA	NA	NA
WP_001295396.1|415561_415867_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|415974_416685_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|416687_417248_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|417282_417624_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|417758_418085_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000048320.1|419291_421763_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083273.1|421856_422048_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|422044_422233_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001296188.1|422632_422797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171933.1|422800_423019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|423178_423334_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000448563.1|423500_423908_-	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000920568.1|423991_424222_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000705353.1|424205_424727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054501.1|424707_425673_+	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	9.7e-59
WP_001151251.1|425713_426136_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.0	1.4e-62
WP_000566848.1|426388_427288_+	SMEK domain-containing protein	NA	NA	NA	NA	NA
WP_001373963.1|427602_428256_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_072644959.1|428268_428964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967407.1|429649_429862_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	4.0e-26
WP_000980987.1|430078_430330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023147795.1|430396_430675_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_001265276.1|430676_431726_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.9	2.0e-113
WP_001204811.1|431743_432121_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	80.8	4.5e-52
WP_000780579.1|432277_432802_-	outer membrane lipoprotein Blc	NA	A0A1W6JNX6	Morganella_phage	54.8	1.7e-46
WP_000592549.1|432994_433954_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000839586.1|434885_435101_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	97.2	7.7e-33
WP_100183881.1|435219_436492_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	1.4e-169
WP_001228695.1|437150_437333_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_072644997.1|437423_437717_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	4.5e-44
WP_000421825.1|438397_438937_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_100069996.1|438945_440256_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.3	1.0e-252
WP_000885571.1|441058_441640_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.9e-103
>prophage 4
NZ_CP024821	Escherichia coli strain CREC-591 chromosome, complete genome	5125266	629928	639930	5125266	holin,tail	Enterobacteria_phage(50.0%)	12	NA	NA
WP_000837924.1|629928_631062_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001082294.1|631202_631637_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_120795384.1|632413_632527_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836772.1|632595_632829_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	4.1e-32
WP_000086519.1|633145_633736_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	2.8e-24
WP_000885599.1|633833_634409_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	9.1e-105
WP_060614949.1|634408_636484_-	hypothetical protein	NA	X2KTY7	Enterobacteria_phage	57.0	5.1e-198
WP_000839557.1|636615_636831_-|holin	holin	holin	A5LH82	Enterobacteria_phage	93.0	6.5e-32
WP_001348108.1|637082_637457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072644863.1|637628_638057_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000640162.1|639100_639643_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	4.9e-76
WP_000247763.1|639639_639930_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
>prophage 5
NZ_CP024821	Escherichia coli strain CREC-591 chromosome, complete genome	5125266	646657	664956	5125266	tRNA,integrase	Escherichia_phage(66.67%)	22	647994:648007	662379:662392
WP_001676522.1|646657_648655_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	3.3e-21
647994:648007	attL	GCATTCACCTGCAA	NA	NA	NA	NA
WP_001151151.1|648995_649418_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_001262393.1|649458_650529_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_000693853.1|650600_651026_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072337.1|651022_651277_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|651356_651776_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_000233809.1|652062_652197_+	phage protein	NA	NA	NA	NA	NA
WP_001169151.1|652207_652363_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|652359_652848_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560225.1|653289_653511_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001352098.1|653510_653681_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|653755_654031_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_000105127.1|654132_656733_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	1.5e-247
WP_000166319.1|656725_657535_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|657591_657786_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|657778_657988_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|658066_658282_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|658283_659519_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001153728.1|659570_660506_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	1.0e-145
WP_000123745.1|660634_662008_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|662485_663469_-	zinc transporter ZntB	NA	NA	NA	NA	NA
662379:662392	attR	GCATTCACCTGCAA	NA	NA	NA	NA
WP_000628065.1|663723_664956_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 6
NZ_CP024821	Escherichia coli strain CREC-591 chromosome, complete genome	5125266	959792	1042261	5125266	coat,terminase,lysis,portal,integrase,holin,protease,transposase	Enterobacteria_phage(46.38%)	97	957149:957164	1046533:1046548
957149:957164	attL	GCGAACTATTTTGCTG	NA	NA	NA	NA
WP_085947771.1|959792_960954_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000409849.1|960995_962354_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	1.1e-20
WP_000287458.1|962940_965364_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_000945561.1|965372_967391_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_000610451.1|967383_968709_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_001061095.1|968710_969124_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_001307105.1|969173_970097_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	9.2e-91
WP_001199180.1|970580_971852_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_000154411.1|971857_972985_-	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_000497941.1|973042_973873_-	FTR1 family protein	NA	NA	NA	NA	NA
WP_001018509.1|974414_975923_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000979516.1|976081_976291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001307103.1|976345_980308_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000191700.1|980347_980986_-	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_001297176.1|981273_982365_+	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_001307708.1|982364_983057_+	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_001126780.1|983068_983455_+	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_001348013.1|983462_984263_+	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001001196.1|984272_984863_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001028095.1|984873_985368_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_001240630.1|985388_986717_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	4.5e-232
WP_001273658.1|986799_986973_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001151437.1|987345_987942_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001143120.1|987962_988190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044263.1|988227_989469_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_000535359.1|989757_991017_-	YccE family protein	NA	NA	NA	NA	NA
WP_000420629.1|991276_992197_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	3.2e-11
WP_000024561.1|992196_992502_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209854.1|992594_993194_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001230242.1|995735_996908_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120112.1|997037_997730_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264933.1|997702_998731_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_077891786.1|999213_1001253_-	hypothetical protein	NA	A0A2D1GLP5	Escherichia_phage	72.3	5.2e-62
WP_072644829.1|1001353_1002256_-	phage antirepressor Ant	NA	Q0H8C7	Salmonella_phage	91.7	2.6e-159
WP_072644830.1|1002318_1002540_-	hypothetical protein	NA	I6RSG6	Salmonella_phage	97.3	7.1e-34
WP_001386205.1|1002536_1002677_-	Arc family DNA-binding protein	NA	A0A0M4S6R9	Salmonella_phage	59.1	4.4e-05
WP_001283827.1|1002782_1003034_+	Arc family DNA-binding protein	NA	A5VW59	Enterobacteria_phage	95.1	1.2e-34
WP_001036007.1|1003030_1003240_+	hypothetical protein	NA	I6R975	Salmonella_phage	98.6	5.9e-30
WP_000151196.1|1003214_1003400_-	hypothetical protein	NA	I6RSG3	Salmonella_phage	100.0	1.1e-08
WP_001085430.1|1003724_1003904_+	hypothetical protein	NA	B8K1I9	Salmonella_phage	100.0	2.1e-28
WP_072644831.1|1003917_1004283_-	hypothetical protein	NA	A0A192Y6W5	Salmonella_phage	98.3	3.1e-66
WP_085956046.1|1004334_1004703_+	hypothetical protein	NA	I6S5X4	Salmonella_phage	100.0	3.4e-65
WP_000331835.1|1004727_1006638_-	hypothetical protein	NA	I6R973	Salmonella_phage	97.8	0.0e+00
WP_072644833.1|1006637_1008023_-	acyltransferase	NA	I6RSG0	Salmonella_phage	95.4	8.2e-245
WP_000964872.1|1008033_1008726_-	DNA transfer protein	NA	A5VW66	Enterobacteria_phage	97.8	5.8e-114
WP_072644834.1|1008728_1009184_-	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	98.7	3.3e-86
WP_001535935.1|1009183_1010137_-	hypothetical protein	NA	Q716G6	Shigella_phage	84.5	1.6e-93
WP_072644835.1|1010136_1011555_-	hypothetical protein	NA	Q9AYZ4	Salmonella_phage	99.6	7.1e-276
WP_021514122.1|1011554_1012055_-	hypothetical protein	NA	G8EYJ2	Enterobacteria_phage	100.0	1.7e-91
WP_021568315.1|1012032_1012269_-	hypothetical protein	NA	A0A2D1GLK1	Escherichia_phage	81.8	4.9e-25
WP_021568314.1|1012313_1013609_-|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	99.1	1.0e-241
WP_000373006.1|1013608_1014520_-	scaffold protein	NA	A0A2D1GLN7	Escherichia_phage	100.0	1.3e-161
WP_072644836.1|1014533_1016699_-|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	98.8	0.0e+00
WP_072644837.1|1016699_1018199_-|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	99.6	9.1e-306
WP_077890887.1|1018176_1018665_-	DNA-packaging protein	NA	A0A0M3ULC0	Salmonella_phage	98.8	1.6e-86
WP_000807788.1|1018744_1018987_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_001016386.1|1019340_1019859_-	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	100.0	3.2e-93
WP_072644839.1|1020058_1020496_-|lysis	lysis protein	lysis	Q9MCN3	Enterobacteria_phage	98.6	2.9e-71
WP_021521977.1|1020492_1020969_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	99.4	3.7e-88
WP_000783734.1|1020952_1021276_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_072644840.1|1021738_1022257_-	DUF1133 family protein	NA	A0A192Y911	Salmonella_phage	98.3	7.7e-95
WP_000994516.1|1022253_1022442_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008200.1|1022438_1022801_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6I9	Enterobacteria_phage	100.0	9.2e-63
WP_000002231.1|1022797_1023088_-	DUF1364 domain-containing protein	NA	K7PK25	Enterobacteria_phage	96.9	9.3e-50
WP_001279421.1|1023087_1023357_-	hypothetical protein	NA	K7PHK7	Enterobacteria_phage	100.0	7.1e-44
WP_000566866.1|1023349_1023520_-	protein ninF	NA	K7PLU6	Enterobacteria_phage	100.0	2.5e-26
WP_001254250.1|1023516_1023699_-	NinE family protein	NA	Q716C5	Shigella_phage	98.3	4.8e-28
WP_000153280.1|1023695_1024223_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_047400585.1|1024219_1024660_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	99.3	3.5e-80
WP_001322819.1|1024938_1026819_-	bifunctional DNA primase/helicase	NA	K7PK08	Enterobacteria_phage	99.7	0.0e+00
WP_000067068.1|1026926_1027787_-	replication protein	NA	K7PL20	Enterobacteria_phage	99.7	4.3e-159
WP_000166207.1|1027779_1027926_-	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000251073.1|1027958_1028252_-	hypothetical protein	NA	K7P6Y2	Enterobacteria_phage	100.0	2.8e-46
WP_000276886.1|1028360_1028546_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_000856967.1|1028626_1029277_+	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	100.0	1.1e-122
WP_001309622.1|1029590_1029896_+	hypothetical protein	NA	A5VW99	Enterobacteria_phage	88.7	5.4e-24
WP_000213975.1|1030166_1030367_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_072644841.1|1030542_1031511_+	cell envelope biogenesis protein TolA	NA	K7P7J7	Enterobacteria_phage	99.4	5.0e-55
WP_000638547.1|1031535_1031667_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001518153.1|1031651_1031804_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	98.0	1.4e-20
WP_072644842.1|1032058_1032766_+	recombinase	NA	K7PKU3	Enterobacteria_phage	98.7	8.5e-137
WP_072644843.1|1032766_1033270_+	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	89.5	6.6e-67
WP_072644844.1|1033278_1033827_+	3'-5' exoribonuclease	NA	K7PM77	Enterobacteria_phage	98.4	2.1e-103
WP_072644845.1|1033843_1034137_+	DUF2856 family protein	NA	K7PH66	Enterobacterial_phage	94.8	2.3e-48
WP_001214452.1|1034147_1034312_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	4.6e-22
WP_077890885.1|1034308_1034944_+	hypothetical protein	NA	E7C9P6	Salmonella_phage	75.2	1.0e-77
WP_072644846.1|1034940_1035546_+	DUF551 domain-containing protein	NA	A0A222YWN7	Escherichia_phage	85.0	2.7e-59
WP_000492058.1|1035612_1035855_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	78.8	5.8e-29
WP_001518157.1|1035973_1036141_+	hypothetical protein	NA	A0A2D1GM11	Escherichia_phage	94.5	4.1e-26
WP_001303849.1|1036180_1036399_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_001609775.1|1036376_1037450_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9G075	Enterobacteria_phage	98.9	9.0e-199
WP_001367057.1|1037544_1040289_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_000829672.1|1040360_1041434_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|1041481_1041655_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001316982.1|1041644_1041875_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524630.1|1041849_1042038_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|1042048_1042261_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
1046533:1046548	attR	GCGAACTATTTTGCTG	NA	NA	NA	NA
>prophage 7
NZ_CP024821	Escherichia coli strain CREC-591 chromosome, complete genome	5125266	1759223	1845358	5125266	head,terminase,capsid,plate,portal,integrase,holin,tail,protease	Shigella_phage(55.77%)	86	1784818:1784834	1842804:1842820
WP_000131044.1|1759223_1761257_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001295527.1|1761385_1761973_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089077.1|1761986_1763459_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159102.1|1763472_1765143_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001295805.1|1766217_1766781_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
WP_001315275.1|1767110_1767905_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001406334.1|1768058_1768820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071593451.1|1769965_1771159_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001209098.1|1771342_1772008_+	membrane protein	NA	NA	NA	NA	NA
WP_000370308.1|1772253_1772949_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023910.1|1772941_1774369_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102115.1|1774379_1775099_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339587.1|1775627_1776482_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001046304.1|1776707_1778033_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
WP_000474074.1|1778141_1778378_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|1778389_1778983_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_024198277.1|1779142_1780012_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	1.6e-52
WP_000092619.1|1781238_1785492_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
1784818:1784834	attL	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
WP_000662258.1|1786586_1786688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803999.1|1787050_1787314_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|1787313_1787454_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147277.1|1787488_1787716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296902.1|1788538_1789081_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|1789155_1789743_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|1789800_1790469_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001315269.1|1793008_1794652_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001305432.1|1794620_1795331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303809.1|1795643_1795973_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|1796220_1796835_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070694.1|1797252_1797942_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000667026.1|1798923_1801122_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121326.1|1801131_1802088_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111349.1|1802066_1802477_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_063082667.1|1803224_1804559_+	FRG domain-containing protein	NA	Q9AZ51	Lactococcus_phage	34.1	2.6e-06
WP_077890891.1|1804760_1806251_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_072644924.1|1806240_1806858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072644925.1|1807192_1807747_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.3	1.7e-87
WP_024215329.1|1809944_1810529_-	YmfQ family protein	NA	O22003	Shigella_phage	99.5	4.1e-113
WP_072644929.1|1810519_1811578_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.3	6.2e-200
WP_000424732.1|1811564_1811990_-	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_001259074.1|1811989_1812538_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.4	7.3e-96
WP_000999511.1|1812537_1813617_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	2.6e-206
WP_040091763.1|1813613_1814942_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.0	5.1e-244
WP_000807211.1|1815002_1816838_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.5	5.9e-307
WP_000661047.1|1816979_1817249_-|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_000090998.1|1817248_1817605_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_040091764.1|1817604_1819101_-|tail	tail sheath protein	tail	S5FKL0	Shigella_phage	99.4	2.0e-276
WP_000497751.1|1819084_1819255_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_072644931.1|1819263_1819824_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	2.3e-105
WP_000224835.1|1819820_1820327_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
WP_000702395.1|1820301_1820712_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
WP_000924828.1|1820708_1821032_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	100.0	3.5e-53
WP_072644932.1|1821110_1822340_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.3	5.8e-226
WP_000999805.1|1822350_1822953_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_000923137.1|1822945_1824172_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	99.0	1.1e-240
WP_122988558.1|1824319_1825816_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	98.8	3.1e-290
WP_000929187.1|1826049_1826544_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	98.8	2.5e-87
WP_072644933.1|1826669_1827020_-	HNH endonuclease	NA	U5P4L6	Shigella_phage	97.4	5.2e-63
WP_001089762.1|1827170_1827506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000613840.1|1827606_1828176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001434542.1|1828351_1828732_-	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	87.2	2.6e-52
WP_001157005.1|1828715_1829192_-	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	96.8	1.2e-86
WP_001120497.1|1829195_1829522_-|holin	phage holin, lambda family	holin	S5FM86	Shigella_phage	99.1	1.5e-56
WP_001258750.1|1829823_1830225_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_000709408.1|1830235_1831201_+	caspase family protein	NA	NA	NA	NA	NA
WP_001205452.1|1831231_1831585_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	82.3	6.4e-53
WP_015675130.1|1831602_1832592_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	1.4e-193
WP_001061416.1|1832599_1833397_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	98.9	1.7e-149
WP_000767096.1|1833416_1833806_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	2.7e-68
WP_000210164.1|1833802_1834129_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	9.2e-54
WP_072644934.1|1834128_1834623_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	92.0	3.3e-79
WP_000104963.1|1834619_1835561_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.4	8.6e-153
WP_001250267.1|1835550_1835730_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	66.7	2.3e-14
WP_000515828.1|1835905_1836457_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	2.6e-101
WP_000649477.1|1836500_1836701_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|1836791_1837466_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000549623.1|1837700_1837907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016389.1|1837878_1838313_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_000008236.1|1838857_1839394_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242749.1|1839384_1839747_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|1839746_1840052_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_077941726.1|1839967_1840402_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	99.3	3.2e-78
WP_000051887.1|1840278_1841442_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893255.1|1841646_1842900_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
1842804:1842820	attR	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
WP_001285288.1|1842911_1844015_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_072735913.1|1844302_1845358_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	4.5e-118
>prophage 8
NZ_CP024821	Escherichia coli strain CREC-591 chromosome, complete genome	5125266	2143726	2221539	5125266	tRNA,head,terminase,capsid,plate,portal,integrase,holin,tail,protease,transposase	Shigella_phage(42.59%)	85	2194419:2194434	2222250:2222265
WP_000399648.1|2143726_2144707_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000738723.1|2144966_2145263_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_000781063.1|2145476_2146763_-	threonine synthase	NA	NA	NA	NA	NA
WP_000241649.1|2146763_2147696_-	homoserine kinase	NA	NA	NA	NA	NA
WP_001264698.1|2147697_2150160_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_001386572.1|2150240_2150306_-	thr operon leader peptide	NA	NA	NA	NA	NA
WP_001223125.1|2150519_2151206_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001303782.1|2151605_2151746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|2151841_2152558_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_001395611.1|2152617_2153943_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001219604.1|2154026_2155451_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.7	1.2e-09
WP_001188656.1|2155450_2156140_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	5.2e-30
WP_000875487.1|2156152_2156626_-	protein CreA	NA	NA	NA	NA	NA
WP_000371666.1|2156836_2157706_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000942344.1|2157702_2158350_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_001378619.1|2158401_2158923_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000068679.1|2159007_2159334_-	trp operon repressor	NA	NA	NA	NA	NA
WP_000409465.1|2159423_2161361_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|2161571_2163239_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093810.1|2163545_2164778_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_001029698.1|2164798_2166181_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132955.1|2166229_2167198_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_000124615.1|2167303_2167948_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_000105865.1|2167975_2168992_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000224877.1|2169447_2170167_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816471.1|2170246_2171470_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000477811.1|2171521_2172844_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
WP_001295412.1|2172970_2173750_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001143257.1|2174007_2175558_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001088405.1|2175529_2176393_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_000563068.1|2176505_2177288_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000531527.1|2177284_2178358_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|2178479_2178641_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|2178767_2179373_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_001401570.1|2179765_2181352_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001217539.1|2181571_2181820_+	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_039004699.1|2182745_2185355_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_039004724.1|2185454_2185589_-	resolvase	NA	A0A0F7LA37	Escherichia_phage	81.6	3.3e-10
WP_061326800.1|2187802_2188387_-	YmfQ family protein	NA	O22003	Shigella_phage	99.5	3.2e-113
WP_032281334.1|2188377_2189436_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	99.1	1.2e-200
WP_000424732.1|2189422_2189848_-	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_072735921.1|2189847_2190396_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	5.1e-97
WP_072735922.1|2190395_2191475_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.2	2.6e-206
WP_072735923.1|2191471_2192800_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
WP_077249838.1|2192890_2193403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072735924.1|2193484_2195317_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.5	3.8e-306
2194419:2194434	attL	TCGGCATCATCACCAA	NA	NA	NA	NA
WP_000661054.1|2195458_2195728_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090998.1|2195727_2196084_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_086528354.1|2196083_2197580_-|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	98.6	6.5e-272
WP_000497751.1|2197563_2197734_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779279.1|2197742_2198303_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	2.3e-105
WP_001570138.1|2198299_2198806_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.3	6.6e-83
WP_000702403.1|2198780_2199191_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	95.6	9.4e-72
WP_038977173.1|2199187_2199511_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	98.1	3.3e-56
WP_038977172.1|2199513_2199714_-	hypothetical protein	NA	S5FNU1	Shigella_phage	95.5	2.5e-25
WP_072735939.1|2199764_2200970_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.5	7.0e-224
WP_001193633.1|2200984_2201635_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	7.3e-119
WP_000466255.1|2201612_2202854_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_000605606.1|2202853_2203036_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_122057049.1|2203047_2204544_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.4	2.2e-299
WP_000929172.1|2204777_2205272_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	8.6e-88
WP_052908756.1|2205397_2205748_-	HNH endonuclease	NA	Q8SBD7	Shigella_phage	97.4	6.2e-64
WP_116838191.1|2205774_2206047_-	peptidase	NA	Q8SBD8	Shigella_phage	98.9	5.7e-41
WP_001766839.1|2205931_2206324_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	98.5	1.5e-63
WP_001148534.1|2206307_2206784_-	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	100.0	7.5e-89
WP_001120502.1|2206787_2207123_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	100.0	5.2e-60
WP_052908757.1|2207199_2208252_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	98.9	2.6e-206
WP_001355891.1|2208401_2208596_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	100.0	1.8e-28
WP_015967852.1|2208845_2209598_-	antitermination protein	NA	Q8SBE4	Shigella_phage	100.0	2.8e-138
WP_001439745.1|2209611_2210601_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	9.5e-195
WP_015967850.1|2210608_2211418_-	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	100.0	6.0e-155
WP_000767113.1|2211437_2211827_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210170.1|2211823_2212150_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_072735893.1|2212149_2212644_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	7.3e-87
WP_072735894.1|2212640_2213582_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	92.7	2.4e-139
WP_072735895.1|2213571_2213751_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	1.7e-14
WP_000514174.1|2213926_2214511_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	60.9	5.5e-57
WP_001231956.1|2214538_2214736_-	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	56.9	1.1e-14
WP_072735896.1|2214831_2215485_+	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	60.8	5.7e-71
WP_000141753.1|2215911_2216157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039005309.1|2216663_2217200_+	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	98.3	9.0e-99
WP_000335009.1|2217190_2218069_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	93.1	8.2e-166
WP_024193627.1|2218116_2218413_+	hypothetical protein	NA	U5P0J0	Shigella_phage	72.2	1.1e-24
WP_061352499.1|2218889_2220131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001218286.1|2220315_2221539_-|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	99.0	9.5e-237
2222250:2222265	attR	TTGGTGATGATGCCGA	NA	NA	NA	NA
>prophage 9
NZ_CP024821	Escherichia coli strain CREC-591 chromosome, complete genome	5125266	2266888	2296112	5125266	integrase,transposase	Escherichia_phage(30.0%)	30	2264594:2264653	2285971:2286739
2264594:2264653	attL	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTC	NA	NA	NA	NA
WP_001138064.1|2266888_2269855_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|2269857_2270418_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|2270543_2270894_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|2271096_2272110_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|2272265_2272739_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	A0A140HLG8	Bacillus_phage	33.8	5.3e-18
WP_001144737.1|2272959_2273226_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001389365.1|2273368_2274133_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|2274625_2275210_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|2275209_2276448_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|2276444_2277350_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|2277471_2278176_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|2278326_2279142_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|2279331_2280036_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000935452.1|2280082_2281387_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000204520.1|2281425_2282133_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|2282129_2282366_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|2282362_2282725_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|2282742_2284437_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|2284488_2284911_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|2284946_2285222_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_100183886.1|2286024_2286336_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|2286332_2286569_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000204520.1|2286565_2287273_+	EAL domain-containing protein	NA	NA	NA	NA	NA
2285971:2286739	attR	GACAAAGTCATCGGGCATTATCTGAACATAAAACACTATCAATAAGTTGGAGTCATTACCGTGCGCGACTACCTGGTGCGCGGCTTGTTACGGCCGGTGGCCTGCACCACGGGCGGCTACGGCGTGTTCGACGATGCGGCCTTGCAACGGCTGTGCTTCGTGCGCGCGGCCTTCGAGGCGGGTATCGGCCTGGATGCCCTGGCGCGGCTGTGCCGTGCGCTCGACGCAGCGGACGGCGCACAAGCCGCAGCGCAGCTTGCCGTGCTGCGCCAGTTGGTCGAGCGGCGGCGCGCGGCGTTGGCCCATCTGGACGCGCAACTGGCCTCCATGCCAGCCGAGCGGGCGCACGAGGAGGCATTGCCGTGAACGCCCCTGACAAACTGCCGCCCGAGACGCGCCAACCCGTTTCCGGCTACCTGTGGGGTGCGCTGGCCGTGTTGACCTGCCCCTGCCATCTGCCGATTCTCGCCGCCGTGCTGGCCGGGACGACCGCCGGTGCCTTCCTTGGCGAGCATTGGGGTGTTGCCGCGCTCGCGCTGACCGGCTTGTTCGTTCTGGCCGTAACGCGGCTGCTGCGCGCCTTCCGGGGCGGATCATGACGAGTTCGCAGCCCGCCGGATGGACGGCGGCCGAGTTGGCGCAGGCGGCGGCGCGCGGACAGCTTGACCTGCATTACCAGCCGCTGGTCGATCTGCGCGATCACCGGATCGCTGGCGCGGAAGCGTTGATGCGCTGGCGGCATCCGAGGCTTGGCCTGTTGCCGCCCGGC	NA	NA	NA	NA
WP_000935440.1|2287311_2288055_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000493383.1|2288039_2288900_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|2288931_2290131_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000470728.1|2290209_2290887_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|2290918_2291161_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000429836.1|2292163_2292598_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000181165.1|2295155_2296112_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.7	1.0e-60
>prophage 10
NZ_CP024821	Escherichia coli strain CREC-591 chromosome, complete genome	5125266	3099746	3116020	5125266	integrase	Morganella_phage(45.45%)	17	3090515:3090528	3120133:3120146
3090515:3090528	attL	GCGTGGCCTGCTTT	NA	NA	NA	NA
WP_000230717.1|3099746_3100202_+	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	67.2	2.9e-45
WP_000290520.1|3100204_3101167_-	abortive infection protein	NA	A0A059NT88	Lactococcus_phage	29.4	4.2e-14
WP_016231257.1|3102001_3102439_+	hypothetical protein	NA	I6S5X4	Salmonella_phage	33.1	3.1e-12
WP_016238273.1|3102498_3104604_-	hypothetical protein	NA	A0A2I7QQN9	Vibrio_phage	36.2	2.0e-88
WP_072644816.1|3104603_3106070_-	acyltransferase	NA	B6SCW4	Bacteriophage	53.8	1.3e-107
WP_001244114.1|3106833_3109596_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.7	3.4e-298
WP_072644817.1|3109608_3110211_-	hypothetical protein	NA	Q8W653	Enterobacteria_phage	33.8	7.0e-23
WP_000181940.1|3110203_3110425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024676.1|3110421_3110685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072644818.1|3110681_3110876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077890877.1|3110868_3111936_-	ash family protein	NA	NA	NA	NA	NA
WP_000476150.1|3111929_3112112_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_072644819.1|3112104_3112938_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	9.0e-21
WP_000412540.1|3112950_3113382_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.7	3.0e-28
WP_001090781.1|3113381_3113585_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_072644820.1|3113699_3114665_-	hypothetical protein	NA	A0A1W6JPD1	Morganella_phage	51.2	3.9e-07
WP_001555742.1|3114760_3116020_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	78.1	3.0e-193
3120133:3120146	attR	GCGTGGCCTGCTTT	NA	NA	NA	NA
>prophage 11
NZ_CP024821	Escherichia coli strain CREC-591 chromosome, complete genome	5125266	4197832	4204972	5125266		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|4197832_4198471_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|4198467_4199730_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|4199726_4200635_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|4200830_4201598_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141333.1|4201648_4202305_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	2.8e-49
WP_072644858.1|4202410_4204972_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	2.3e-30
>prophage 12
NZ_CP024821	Escherichia coli strain CREC-591 chromosome, complete genome	5125266	4555867	4568789	5125266	integrase	Escherichia_phage(83.33%)	6	4548678:4548692	4558501:4558515
4548678:4548692	attL	TTTTTTTTGCACCTC	NA	NA	NA	NA
WP_001224626.1|4555867_4556437_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.2	7.0e-49
WP_001181154.1|4557185_4557815_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	99.0	5.4e-119
WP_000243052.1|4558132_4558753_+	LuxR family transcriptional regulator	NA	A0A2L1IV08	Escherichia_phage	99.0	1.3e-117
4558501:4558515	attR	GAGGTGCAAAAAAAA	NA	NA	NA	NA
WP_012311963.1|4558777_4566691_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV38	Escherichia_phage	93.4	0.0e+00
WP_000100042.1|4566738_4567269_+	hypothetical protein	NA	A0A2L1IV11	Escherichia_phage	97.7	3.3e-85
WP_000368131.1|4567856_4568789_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
>prophage 13
NZ_CP024821	Escherichia coli strain CREC-591 chromosome, complete genome	5125266	4819827	4829269	5125266		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569325.1|4819827_4820754_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|4820758_4821490_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|4821470_4821578_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|4821637_4822369_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|4822590_4824276_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|4824272_4824992_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|4825038_4825509_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|4825549_4826011_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001317947.1|4826135_4828136_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001292774.1|4828132_4829269_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 14
NZ_CP024821	Escherichia coli strain CREC-591 chromosome, complete genome	5125266	4974500	5092854	5125266	head,terminase,capsid,portal,integrase,holin,tail,protease,transposase	Escherichia_phage(41.18%)	99	4985753:4985768	5056545:5056560
WP_100183881.1|4974500_4975774_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	1.4e-169
WP_001313066.1|4976847_4977027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001201739.1|4977211_4977595_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
WP_000609174.1|4977591_4977939_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_050867726.1|4977988_4979524_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.5	1.0e-259
WP_000813432.1|4980482_4981085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001313064.1|4981178_4981457_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000221530.1|4982911_4983481_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_050867729.1|4983740_4984142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221623.1|4984129_4984537_+	hypothetical protein	NA	NA	NA	NA	NA
4985753:4985768	attL	TTTCAGGGAAATATCC	NA	NA	NA	NA
WP_072646465.1|4986851_4987886_-	phosphotriesterase	NA	NA	NA	NA	NA
WP_000739816.1|4987888_4988854_-	DMT family transporter	NA	NA	NA	NA	NA
WP_001066367.1|4988910_4989669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000667429.1|4989682_4990897_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000086499.1|4992440_4993841_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000262197.1|4994063_4995362_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000677248.1|4995420_4996140_-	amino acid racemase	NA	NA	NA	NA	NA
WP_000789106.1|4996479_4997379_+	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_139242114.1|4998505_4999102_-	MFS transporter	NA	NA	NA	NA	NA
WP_000705006.1|4999176_5000325_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	1.0e-51
WP_001198735.1|5000321_5000939_-	2-dehydro-3-deoxy-6-phosphogalactonate aldolase	NA	NA	NA	NA	NA
WP_001696788.1|5000922_5001801_-	2-dehydro-3-deoxygalactonokinase	NA	NA	NA	NA	NA
WP_000174305.1|5001797_5002487_-	D-galactonate utilization transcriptional regulator DgoR	NA	NA	NA	NA	NA
WP_085967273.1|5003682_5004895_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.8	2.6e-101
WP_100183881.1|5004911_5006185_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	1.4e-169
WP_000706914.1|5006451_5006586_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000194408.1|5009335_5010367_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_000671481.1|5010341_5011361_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_001094740.1|5011424_5012138_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.7	5.2e-17
WP_000849708.1|5015154_5015433_+	DUF5339 domain-containing protein	NA	NA	NA	NA	NA
WP_001033555.1|5015770_5016802_-	isoaspartyl peptidase/L-asparaginase	NA	NA	NA	NA	NA
WP_001333102.1|5017324_5017771_-	maturase	NA	NA	NA	NA	NA
WP_000598813.1|5018416_5019778_-	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
WP_000355772.1|5019774_5021031_-	peptidase T	NA	NA	NA	NA	NA
WP_000351505.1|5023451_5024786_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_072644966.1|5025273_5026320_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_072644965.1|5026913_5027639_-	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_000019449.1|5027822_5028803_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
WP_000973176.1|5029556_5030102_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_061357678.1|5030098_5030842_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_072644964.1|5030853_5031933_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986335.1|5031994_5032930_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011466.1|5033386_5034304_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_033810912.1|5034405_5035356_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_000532912.1|5037742_5038459_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|5038801_5040256_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_032249262.1|5040357_5041674_-	shikimate transporter	NA	NA	NA	NA	NA
WP_001347679.1|5043302_5050379_-	inverse autotransporter adhesin YeeJ	NA	NA	NA	NA	NA
WP_001302302.1|5050868_5051666_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533615.1|5051901_5052927_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
WP_000096344.1|5052926_5053130_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_040234786.1|5053188_5055630_-	exonuclease	NA	V5UQJ3	Shigella_phage	47.0	4.5e-113
WP_001070253.1|5055723_5055912_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854564.1|5055908_5056097_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|5056499_5056664_+	hypothetical protein	NA	NA	NA	NA	NA
5056545:5056560	attR	TTTCAGGGAAATATCC	NA	NA	NA	NA
WP_001171946.1|5056667_5056886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040235278.1|5057045_5057201_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_001397087.1|5057493_5057832_-	peptidase S24-like family protein	NA	H9C160	Pectobacterium_phage	30.7	2.5e-06
WP_000693883.1|5058450_5058876_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262356.1|5058947_5060018_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.4e-63
WP_001151221.1|5060058_5060481_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.2	9.7e-64
WP_000161640.1|5060627_5061437_-	hypothetical protein	NA	A0A0F7L9X0	Escherichia_phage	94.8	2.1e-155
WP_001557860.1|5061852_5061960_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_001013636.1|5062004_5062217_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_000737636.1|5062360_5062753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024175747.1|5063049_5063328_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	1.1e-12
WP_024195967.1|5063329_5064379_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.4e-108
WP_001217424.1|5064391_5064751_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	8.3e-40
WP_016240600.1|5064747_5065437_+	antitermination protein Q	NA	I6PDF8	Cronobacter_phage	50.2	2.6e-58
WP_000839572.1|5066233_5066449_+|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000193280.1|5066453_5066804_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.9e-37
WP_000992100.1|5066867_5067401_+	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
WP_001228684.1|5067617_5067803_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	78.0	2.7e-18
WP_001140099.1|5067907_5068258_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	1.2e-64
WP_001312917.1|5068405_5068888_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	4.3e-84
WP_001140903.1|5068887_5070645_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.7	0.0e+00
WP_000478564.1|5070656_5070839_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	95.0	2.5e-24
WP_000466255.1|5070838_5072080_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_001193631.1|5072057_5072708_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_072644981.1|5072722_5073928_+|capsid	phage major capsid protein	capsid	A0A1B5FPI9	Escherichia_phage	99.0	2.2e-222
WP_000601355.1|5073978_5074167_+	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	100.0	7.2e-27
WP_000983037.1|5074178_5074484_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	100.0	9.2e-40
WP_001147820.1|5074492_5074831_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	99.1	1.6e-56
WP_001312916.1|5074827_5075277_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.5	7.9e-64
WP_001209399.1|5075273_5075618_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	100.0	4.2e-57
WP_072644980.1|5075677_5076382_+|tail	phage tail protein	tail	A0A1B5FP82	Escherichia_phage	95.7	5.7e-117
WP_001312914.1|5076381_5076768_+|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.8e-64
WP_071590020.1|5076809_5077070_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.7	1.6e-40
WP_024257906.1|5077116_5080344_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
WP_001330090.1|5080321_5080678_+|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_001152459.1|5080677_5081376_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	96.1	1.7e-129
WP_032241748.1|5081380_5082124_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.7e-148
WP_000090949.1|5082060_5082663_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	2.6e-86
WP_072735910.1|5082723_5086119_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	90.4	0.0e+00
WP_001230352.1|5086189_5086789_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.3e-109
WP_072735909.1|5086853_5090252_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	34.5	1.2e-10
WP_072735908.1|5090251_5090833_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	1.0e-103
WP_112041176.1|5091447_5091675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001079062.1|5092323_5092854_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	99.1	5.5e-56
>prophage 1
NZ_CP024822	Escherichia coli strain CREC-591 plasmid pCREC-591_1, complete sequence	118156	73630	111739	118156	transposase,integrase	Escherichia_phage(54.55%)	37	69132:69146	103122:103136
69132:69146	attL	AGGCGACGAACACGA	NA	NA	NA	NA
WP_001139958.1|73630_74785_-|integrase	integrase	integrase	B5WZU7	Pseudomonas_phage	43.0	1.3e-46
WP_001302705.1|74912_75068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001349157.1|75975_76224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001417545.1|76220_77513_-	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
WP_001193554.1|77512_78169_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_000014116.1|78153_78714_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_000959785.1|78723_79338_-	pilus assembly protein PilX	NA	NA	NA	NA	NA
WP_001208805.1|79355_80453_-	pilus biosynthesis protein PilR	NA	NA	NA	NA	NA
WP_000362202.1|80465_82019_-	Flp pilus assembly complex ATPase component	NA	NA	NA	NA	NA
WP_001247334.1|82029_82482_-	type IV pilus biogenesis protein PilP	NA	NA	NA	NA	NA
WP_000752772.1|82468_83764_-	type 4b pilus protein PilO2	NA	NA	NA	NA	NA
WP_000748143.1|83756_85439_-	PilN family type IVB pilus formation outer membrane protein	NA	NA	NA	NA	NA
WP_000539807.1|85452_85890_-	type IV pilus biogenesis protein PilM	NA	NA	NA	NA	NA
WP_000494779.1|87579_87876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001136187.1|88051_88306_-	PilI type IV pilus biogenesis protein	NA	NA	NA	NA	NA
WP_000744644.1|88467_89019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001282653.1|89245_90001_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.8	6.2e-45
WP_023181050.1|90017_91553_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.7	6.6e-102
WP_000213859.1|91837_92521_-	conjugal transfer protein TraC	NA	NA	NA	NA	NA
WP_001372168.1|92774_93308_-	transcription termination factor NusG	NA	NA	NA	NA	NA
WP_000483804.1|93749_93986_-	conjugal transfer protein TraA	NA	NA	NA	NA	NA
WP_001324596.1|93954_94218_-	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	54.0	6.1e-08
WP_000907870.1|95190_96222_+	replication initiation protein	NA	NA	NA	NA	NA
WP_097291460.1|97188_97500_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2I6TCA4	Escherichia_phage	94.1	1.2e-47
WP_089576444.1|97496_97787_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	89.5	2.3e-40
WP_089576443.1|98151_98526_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_097291462.1|98535_99489_+	caspase family protein	NA	NA	NA	NA	NA
WP_001067855.1|101677_102382_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001137892.1|103162_103747_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
103122:103136	attR	TCGTGTTCGTCGCCT	NA	NA	NA	NA
WP_000004159.1|103746_104985_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|104981_105887_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|106008_106713_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014839980.1|107086_107503_+	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_014839979.1|107507_108026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839978.1|108025_108814_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|109313_110018_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|111034_111739_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
NZ_CP024824	Escherichia coli strain CREC-591 plasmid pCREC-591_3, complete sequence	62815	26560	53427	62815	integrase,transposase	Escherichia_phage(33.33%)	27	14249:14268	39431:39450
14249:14268	attL	CAAACTTTCACATGTGAAAG	NA	NA	NA	NA
WP_000543934.1|26560_27571_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_000949433.1|27573_28110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000243801.1|28408_28729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000278322.1|28959_29562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326394.1|30200_30641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001257735.1|30612_34866_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	47.6	1.1e-18
WP_000988731.1|34998_35724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|35961_36666_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000703827.1|37094_37367_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001207227.1|37415_38597_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
WP_001151304.1|38600_39386_-	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
WP_000338945.1|39559_39871_-	hypothetical protein	NA	NA	NA	NA	NA
39431:39450	attR	CAAACTTTCACATGTGAAAG	NA	NA	NA	NA
WP_001043260.1|40177_40993_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001082319.1|41053_41857_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|41856_42693_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000844627.1|42998_43241_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_021536379.1|43272_43950_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_032153701.1|44028_45228_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_001255015.1|45494_45800_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023300759.1|45827_47042_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_021598067.1|47258_48143_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001120888.1|48173_49667_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000743213.1|49877_50102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001366550.1|50098_50836_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001044210.1|51321_51462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|51467_52172_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|52722_53427_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
NZ_CP024825	Escherichia coli strain CREC-591 plasmid pCREC-591_4, complete sequence	46161	0	3308	46161	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_004199413.1|290_3308_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
>prophage 2
NZ_CP024825	Escherichia coli strain CREC-591 plasmid pCREC-591_4, complete sequence	46161	8472	12643	46161		Streptococcus_phage(33.33%)	3	NA	NA
WP_004199098.1|8472_10800_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	28.1	8.6e-37
WP_000517490.1|10803_12066_-	ATP-binding protein	NA	A0A1V0SKF8	Klosneuvirus	31.4	1.3e-07
WP_001215543.1|12148_12643_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.3	8.0e-17
>prophage 3
NZ_CP024825	Escherichia coli strain CREC-591 plasmid pCREC-591_4, complete sequence	46161	31274	31790	46161		Tupanvirus(100.0%)	1	NA	NA
WP_001025390.1|31274_31790_-	DnaJ domain-containing protein	NA	A0A2K9L588	Tupanvirus	39.8	3.3e-05
>prophage 4
NZ_CP024825	Escherichia coli strain CREC-591 plasmid pCREC-591_4, complete sequence	46161	36390	40843	46161	transposase	Burkholderia_phage(25.0%)	5	NA	NA
WP_000516402.1|36390_37053_-	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
WP_001549893.1|37433_38096_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
WP_000343760.1|38184_39405_-|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_001549892.1|39506_39746_+	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
WP_001067834.1|40138_40843_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
>prophage 5
NZ_CP024825	Escherichia coli strain CREC-591 plasmid pCREC-591_4, complete sequence	46161	44105	45122	46161	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_001310555.1|44105_45122_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
