The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	0	22901	5107874		Paramecium_bursaria_Chlorella_virus(100.0%)	11	NA	NA
WP_000048963.1|3221_3827_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_020233384.1|3880_5197_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_021523075.1|5186_6944_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000177498.1|7855_8461_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_001523206.1|8631_10938_-	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
WP_021523074.1|11001_11862_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_059321765.1|12069_14478_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001523200.1|18551_18875_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698145.1|18882_19068_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_020233705.1|19064_21704_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762229.1|21911_22901_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 2
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	27861	31896	5107874		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000837924.1|27861_28995_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001295593.1|29135_29570_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000286865.1|30154_31069_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_029702064.1|31068_31896_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	G9BWD6	Planktothrix_phage	28.5	3.8e-11
>prophage 3
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	35752	69172	5107874	tail,terminase,transposase,head,lysis,portal,capsid	Enterobacteria_phage(56.76%)	46	NA	NA
WP_001314683.1|35752_36793_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.9	2.9e-125
WP_000654155.1|36802_37084_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	1.4e-18
WP_042099016.1|37083_39459_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.0	1.8e-167
WP_001542091.1|39523_40123_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	9.8e-102
WP_021523093.1|40190_43670_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_049286672.1|43730_44333_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	8.1e-88
WP_032153655.1|44269_45013_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	9.5e-147
WP_001551186.1|45018_45717_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	8.9e-131
WP_000847345.1|45716_46046_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_032153656.1|46042_48604_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	95.9	0.0e+00
WP_000459457.1|48596_49031_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479153.1|49012_49435_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001349920.1|49450_50191_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000683128.1|50198_50594_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_000975070.1|50590_51169_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000752979.1|51180_51534_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_020233914.1|51545_51944_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	2.3e-62
WP_000063277.1|51985_53011_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.7	2.7e-192
WP_001708751.1|53065_53398_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_020233915.1|53407_54727_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	2.2e-231
WP_001356819.1|54707_56309_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
WP_000198149.1|56305_56512_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027269.1|56508_58434_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000453587.1|58408_58954_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001368374.1|59342_59576_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|59633_60044_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|60195_60369_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|60540_60696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|60775_60841_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|60843_61032_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|61042_61255_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|61617_62115_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|62111_62645_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|62641_62953_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|62957_63173_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000526135.1|63729_64188_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_000066484.1|64638_64854_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|65154_65367_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|65421_65511_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|65788_66541_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265199.1|66554_67604_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
WP_012304870.1|67605_67884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|67950_68202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|68418_68574_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|68645_68933_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|68932_69172_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
>prophage 4
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	74986	98679	5107874	transposase,integrase,lysis	Escherichia_phage(29.41%)	28	84736:84749	95486:95499
WP_001151242.1|74986_75385_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.9	7.7e-63
WP_000054487.1|75425_76391_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_000705355.1|76371_76893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000921596.1|76876_77104_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000381212.1|77184_77592_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000379575.1|77760_77916_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000344950.1|77917_78493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|78979_79168_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083276.1|79164_79356_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048363.1|79449_81921_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	1.2e-57
WP_001296941.1|82008_82245_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001339397.1|82315_82993_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|82992_83340_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_029392005.1|83359_84931_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
84736:84749	attL	GAAAAACTGGATGT	NA	NA	NA	NA
WP_021523105.1|84986_86267_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	3.9e-156
WP_001389342.1|86268_86397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836037.1|86454_87474_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|87485_88700_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_001314753.1|88905_89232_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.2e-23
WP_000705205.1|89366_89708_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|89742_90303_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001445899.1|90305_91016_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|91123_91429_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001551145.1|91627_94054_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
WP_072170800.1|94114_96538_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.5	3.7e-208
95486:95499	attR	GAAAAACTGGATGT	NA	NA	NA	NA
WP_001520568.1|96548_97166_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.1	2.5e-76
WP_020233477.1|97167_98022_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_001520571.1|98064_98679_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.8	4.3e-28
>prophage 5
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	116440	117742	5107874		Bacillus_phage(100.0%)	1	NA	NA
WP_001520578.1|116440_117742_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.6	4.2e-17
>prophage 6
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	127639	129451	5107874		Vaccinia_virus(100.0%)	1	NA	NA
WP_001520590.1|127639_129451_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.5	0.0e+00
>prophage 7
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	149356	150631	5107874	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|149356_150631_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 8
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	157546	159045	5107874		Salmonella_phage(50.0%)	2	NA	NA
WP_001296937.1|157546_158068_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
WP_000250656.1|158148_159045_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
>prophage 9
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	167848	176652	5107874		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101181.1|167848_168676_+	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|168803_169385_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_001520605.1|169530_170700_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|170865_170955_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|171253_172279_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000269493.1|172275_173208_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182362.1|173320_174532_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098886.1|174822_175971_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	7.2e-85
WP_000493947.1|176010_176652_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 10
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	182158	184425	5107874		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587571.1|182158_182971_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	6.5e-08
WP_020233101.1|182974_183760_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001309532.1|183756_184425_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.8	4.5e-23
>prophage 11
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	192715	197799	5107874		environmental_halophage(33.33%)	5	NA	NA
WP_001520612.1|192715_193936_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
WP_001520613.1|193932_195204_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948865.1|195178_195925_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	3.8e-10
WP_001314771.1|195934_197422_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367171.1|197430_197799_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	5.6e-15
>prophage 12
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	216390	235840	5107874	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_023144643.1|216390_218091_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	2.1e-32
WP_000069375.1|218147_220526_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000368046.1|220858_221692_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001520625.1|221848_222895_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.4	1.2e-83
WP_001270810.1|223026_223218_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_029701352.1|223221_224658_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001520627.1|224720_225434_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209784.1|225680_226145_-	endopeptidase	NA	A0A217EQL1	Bacillus_phage	35.3	8.6e-13
WP_000029466.1|226222_226972_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154187.1|226971_227523_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_001520628.1|227585_228566_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|228666_228966_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672359.1|228970_231358_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018588.1|231372_232356_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|232494_232539_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|232661_233018_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|233071_233269_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|233365_233908_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|233911_235840_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
>prophage 13
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	247129	249391	5107874		Tupanvirus(100.0%)	1	NA	NA
WP_001520636.1|247129_249391_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.8e-143
>prophage 14
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	255518	256346	5107874		Bacillus_virus(100.0%)	1	NA	NA
WP_000175037.1|255518_256346_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 15
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	263821	265042	5107874		Klosneuvirus(100.0%)	1	NA	NA
WP_000082004.1|263821_265042_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.3	2.5e-27
>prophage 16
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	271806	272460	5107874		Planktothrix_phage(100.0%)	1	NA	NA
WP_001520652.1|271806_272460_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.7	4.4e-15
>prophage 17
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	276849	278805	5107874		Streptococcus_phage(100.0%)	1	NA	NA
WP_021523123.1|276849_278805_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	2.4e-40
>prophage 18
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	283730	287816	5107874		Tupanvirus(50.0%)	4	NA	NA
WP_001135079.1|283730_284372_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	35.4	3.8e-19
WP_000438819.1|284464_285823_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719088.1|285940_286699_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000723698.1|286835_287816_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	1.0e-07
>prophage 19
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	296629	297484	5107874		Indivirus(100.0%)	1	NA	NA
WP_001520673.1|296629_297484_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.1e-10
>prophage 20
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	300803	305380	5107874		Bacillus_phage(100.0%)	3	NA	NA
WP_000219686.1|300803_302087_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000621404.1|302233_303709_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000766137.1|303889_305380_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 21
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	320126	328231	5107874	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|320126_321812_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_001520692.1|322016_322598_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220972.1|322636_323332_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|323389_325300_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_014639208.1|325431_325776_+	RidA family protein	NA	NA	NA	NA	NA
WP_001322969.1|326137_326497_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|326616_326796_-	YoaH family protein	NA	NA	NA	NA	NA
WP_001520695.1|326869_328231_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.7	1.8e-42
>prophage 22
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	332093	333650	5107874		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|332093_333650_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 23
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	339290	339500	5107874		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|339290_339500_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 24
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	345543	347592	5107874		Moraxella_phage(100.0%)	1	NA	NA
WP_001055785.1|345543_347592_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 25
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	355088	359558	5107874		Escherichia_phage(33.33%)	7	NA	NA
WP_001520704.1|355088_355745_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	2.8e-57
WP_001520705.1|356140_356482_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879330.1|356494_357367_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204705.1|357370_357745_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|357883_358114_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011653.1|358215_358872_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|358895_359558_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 26
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	367613	369089	5107874		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|367613_369089_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 27
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	373087	380154	5107874		Bacillus_virus(50.0%)	9	NA	NA
WP_001184045.1|373087_374410_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_011076428.1|374425_375358_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202987.1|375436_376192_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001520716.1|376188_376974_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568522.1|377123_378134_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|378142_378754_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072146566.1|378892_378958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001520719.1|379028_379631_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|379632_380154_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 28
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	384172	386223	5107874		Escherichia_coli_phage(50.0%)	3	NA	NA
WP_001563891.1|384172_384991_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	96.9	4.6e-70
WP_000252980.1|385043_385439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019591.1|385479_386223_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
>prophage 29
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	392707	394441	5107874	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025322.1|392707_394441_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
>prophage 30
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	398961	404605	5107874		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_000763867.1|398961_399351_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_100190771.1|399365_400415_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204344.1|400417_401278_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483203.1|401296_402898_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.3	1.6e-13
WP_001306742.1|402943_404605_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
>prophage 31
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	414693	416208	5107874		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001187819.1|414693_416208_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 32
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	428897	429650	5107874		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|428897_429650_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 33
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	441655	442911	5107874	transposase	uncultured_Caudovirales_phage(33.33%)	3	NA	NA
WP_000334576.1|441655_442153_+	hypothetical protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	65.2	5.9e-52
WP_001336494.1|442034_442364_-	helix-turn-helix domain-containing protein	NA	A0A1B0VCD8	Salmonella_phage	86.6	8.1e-42
WP_001347174.1|442386_442911_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.0	2.2e-33
>prophage 34
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	458894	469094	5107874		Bacillus_phage(40.0%)	8	NA	NA
WP_020233536.1|458894_460589_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|460826_461009_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922682.1|461087_462005_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212225.1|462177_463098_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000228683.1|463086_463557_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	49.0	1.8e-34
WP_001157256.1|463537_464956_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	4.0e-101
WP_000826783.1|467064_468423_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	19.4	5.1e-05
WP_001339045.1|468422_469094_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
>prophage 35
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	477997	498592	5107874		Bacillus_phage(50.0%)	5	NA	NA
WP_001334858.1|477997_479800_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
WP_000098398.1|479786_481589_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.6	1.4e-31
WP_000970688.1|481755_482715_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_000623056.1|482905_489013_+	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	4.0e-33
WP_000369516.1|489100_498592_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
>prophage 36
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	534724	536526	5107874	transposase	Escherichia_phage(100.0%)	2	NA	NA
WP_001300609.1|534724_535507_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	2.0e-139
WP_000255926.1|535503_536526_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	7.0e-201
>prophage 37
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	546304	548463	5107874		Yersinia_phage(33.33%)	4	NA	NA
WP_021523139.1|546304_547126_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	8.0e-46
WP_001703514.1|547207_547687_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	6.8e-13
WP_001186773.1|547702_548179_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|548241_548463_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 38
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	552804	553971	5107874		Stx2-converting_phage(100.0%)	1	NA	NA
WP_021523140.1|552804_553971_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.0	4.2e-226
>prophage 39
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	561615	562515	5107874		Cellulophaga_phage(100.0%)	1	NA	NA
WP_021523143.1|561615_562515_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 40
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	569869	577278	5107874	transposase	Paramecium_bursaria_Chlorella_virus(25.0%)	7	NA	NA
WP_021523146.1|569869_571036_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.4	1.3e-110
WP_000526135.1|571338_571797_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_021523147.1|571996_573403_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	4.7e-38
WP_021523148.1|573497_574517_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	49.5	1.5e-89
WP_032142977.1|574555_575266_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_021523150.1|575296_576349_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_021523151.1|576345_577278_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	37.3	2.4e-14
>prophage 41
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	580664	588182	5107874		Escherichia_phage(42.86%)	7	NA	NA
WP_021523155.1|580664_581213_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	4.4e-48
WP_021523156.1|581217_582096_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	64.5	1.9e-106
WP_021523157.1|582153_583053_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.1	1.7e-28
WP_001515524.1|583052_584138_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.3e-101
WP_021523158.1|584509_585403_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_021523159.1|585634_586630_-	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.0	2.5e-09
WP_021523160.1|586787_588182_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	9.8e-20
>prophage 42
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	593974	600768	5107874		Bacillus_phage(25.0%)	6	NA	NA
WP_021523164.1|593974_595345_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	1.7e-32
WP_000079285.1|595537_596974_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.3e-46
WP_021523165.1|596976_598200_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_024166508.1|598196_598676_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_021523167.1|598675_599644_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.5	3.8e-87
WP_000048190.1|599646_600768_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 43
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	605011	615402	5107874		uncultured_marine_virus(20.0%)	8	NA	NA
WP_000654503.1|605011_605851_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
WP_021523170.1|605943_608106_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482901.1|608108_608552_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|608557_609697_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_021523171.1|610355_611939_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_021523172.1|612212_614066_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234777.1|614087_614669_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.8e-31
WP_001295424.1|614760_615402_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 44
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	620065	621418	5107874		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001520814.1|620065_621418_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	7.1e-07
>prophage 45
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	635587	699963	5107874	tail,terminase,lysis,head,integrase,holin,portal,capsid,plate,tRNA	Escherichia_phage(40.0%)	71	639876:639902	672755:672781
WP_000675148.1|635587_636991_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	2.7e-33
WP_000137877.1|636987_637710_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|637889_638222_+	YegP family protein	NA	NA	NA	NA	NA
WP_001520824.1|638369_639731_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.2	1.6e-216
639876:639902	attL	AATCTCCCTTACACGGGCTTATTTTTT	NA	NA	NA	NA
WP_000468308.1|640003_640222_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882966.1|640303_641467_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	1.8e-205
WP_001565024.1|641466_641946_-|tail	phage tail protein	tail	O64315	Escherichia_phage	98.1	9.6e-84
WP_021523174.1|641960_644408_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.7	0.0e+00
WP_000785970.1|644400_644520_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_020233494.1|644552_644828_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001251412.1|644884_645403_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	3.2e-93
WP_020233495.1|645415_646606_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	9.0e-224
WP_032142943.1|646935_647529_-	hypothetical protein	NA	Q858S7	Enterobacteria_phage	99.0	1.0e-106
WP_021523177.1|647750_648278_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	92.6	4.9e-89
WP_021523178.1|648279_650301_-|tail	tail fiber protein	tail	A0A0A7NV63	Enterobacteria_phage	64.5	2.7e-260
WP_001285325.1|650311_650842_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_001121453.1|650834_651743_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	4.4e-162
WP_000127164.1|651747_652095_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_020233499.1|652091_652727_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.5	1.2e-113
WP_021523179.1|652810_653596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001001802.1|653667_654120_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.0	1.5e-75
WP_000917186.1|654112_654580_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	2.5e-81
WP_072174950.1|654542_654716_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	91.2	9.8e-23
WP_001512906.1|654687_655113_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	98.6	1.9e-67
WP_000736608.1|655100_655526_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	95.7	2.3e-57
WP_001144101.1|655540_656038_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|656037_656319_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846399.1|656322_656526_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988636.1|656525_657035_-|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	100.0	8.6e-91
WP_000203455.1|657134_657878_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LDU4	Escherichia_phage	99.2	3.0e-124
WP_020233501.1|657881_658955_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.2	2.5e-201
WP_020233502.1|659013_659868_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	98.2	8.1e-134
WP_000156847.1|660041_661814_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	100.0	0.0e+00
WP_001533791.1|661813_662848_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	2.7e-200
WP_029401227.1|663234_664659_+	histidine kinase	NA	NA	NA	NA	NA
WP_029401228.1|664655_665648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029401229.1|665598_666750_-	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	31.2	1.4e-32
WP_029701698.1|669085_669361_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	1.5e-44
WP_029701699.1|669357_669582_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	98.6	3.8e-35
WP_001754915.1|669581_669884_-	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	100.0	3.5e-47
WP_000557703.1|669883_670108_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_029701701.1|670171_670672_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	98.8	1.9e-90
WP_029701703.1|670849_671125_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	98.9	2.2e-48
WP_000020919.1|671246_671546_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_000985261.1|671661_672675_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
WP_001303579.1|672951_673269_-	hypothetical protein	NA	NA	NA	NA	NA
672755:672781	attR	AATCTCCCTTACACGGGCTTATTTTTT	NA	NA	NA	NA
WP_000807371.1|673683_674583_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	4.8e-12
WP_000178552.1|674664_675444_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_001520826.1|675543_676584_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490663.1|676631_677987_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000823282.1|677990_678275_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182900.1|678305_678758_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_001308759.1|680053_680908_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|681137_682190_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858471.1|682446_683724_+	MFS transporter	NA	NA	NA	NA	NA
WP_001520828.1|683720_684725_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.7	4.4e-14
WP_001520829.1|684721_685687_+	kinase	NA	NA	NA	NA	NA
WP_000434044.1|685660_686407_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020233504.1|686458_687277_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.1e-23
WP_000822277.1|687341_688142_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195594.1|688138_688927_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|689149_689422_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134572.1|689542_690367_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153067.1|690585_690924_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000702203.1|691005_692040_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_001520833.1|692055_694536_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677340.1|694551_695226_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830468.1|695306_695849_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001328276.1|696144_696426_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|696688_697798_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001520834.1|697929_699963_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.3	2.3e-54
>prophage 46
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	711402	720845	5107874		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001520842.1|711402_712539_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	2.5e-162
WP_021523183.1|712535_714536_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001295429.1|714660_715122_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|715163_715634_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|715680_716400_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001309587.1|716396_718082_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
WP_001240398.1|718303_719035_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001216963.1|719094_719202_+	protein YohO	NA	NA	NA	NA	NA
WP_000783145.1|719182_719914_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569374.1|719918_720845_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 47
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	741099	742620	5107874		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255032.1|741099_742620_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 48
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	746314	750087	5107874		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|746314_746983_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_021517208.1|747240_748077_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001578658.1|748107_750087_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	1.9e-13
>prophage 49
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	754155	755013	5107874		Catovirus(100.0%)	1	NA	NA
WP_000873880.1|754155_755013_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	35.0	3.1e-24
>prophage 50
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	769507	773808	5107874		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_001520864.1|769507_770974_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.8	1.1e-42
WP_001520865.1|771091_772078_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_001297918.1|772116_772830_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|773241_773808_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 51
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	779562	787211	5107874		Vibrio_phage(50.0%)	7	NA	NA
WP_000194914.1|779562_781152_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
WP_000202798.1|781155_781500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001595981.1|781832_783023_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	3.8e-20
WP_001234850.1|783050_783746_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578079.1|783895_785656_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_000494186.1|785780_786065_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_020233566.1|786203_787211_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	2.0e-83
>prophage 52
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	798908	799526	5107874		Bacillus_virus(100.0%)	1	NA	NA
WP_001328413.1|798908_799526_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 53
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	808292	814061	5107874		Bacillus_phage(25.0%)	5	NA	NA
WP_000422190.1|808292_809936_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.6	2.8e-13
WP_000884972.1|810011_810662_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000786358.1|810661_811726_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406118.1|811799_812855_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865539.1|812966_814061_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.2	2.0e-116
>prophage 54
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	818224	823067	5107874		Hokovirus(50.0%)	2	NA	NA
WP_001520877.1|818224_821074_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.9	4.9e-42
WP_000559127.1|821240_823067_+	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	27.3	4.4e-20
>prophage 55
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	837990	849817	5107874		Pseudomonas_phage(40.0%)	6	NA	NA
WP_029701249.1|837990_840618_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.3	4.2e-88
WP_000990765.1|840764_841487_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_021517215.1|841547_845306_-	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	26.7	7.7e-19
WP_001075170.1|846001_848287_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_000332037.1|848432_849563_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
WP_021523189.1|849562_849817_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	63.1	1.5e-24
>prophage 56
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	852863	853940	5107874		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000779071.1|852863_853940_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.9e-08
>prophage 57
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	859832	864390	5107874	transposase	Sodalis_phage(50.0%)	4	NA	NA
WP_000140566.1|859832_860792_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.1e-69
WP_000992991.1|861018_861822_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_001328560.1|861838_863128_-	MFS transporter	NA	NA	NA	NA	NA
WP_021523190.1|863184_864390_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.2e-26
>prophage 58
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	867992	872996	5107874		Tupanvirus(50.0%)	4	NA	NA
WP_001306469.1|867992_868595_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	4.4e-09
WP_024166496.1|868902_870042_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	30.1	2.2e-30
WP_000461642.1|870045_871014_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	4.0e-36
WP_001551384.1|871013_872996_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.1e-19
>prophage 59
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	907804	911032	5107874		Salmonella_phage(50.0%)	3	NA	NA
WP_000813860.1|907804_908404_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012889.1|908462_910295_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203403.1|910381_911032_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.5	2.8e-09
>prophage 60
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	921595	923468	5107874		Sodalis_phage(50.0%)	2	NA	NA
WP_001520932.1|921595_922498_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	44.2	2.4e-67
WP_001293612.1|922694_923468_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 61
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	927679	929197	5107874		Mollivirus(100.0%)	1	NA	NA
WP_000334221.1|927679_929197_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
>prophage 62
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	935661	936798	5107874		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699144.1|935661_936798_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	2.0e-23
>prophage 63
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	945280	946366	5107874		Pandoravirus(100.0%)	1	NA	NA
WP_001297933.1|945280_946366_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
>prophage 64
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	964389	968019	5107874	integrase	Enterobacteria_phage(33.33%)	4	965450:965472	975758:975780
WP_000368131.1|964389_965322_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
965450:965472	attL	TTCGATTCCTGCAGGGGACACCA	NA	NA	NA	NA
WP_001535474.1|965636_966923_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	37.3	1.1e-65
WP_001706457.1|966924_967671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000749077.1|967827_968019_+	AlpA family transcriptional regulator	NA	E5E3Y1	Burkholderia_phage	49.0	4.2e-06
975758:975780	attR	TTCGATTCCTGCAGGGGACACCA	NA	NA	NA	NA
>prophage 65
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	974996	975623	5107874		Clostridium_phage(100.0%)	1	NA	NA
WP_001102877.1|974996_975623_+	recombinase family protein	NA	A0A0A8WJD4	Clostridium_phage	28.7	1.0e-08
>prophage 66
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	978668	980102	5107874		Bacillus_phage(100.0%)	1	NA	NA
WP_001520960.1|978668_980102_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.0	4.1e-29
>prophage 67
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	986755	994331	5107874		Bacillus_phage(50.0%)	4	NA	NA
WP_021523193.1|986755_990349_+	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	6.2e-10
WP_020233686.1|990404_991550_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|991623_992568_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283480.1|992636_994331_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.8	8.0e-24
>prophage 68
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	998021	998942	5107874		Morganella_phage(100.0%)	1	NA	NA
WP_000484013.1|998021_998942_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	6.4e-76
>prophage 69
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1002760	1003495	5107874		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|1002760_1003495_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 70
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1029191	1044573	5107874		Streptococcus_phage(33.33%)	15	NA	NA
WP_001520978.1|1029191_1031207_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	3.8e-150
WP_001520979.1|1031277_1032276_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254839.1|1032505_1033267_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|1033451_1034423_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|1034806_1035064_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623136.1|1035108_1036836_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522247.1|1036876_1037386_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096660.1|1037427_1038279_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_029701317.1|1038383_1038752_+	YfeK family protein	NA	NA	NA	NA	NA
WP_001306253.1|1038754_1039666_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.3	2.9e-57
WP_000021036.1|1039799_1040897_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_000852686.1|1040886_1041762_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458420.1|1041761_1042595_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290240.1|1042594_1043611_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000517443.1|1043781_1044573_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	6.8e-18
>prophage 71
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1048051	1054409	5107874	transposase	Mycobacterium_phage(33.33%)	8	NA	NA
WP_020233887.1|1048051_1049353_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
WP_000526135.1|1049463_1049922_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_000084590.1|1050121_1051021_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000526135.1|1051144_1051603_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_001520984.1|1051828_1052404_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001296281.1|1052464_1052914_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|1052900_1053326_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_021523195.1|1053539_1054409_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
>prophage 72
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1073016	1073967	5107874		Cyanophage(100.0%)	1	NA	NA
WP_001003734.1|1073016_1073967_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 73
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1091234	1091948	5107874		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|1091234_1091948_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 74
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1113215	1117217	5107874		Enterobacteria_phage(33.33%)	4	NA	NA
WP_001309646.1|1113215_1114505_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.1	6.6e-63
WP_001295473.1|1114590_1115217_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295474.1|1115541_1116579_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_020233339.1|1116578_1117217_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.3	1.2e-28
>prophage 75
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1123651	1129954	5107874		Escherichia_phage(60.0%)	6	NA	NA
WP_001344399.1|1123651_1123825_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
WP_000669412.1|1124138_1124654_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_001521044.1|1124669_1125209_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	96.6	1.6e-42
WP_000138282.1|1125303_1126881_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001296289.1|1126949_1128416_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
WP_021551967.1|1128577_1129954_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	5.3e-42
>prophage 76
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1150422	1150854	5107874		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|1150422_1150854_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 77
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1160980	1167318	5107874		Mycoplasma_phage(20.0%)	8	NA	NA
WP_001521059.1|1160980_1162264_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	1.7e-34
WP_000523616.1|1162322_1162523_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124471.1|1162534_1162870_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196617.1|1162871_1164722_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_001357290.1|1164738_1165254_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|1165349_1165673_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|1165689_1166076_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|1166103_1167318_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 78
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1182454	1183966	5107874		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001521073.1|1182454_1183966_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
>prophage 79
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1189724	1201014	5107874		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|1189724_1190978_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_001521077.1|1191306_1192497_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|1192541_1192880_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001298983.1|1192940_1194275_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001590522.1|1194264_1194978_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001309666.1|1195142_1196570_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	2.3e-16
WP_021523225.1|1197126_1201014_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	1.0e-130
>prophage 80
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1205133	1205394	5107874		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196285.1|1205133_1205394_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	8.4e-18
>prophage 81
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1208853	1212596	5107874		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|1208853_1209534_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|1209806_1210781_-	signal peptidase I	NA	NA	NA	NA	NA
WP_001521085.1|1210796_1212596_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 82
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1218367	1224456	5107874	tRNA	Cafeteria_roenbergensis_virus(25.0%)	7	NA	NA
WP_000219193.1|1218367_1219702_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001521087.1|1219734_1220616_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001521088.1|1220718_1221306_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|1221367_1221751_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262721.1|1222055_1222745_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	9.3e-56
WP_001521090.1|1222792_1223830_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|1224036_1224456_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 83
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1229749	1232705	5107874	transposase	Burkholderia_virus(50.0%)	2	NA	NA
WP_000841103.1|1229749_1231048_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_100190661.1|1231356_1232705_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.1	5.1e-74
>prophage 84
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1238285	1240859	5107874		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|1238285_1240859_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 85
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1246765	1247836	5107874		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168045.1|1246765_1247836_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 86
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1261582	1262065	5107874		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001520337.1|1261582_1262065_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	5.2e-29
>prophage 87
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1277496	1281548	5107874		Klosneuvirus(50.0%)	4	NA	NA
WP_000097652.1|1277496_1278777_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.9	2.1e-32
WP_001295173.1|1279014_1280415_+	GABA permease	NA	NA	NA	NA	NA
WP_000156814.1|1280435_1281098_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522417.1|1281098_1281548_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.6e-06
>prophage 88
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1285482	1290678	5107874		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|1285482_1285728_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_001521113.1|1285724_1286126_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	3.4e-18
WP_100190774.1|1286107_1288150_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	47.0	2.2e-185
WP_001521117.1|1288159_1289119_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	7.0e-134
WP_000985494.1|1289475_1290678_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 89
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1303723	1309110	5107874	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|1303723_1303909_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047170.1|1304143_1306774_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140506.1|1306902_1307403_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|1307471_1308533_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132231.1|1308612_1309110_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 90
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1314577	1315543	5107874		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287415.1|1314577_1315543_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 91
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1322956	1323970	5107874		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001521133.1|1322956_1323970_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	1.3e-26
>prophage 92
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1343075	1350215	5107874		Escherichia_phage(83.33%)	6	NA	NA
WP_001272917.1|1343075_1345637_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	9.2e-32
WP_001141345.1|1345742_1346399_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
WP_001295181.1|1346449_1347217_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_000847993.1|1347412_1348321_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.1e-117
WP_001521147.1|1348317_1349580_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|1349576_1350215_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 93
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1355429	1359145	5107874		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000081550.1|1355429_1356422_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|1356484_1357624_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|1357763_1358390_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|1358383_1359145_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 94
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1362257	1364290	5107874		Tupanvirus(50.0%)	2	NA	NA
WP_001173673.1|1362257_1362863_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
WP_001090361.1|1362862_1364290_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
>prophage 95
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1383744	1385092	5107874	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_100190663.1|1383744_1385092_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	5.1e-74
>prophage 96
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1389761	1390547	5107874		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_021523232.1|1389761_1390547_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	8.5e-21
>prophage 97
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1394957	1399877	5107874		Vibrio_phage(33.33%)	4	NA	NA
WP_001199973.1|1394957_1395629_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
WP_020232912.1|1395922_1396795_+	YgcG family protein	NA	NA	NA	NA	NA
WP_000036723.1|1396854_1398153_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|1398239_1399877_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 98
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1403910	1410957	5107874		Erysipelothrix_phage(33.33%)	4	NA	NA
WP_001521172.1|1403910_1405212_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.4	1.5e-38
WP_000186450.1|1405268_1408025_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
WP_000098243.1|1408255_1409596_-	glucarate dehydratase	NA	NA	NA	NA	NA
WP_001521173.1|1409616_1410957_-	glucarate dehydratase-related protein	NA	Q6A202	Oenococcus_phage	23.8	3.5e-06
>prophage 99
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1415558	1416407	5107874		Vibrio_phage(100.0%)	1	NA	NA
WP_029701940.1|1415558_1416407_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	6.1e-41
>prophage 100
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1421265	1422021	5107874		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|1421265_1422021_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 101
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1428738	1430238	5107874		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000004944.1|1428738_1430238_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.6	4.3e-21
>prophage 102
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1438460	1454008	5107874	tRNA	Bacillus_phage(33.33%)	9	NA	NA
WP_001300698.1|1438460_1439666_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	3.0e-73
WP_000184261.1|1439665_1440109_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117728.1|1440159_1440966_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000678646.1|1441204_1442302_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000016907.1|1442880_1444134_-	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237947.1|1444365_1445697_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775931.1|1445758_1447585_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.7	3.5e-25
WP_001460029.1|1447584_1451127_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.9	1.2e-08
WP_001138156.1|1451119_1454008_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	5.3e-68
>prophage 103
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1459485	1466258	5107874		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|1459485_1460280_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|1460286_1461162_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_029701934.1|1461312_1463559_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|1463571_1464102_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082201.1|1464786_1465476_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|1465544_1466258_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 104
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1475890	1478385	5107874		Aichi_virus(50.0%)	2	NA	NA
WP_000256438.1|1475890_1477309_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603518.1|1477623_1478385_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 105
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1485395	1495677	5107874	tRNA	Microcystis_virus(16.67%)	10	NA	NA
WP_029701928.1|1485395_1486151_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A7K9	Microcystis_virus	40.6	2.9e-10
WP_001295374.1|1487302_1488751_+	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001010156.1|1488752_1488878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|1488874_1488946_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192815.1|1489000_1489549_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003068.1|1489591_1491109_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|1491118_1492217_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_029701971.1|1492307_1494041_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	3.2e-60
WP_029701969.1|1494046_1494757_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|1494780_1495677_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 106
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1499482	1504856	5107874		Pandoravirus(50.0%)	3	NA	NA
WP_001336277.1|1499482_1500916_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.3	2.0e-31
WP_000951964.1|1500972_1501716_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_032153694.1|1501982_1504856_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	52.0	2.8e-263
>prophage 107
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1512991	1514224	5107874		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|1512991_1514224_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 108
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1542519	1543674	5107874		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|1542519_1543674_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 109
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1566458	1567721	5107874	integrase	Pseudomonas_phage(100.0%)	1	1557123:1557137	1573447:1573461
1557123:1557137	attL	CTCCTGAACGATAAT	NA	NA	NA	NA
WP_001218875.1|1566458_1567721_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.6	2.2e-79
WP_001218875.1|1566458_1567721_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.6	2.2e-79
1573447:1573461	attR	ATTATCGTTCAGGAG	NA	NA	NA	NA
>prophage 110
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1586958	1588593	5107874		Rhizobium_phage(100.0%)	1	NA	NA
WP_000041168.1|1586958_1588593_-	DNA phosphorothioation system sulfurtransferase DndC	NA	R9TRT5	Rhizobium_phage	27.9	6.1e-21
>prophage 111
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1604831	1607026	5107874		Yersinia_phage(33.33%)	4	NA	NA
WP_001175175.1|1604831_1605650_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	6.7e-45
WP_000213722.1|1605741_1606227_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	1.2e-12
WP_001384029.1|1606241_1606718_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692350.1|1606804_1607026_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
>prophage 112
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1610611	1611595	5107874		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001298261.1|1610611_1611595_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.4	1.4e-36
>prophage 113
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1623943	1625183	5107874		Hokovirus(50.0%)	2	NA	NA
WP_001542355.1|1623943_1624339_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.7	2.5e-29
WP_029701466.1|1624508_1625183_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	7.1e-08
>prophage 114
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1657866	1659039	5107874		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524970.1|1657866_1659039_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	5.5e-40
>prophage 115
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1681251	1682136	5107874		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018760.1|1681251_1682136_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 116
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1688212	1697563	5107874		Staphylococcus_phage(33.33%)	7	NA	NA
WP_000013149.1|1688212_1689040_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
WP_000691628.1|1689239_1690166_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848528.1|1690216_1690474_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095187.1|1690516_1692736_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000059388.1|1692846_1694259_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965722.1|1694333_1695071_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_001281841.1|1695304_1697563_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.8e-84
>prophage 117
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1700873	1701266	5107874		Stx_converting_phage(100.0%)	1	NA	NA
WP_000712658.1|1700873_1701266_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 118
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1705093	1716056	5107874		Bacillus_virus(20.0%)	12	NA	NA
WP_000195292.1|1705093_1706986_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.9	7.6e-92
WP_000105733.1|1707014_1707596_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444747.1|1707595_1708423_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|1708447_1708870_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|1708870_1709500_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735278.1|1709704_1711186_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|1711333_1712005_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442860.1|1712010_1713171_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000188362.1|1713208_1714024_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_001295627.1|1714139_1714913_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000469266.1|1714970_1715141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076997.1|1715402_1716056_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 119
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1725573	1727007	5107874		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|1725573_1727007_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 120
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1732144	1733383	5107874	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708491.1|1732144_1733383_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	7.7e-93
>prophage 121
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1739685	1755823	5107874	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264352.1|1739685_1740699_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
WP_001144069.1|1740936_1741152_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918837.1|1741262_1743008_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.2	2.4e-76
WP_000437371.1|1743202_1745044_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|1745122_1745629_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_029701451.1|1745882_1746647_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018005.1|1746923_1747547_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000094730.1|1747653_1749174_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
WP_000633385.1|1749480_1750971_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	2.4e-32
WP_000450588.1|1751012_1751345_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212458.1|1751563_1752547_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_021523277.1|1752730_1755823_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.2	3.4e-158
>prophage 122
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1767540	1768506	5107874		Escherichia_phage(100.0%)	1	NA	NA
WP_001098805.1|1767540_1768506_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 123
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1790066	1792361	5107874		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861720.1|1790066_1792361_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	1.7e-157
>prophage 124
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1800344	1801490	5107874		Streptococcus_phage(100.0%)	1	NA	NA
WP_001521378.1|1800344_1801490_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	42.0	5.2e-51
>prophage 125
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1819111	1826906	5107874		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809258.1|1819111_1819975_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.6e-50
WP_001521387.1|1820039_1822076_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_001521388.1|1822033_1822429_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158035.1|1822448_1823039_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646047.1|1823048_1823624_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001521390.1|1823736_1824777_-	permease	NA	NA	NA	NA	NA
WP_000084526.1|1824849_1825485_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037605.1|1825612_1826131_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	5.8e-10
WP_001521391.1|1826110_1826554_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189309.1|1826603_1826906_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	6.6e-14
>prophage 126
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1832608	1834498	5107874		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|1832608_1834498_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 127
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1839974	1846613	5107874		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133044.1|1839974_1842647_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031055.1|1842671_1844159_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|1844186_1844639_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207680.1|1845269_1846613_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 128
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1850693	1853566	5107874	protease	Pandoravirus(50.0%)	2	NA	NA
WP_001603854.1|1850693_1851542_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|1851631_1853566_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 129
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1860194	1861672	5107874		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|1860194_1861166_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445407.1|1861393_1861672_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	3.4e-17
>prophage 130
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1865740	1880534	5107874		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|1865740_1866550_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922873.1|1866759_1867737_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|1867750_1868737_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030006.1|1868757_1869324_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.5	6.5e-55
WP_000030537.1|1869320_1869896_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|1869864_1870422_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|1870428_1871154_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|1871201_1872635_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|1872657_1872945_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183676.1|1873062_1873554_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|1873599_1874454_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|1874450_1874723_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620396.1|1874935_1875568_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_020233285.1|1875564_1876293_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001300411.1|1876289_1876943_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_020233286.1|1877172_1879509_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.1	5.8e-41
WP_001521402.1|1879604_1880534_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 131
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1887283	1892016	5107874		Salmonella_phage(50.0%)	5	NA	NA
WP_001521407.1|1887283_1888396_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	4.7e-73
WP_000979887.1|1888455_1888920_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000209000.1|1888916_1889792_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000054239.1|1889788_1890478_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_001521408.1|1890525_1892016_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.9	3.7e-09
>prophage 132
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1895721	1896219	5107874	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366126.1|1895721_1896219_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
>prophage 133
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1900185	1902710	5107874	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001295271.1|1900185_1901553_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497723.1|1901642_1902710_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 134
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1919206	1920250	5107874		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|1919206_1920250_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 135
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1930815	1931700	5107874		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258942.1|1930815_1931700_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	29.8	1.6e-23
>prophage 136
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1938204	1942358	5107874		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738579.1|1938204_1939230_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
WP_000019674.1|1939297_1940479_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001308990.1|1940488_1941592_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078344.1|1941599_1942358_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
>prophage 137
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1952866	1954338	5107874	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|1952866_1953376_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004456.1|1953390_1954338_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 138
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1974215	1979789	5107874		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_000031783.1|1974215_1975400_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124703.1|1975470_1977585_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.7	1.1e-57
WP_001138043.1|1977681_1978152_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|1978248_1978623_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903377.1|1978748_1979036_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820714.1|1979043_1979403_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_001209690.1|1979402_1979789_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.1	3.3e-18
>prophage 139
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	1985359	1994900	5107874		Tupanvirus(25.0%)	9	NA	NA
WP_020232893.1|1985359_1987273_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	1.5e-74
WP_001521449.1|1987272_1988295_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|1988288_1988507_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274680.1|1988560_1989430_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|1989484_1989889_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|1990190_1990823_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001295162.1|1990873_1992964_+	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000963771.1|1993030_1994251_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_001521451.1|1994336_1994900_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	1.3e-60
>prophage 140
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2013805	2014642	5107874		Vibrio_phage(100.0%)	1	NA	NA
WP_000742141.1|2013805_2014642_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 141
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2031548	2036060	5107874		Bacillus_phage(66.67%)	5	NA	NA
WP_001521469.1|2031548_2033171_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.3	1.2e-141
WP_000493756.1|2033287_2033605_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000650973.1|2033663_2033960_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001253707.1|2033991_2035344_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	4.7e-11
WP_001157751.1|2035340_2036060_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 142
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2042625	2043519	5107874		Sodalis_phage(100.0%)	1	NA	NA
WP_000039100.1|2042625_2043519_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.5e-69
>prophage 143
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2049679	2052073	5107874		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_001521478.1|2049679_2052073_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 144
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2056463	2057690	5107874		Ralstonia_phage(100.0%)	1	NA	NA
WP_001521480.1|2056463_2057690_-	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	60.2	8.9e-134
>prophage 145
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2066292	2068740	5107874		Dickeya_phage(100.0%)	1	NA	NA
WP_000993442.1|2066292_2068740_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 146
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2088750	2090561	5107874		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073586.1|2088750_2089494_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	24.9	9.9e-11
WP_000907822.1|2089490_2090561_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 147
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2094103	2095586	5107874		Planktothrix_phage(50.0%)	2	NA	NA
WP_001521501.1|2094103_2094817_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	30.6	2.0e-13
WP_000082101.1|2094818_2095586_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 148
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2101321	2104140	5107874		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|2101321_2102176_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|2102420_2103479_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|2103471_2104140_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 149
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2107146	2111279	5107874		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|2107146_2107773_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_001521507.1|2107846_2110045_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.5	1.9e-118
WP_000130615.1|2110147_2110393_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100467.1|2110613_2111279_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
>prophage 150
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2119172	2124775	5107874		Bacillus_virus(50.0%)	3	NA	NA
WP_001521512.1|2119172_2119979_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	5.9e-17
WP_001190062.1|2119983_2120385_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_048237751.1|2120587_2124775_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	43.8	7.5e-23
>prophage 151
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2128716	2129376	5107874		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_042045864.1|2128716_2129376_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	37.8	1.1e-24
>prophage 152
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2132986	2135722	5107874		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001586382.1|2132986_2135722_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 153
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2149132	2151175	5107874		Indivirus(100.0%)	1	NA	NA
WP_001298719.1|2149132_2151175_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	6.8e-46
>prophage 154
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2154523	2156659	5107874		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000008965.1|2154523_2154877_+	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	1.3e-24
WP_001328189.1|2154931_2156221_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	2.3e-172
WP_000065800.1|2156233_2156659_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	2.5e-51
>prophage 155
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2169727	2171197	5107874		Pithovirus(50.0%)	2	NA	NA
WP_001521540.1|2169727_2170498_+	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.6	2.3e-18
WP_001296814.1|2170549_2171197_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 156
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2217698	2219683	5107874		Bacillus_virus(50.0%)	2	NA	NA
WP_000103574.1|2217698_2218703_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
WP_001196487.1|2218699_2219683_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
>prophage 157
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2229624	2231958	5107874		Escherichia_phage(100.0%)	1	NA	NA
WP_001521567.1|2229624_2231958_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.4	7.0e-71
>prophage 158
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2235612	2238029	5107874	transposase	Morganella_phage(50.0%)	4	NA	NA
WP_000014594.1|2235612_2235825_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
WP_001521571.1|2235878_2236250_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_001135727.1|2236405_2236558_-	type I toxin-antitoxin system toxin HokA	NA	NA	NA	NA	NA
WP_085947770.1|2236659_2238029_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
>prophage 159
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2241894	2242890	5107874		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182662.1|2241894_2242890_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.8	1.6e-11
>prophage 160
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2248207	2249749	5107874		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001521578.1|2248207_2249749_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 161
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2278209	2280054	5107874		Tupanvirus(100.0%)	1	NA	NA
WP_020233168.1|2278209_2280054_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.5e-15
>prophage 162
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2302380	2311887	5107874		Rhizobium_phage(16.67%)	9	NA	NA
WP_000024392.1|2302380_2302632_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|2302773_2303205_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116566.1|2303449_2304994_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214156.1|2305003_2306287_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483830.1|2306290_2307250_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982100.1|2307236_2308271_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000646014.1|2308509_2309535_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213834.1|2309544_2310741_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000587750.1|2310954_2311887_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
>prophage 163
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2315241	2317075	5107874		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_001052917.1|2315241_2316015_-	glycosyltransferase family 25 protein	NA	A0A0P0YNC5	Yellowstone_lake_phycodnavirus	33.7	7.6e-06
WP_000364807.1|2316046_2317075_-	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.5	1.6e-11
>prophage 164
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2324513	2329076	5107874		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171866.1|2324513_2324993_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
WP_001114542.1|2325031_2325841_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.2	5.9e-25
WP_001051798.1|2325938_2326106_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|2326126_2326363_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001521609.1|2326579_2327248_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000050153.1|2327419_2328640_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	5.0e-44
WP_001298007.1|2328620_2329076_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
>prophage 165
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2332450	2339202	5107874		Morganella_phage(25.0%)	6	NA	NA
WP_001521610.1|2332450_2333275_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	79.0	1.2e-97
WP_000924289.1|2333567_2334185_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001521612.1|2334181_2335864_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	3.9e-23
WP_001521613.1|2336121_2336745_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.9	7.0e-18
WP_000135058.1|2336799_2337075_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280473.1|2337093_2339202_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 166
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2343502	2344894	5107874		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|2343502_2344894_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 167
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2358402	2359587	5107874	integrase	Enterobacteria_phage(100.0%)	1	2353193:2353209	2366410:2366426
2353193:2353209	attL	AATGCCGTTAATCAGTA	NA	NA	NA	NA
WP_001218910.1|2358402_2359587_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	2.6e-162
WP_001218910.1|2358402_2359587_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	2.6e-162
2366410:2366426	attR	TACTGATTAACGGCATT	NA	NA	NA	NA
>prophage 168
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2387357	2388692	5107874		Moraxella_phage(100.0%)	1	NA	NA
WP_001586450.1|2387357_2388692_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.2	3.0e-66
>prophage 169
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2399506	2407983	5107874		Micromonas_sp._RCC1109_virus(25.0%)	9	NA	NA
WP_001521691.1|2399506_2401195_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.4	1.3e-55
WP_001300753.1|2401300_2401399_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000060506.1|2401963_2402053_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001306726.1|2402332_2403517_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	6.8e-14
WP_000148043.1|2403524_2404022_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|2404018_2404381_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|2404370_2404718_-	YidH family protein	NA	NA	NA	NA	NA
WP_001521692.1|2404777_2406271_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.7	6.6e-30
WP_001521693.1|2406267_2407983_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	4.3e-41
>prophage 170
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2414843	2415797	5107874		Synechococcus_phage(50.0%)	2	NA	NA
WP_001243431.1|2414843_2415272_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|2415383_2415797_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 171
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2420224	2421373	5107874		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|2420224_2421373_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 172
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2426077	2433446	5107874		Bacillus_virus(33.33%)	8	NA	NA
WP_001521708.1|2426077_2428492_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060112.1|2428520_2429594_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|2429593_2430694_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|2430698_2432102_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_122134670.1|2432398_2432479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000831330.1|2432708_2432849_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|2432865_2433225_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|2433188_2433446_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 173
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2446114	2447452	5107874		Moraxella_phage(100.0%)	1	NA	NA
WP_001316740.1|2446114_2447452_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 174
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2456455	2463970	5107874		Bacillus_phage(25.0%)	6	NA	NA
WP_000063125.1|2456455_2457229_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251991.1|2457319_2458210_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|2458209_2459169_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867151.1|2459254_2460295_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000334086.1|2460608_2462438_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	5.6e-132
WP_001521725.1|2462599_2463970_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	6.9e-34
>prophage 175
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2475922	2476915	5107874		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845107.1|2475922_2476915_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 176
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2480083	2486642	5107874	transposase	Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
WP_000102332.1|2480083_2481952_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	2.3e-64
WP_000526135.1|2482133_2482592_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_000715936.1|2482827_2483247_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387770.1|2483254_2484760_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000211858.1|2484764_2485730_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_020233744.1|2485754_2486642_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.7	4.3e-05
>prophage 177
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2500036	2501683	5107874		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012630.1|2500036_2501683_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	32.2	6.7e-68
>prophage 178
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2510011	2515425	5107874		Bacillus_phage(33.33%)	4	NA	NA
WP_001521748.1|2510011_2512033_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	4.9e-113
WP_001445788.1|2512079_2513564_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001521751.1|2513699_2514965_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	5.4e-41
WP_001280776.1|2515095_2515425_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 179
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2519455	2523695	5107874		Catovirus(33.33%)	4	NA	NA
WP_001306792.1|2519455_2520586_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.9e-27
WP_001521756.1|2520582_2521845_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.3e-23
WP_029701885.1|2521885_2522560_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612044.1|2522564_2523695_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 180
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2531713	2533369	5107874		Tetraselmis_virus(100.0%)	1	NA	NA
WP_021523313.1|2531713_2533369_-	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	6.1e-45
>prophage 181
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2543669	2547528	5107874		Bacillus_phage(100.0%)	3	NA	NA
WP_000130691.1|2543669_2544566_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213584.1|2544565_2545282_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383407.1|2545365_2547528_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 182
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2554905	2556735	5107874		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|2554905_2556735_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 183
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2571373	2574660	5107874		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187543.1|2571373_2573014_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	4.8e-42
WP_001295260.1|2573092_2573362_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459600.1|2573365_2573881_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109943.1|2573883_2574660_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 184
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2583441	2584056	5107874		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296979.1|2583441_2584056_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 185
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2591712	2593060	5107874	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_100190636.1|2591712_2593060_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
>prophage 186
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2599892	2602679	5107874		uncultured_virus(100.0%)	1	NA	NA
WP_000250006.1|2599892_2602679_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 187
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2606757	2609228	5107874		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001188777.1|2606757_2608167_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190577.1|2608178_2609228_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 188
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2626936	2629716	5107874		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001521799.1|2626936_2627833_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	89.9	1.8e-59
WP_001521800.1|2628000_2628897_+	sulfofructose kinase	NA	NA	NA	NA	NA
WP_001521801.1|2628930_2629716_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
>prophage 189
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2641227	2644278	5107874		Escherichia_phage(100.0%)	1	NA	NA
WP_011310337.1|2641227_2644278_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 190
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2660036	2664897	5107874		Bacillus_thuringiensis_phage(33.33%)	5	NA	NA
WP_001297064.1|2660036_2660657_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001166043.1|2660916_2661900_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270251.1|2662048_2662723_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580427.1|2662828_2664202_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	26.2	2.9e-16
WP_001033722.1|2664198_2664897_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 191
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2676471	2680974	5107874		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_000084268.1|2676471_2677317_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|2677741_2677987_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|2678071_2678557_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|2678649_2679576_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293344.1|2679642_2680974_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 192
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2686611	2690784	5107874		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_032152781.1|2686611_2690784_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	33.5	4.0e-24
>prophage 193
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2698099	2699653	5107874		Pandoravirus(100.0%)	1	NA	NA
WP_000694075.1|2698099_2699653_+	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	23.8	3.0e-09
>prophage 194
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2706521	2713768	5107874		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424838.1|2706521_2707184_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_001521842.1|2707195_2709697_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001004446.1|2710005_2711085_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001521843.1|2711099_2711420_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001521845.1|2711470_2713768_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 195
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2730754	2732599	5107874		Acinetobacter_phage(100.0%)	1	NA	NA
WP_021523320.1|2730754_2732599_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.6	5.5e-10
>prophage 196
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2740938	2743991	5107874		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023085.1|2740938_2741889_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	1.1e-27
WP_000031784.1|2742806_2743991_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 197
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2748107	2756436	5107874		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|2748107_2752136_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|2752212_2756436_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 198
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2765799	2767563	5107874		Klosneuvirus(50.0%)	3	NA	NA
WP_000362388.1|2765799_2766471_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000940106.1|2766513_2767104_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|2767290_2767563_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 199
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2772952	2774542	5107874		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187540.1|2772952_2774542_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 200
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2790465	2797433	5107874	transposase	Dickeya_phage(50.0%)	3	NA	NA
WP_000096041.1|2790465_2794149_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
WP_000956830.1|2794368_2796000_+	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_100190637.1|2796085_2797433_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
>prophage 201
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2819030	2820146	5107874		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|2819030_2820146_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 202
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2829361	2829970	5107874		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|2829361_2829970_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 203
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2836531	2839079	5107874		Escherichia_phage(50.0%)	2	NA	NA
WP_000918363.1|2836531_2837947_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_001147328.1|2837999_2839079_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
>prophage 204
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2843285	2846899	5107874		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357740.1|2843285_2846108_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|2846362_2846899_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 205
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2850716	2852066	5107874		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|2850716_2852066_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 206
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2857675	2859634	5107874		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078214.1|2857675_2859634_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.7	1.1e-90
>prophage 207
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2868918	2871066	5107874		Escherichia_phage(100.0%)	1	NA	NA
WP_077468916.1|2868918_2871066_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	3.1e-33
>prophage 208
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2876311	2878297	5107874		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001522248.1|2876311_2878297_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	45.2	4.6e-148
>prophage 209
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2882179	2883729	5107874		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611392.1|2882179_2882860_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	6.7e-06
WP_001075537.1|2882970_2883729_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	7.9e-16
>prophage 210
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2889353	2890142	5107874		Pithovirus(100.0%)	1	NA	NA
WP_001193403.1|2889353_2890142_-	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.2	3.2e-12
>prophage 211
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2894981	2896484	5107874		Burkholderia_virus(100.0%)	1	NA	NA
WP_001305708.1|2894981_2896484_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	7.0e-56
>prophage 212
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2917681	2920893	5107874	tRNA	Catovirus(50.0%)	2	NA	NA
WP_000003806.1|2917681_2919199_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856827.1|2919435_2920893_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.8	2.3e-48
>prophage 213
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2929508	2931850	5107874		Klebsiella_phage(33.33%)	4	NA	NA
WP_000692345.1|2929508_2929730_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_021553055.1|2929794_2930271_-	RadC family protein	NA	NA	NA	NA	NA
WP_001564060.1|2930286_2930766_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	8.9e-13
WP_001175165.1|2931031_2931850_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.5	6.5e-48
>prophage 214
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2951901	2955483	5107874		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001001003.1|2951901_2953053_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	55.2	1.3e-107
WP_001564046.1|2953181_2954237_-	response regulator	NA	NA	NA	NA	NA
WP_000792585.1|2954253_2955483_-	ATPase	NA	Q9EYF3	Enterobacteria_phage	30.3	5.6e-19
>prophage 215
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2962308	2962884	5107874		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000722279.1|2962308_2962884_-	DJ-1/PfpI family protein	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	31.8	1.5e-14
>prophage 216
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2976889	2981799	5107874	transposase	Shigella_phage(33.33%)	4	NA	NA
WP_085947917.1|2976889_2978162_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_032153628.1|2979149_2979803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001564037.1|2979943_2981176_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	32.9	5.0e-60
WP_001564035.1|2981160_2981799_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.0	3.9e-56
>prophage 217
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	2985095	2986604	5107874		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001189111.1|2985095_2986604_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
>prophage 218
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3000479	3001745	5107874	integrase	Pseudomonas_phage(100.0%)	1	2988450:2988463	3003396:3003409
2988450:2988463	attL	AATTACCGTCTTTG	NA	NA	NA	NA
WP_029701734.1|3000479_3001745_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	2.0e-80
WP_029701734.1|3000479_3001745_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	2.0e-80
3003396:3003409	attR	CAAAGACGGTAATT	NA	NA	NA	NA
>prophage 219
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3010078	3012062	5107874		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|3010078_3010372_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|3010415_3012062_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 220
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3016976	3017510	5107874		Morganella_phage(100.0%)	1	NA	NA
WP_001522351.1|3016976_3017510_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.1e-47
>prophage 221
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3022429	3023407	5107874		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|3022429_3023407_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 222
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3030835	3031381	5107874		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|3030835_3031381_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 223
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3035417	3048448	5107874	protease,tRNA	Vibrio_phage(20.0%)	11	NA	NA
WP_020233522.1|3035417_3036755_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122460.1|3036764_3038612_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_001280339.1|3038604_3039555_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|3039640_3039949_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|3040024_3041305_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312481.1|3041390_3042650_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|3042652_3043657_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|3043738_3043936_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|3044039_3045338_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|3045542_3045968_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076315.1|3046006_3048448_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
>prophage 224
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3052291	3053455	5107874		Ralstonia_phage(100.0%)	1	NA	NA
WP_000944019.1|3052291_3053455_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	8.3e-81
>prophage 225
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3067748	3068957	5107874	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_024194431.1|3067748_3068957_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.5	1.0e-206
>prophage 226
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3090104	3096585	5107874		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_000055075.1|3090104_3090635_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_001522398.1|3090944_3091901_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_001522399.1|3092033_3093536_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_001361374.1|3093549_3094572_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596021.1|3094558_3095554_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|3095586_3096585_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 227
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3101044	3104355	5107874		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_000212715.1|3101044_3101287_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	50.0	1.4e-14
WP_001105433.1|3101276_3101567_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	63.8	3.8e-27
WP_001009182.1|3101567_3102032_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	8.5e-53
WP_000187798.1|3102216_3104355_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
>prophage 228
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3107993	3114090	5107874		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_001181324.1|3107993_3108941_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|3109125_3109179_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471850.1|3109319_3112016_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.3	3.4e-45
WP_000047539.1|3112221_3112608_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|3112680_3113142_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|3113154_3114090_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 229
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3122358	3131634	5107874	tRNA	Klosneuvirus(33.33%)	6	NA	NA
WP_000416387.1|3122358_3125214_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786399.1|3125213_3125657_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_100190782.1|3126010_3127522_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	3.9e-46
WP_000584114.1|3127788_3128889_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_100190783.1|3128888_3129971_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_021523335.1|3130131_3131634_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	43.9	1.4e-83
>prophage 230
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3136761	3137781	5107874		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_001318460.1|3136761_3137781_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
>prophage 231
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3147432	3155790	5107874	transposase	Shigella_phage(20.0%)	7	NA	NA
WP_085948656.1|3147432_3148599_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.8e-184
WP_000625671.1|3148534_3148948_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001293436.1|3149010_3151008_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_085947616.1|3151161_3152318_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000177057.1|3153251_3153509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|3154065_3154833_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684855.1|3154833_3155790_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	2.4e-17
>prophage 232
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3165965	3168125	5107874	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_000998019.1|3165965_3167351_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000612591.1|3167400_3167748_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171523.1|3167744_3168125_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
>prophage 233
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3180343	3182751	5107874		Yersinia_phage(50.0%)	3	NA	NA
WP_001234656.1|3180343_3181162_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	1.6e-46
WP_001186775.1|3181990_3182467_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|3182529_3182751_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
>prophage 234
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3205689	3206670	5107874		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000991438.1|3205689_3206670_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	56.6	4.7e-101
>prophage 235
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3210032	3211709	5107874		Escherichia_phage(100.0%)	2	NA	NA
WP_000790583.1|3210032_3210635_+	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
WP_000044711.1|3211112_3211709_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 236
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3221975	3223436	5107874		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208176.1|3221975_3223436_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.9	6.2e-49
>prophage 237
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3236504	3237425	5107874	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000181195.1|3236504_3237425_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.7	2.2e-60
>prophage 238
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3252170	3253835	5107874		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000919580.1|3252170_3253835_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	5.3e-12
>prophage 239
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3264460	3265740	5107874		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|3264460_3265198_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_001350779.1|3265200_3265740_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	3.8e-28
>prophage 240
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3273638	3276514	5107874		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175940.1|3273638_3275228_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001295748.1|3275620_3276226_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|3276352_3276514_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 241
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3282101	3283424	5107874		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|3282101_3283424_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 242
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3290141	3291374	5107874		Enterococcus_phage(100.0%)	1	NA	NA
WP_000093813.1|3290141_3291374_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
>prophage 243
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3295674	3300899	5107874	transposase	Bacillus_phage(66.67%)	3	NA	NA
WP_100190637.1|3295674_3297022_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
WP_000046749.1|3297083_3298751_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_021523345.1|3298961_3300899_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 244
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3304085	3306199	5107874		Bacillus_phage(50.0%)	2	NA	NA
WP_001188679.1|3304085_3304775_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_021523346.1|3304774_3306199_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.7	4.2e-10
>prophage 245
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3318566	3327633	5107874		Cyanophage(20.0%)	9	NA	NA
WP_000130187.1|3318566_3319520_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
WP_001094685.1|3319634_3320222_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528538.1|3320256_3320823_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001102367.1|3320971_3321685_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843579.1|3321710_3322115_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|3322489_3324406_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|3324494_3325625_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000935262.1|3325728_3325938_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_000681352.1|3326466_3327633_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	1.7e-89
>prophage 246
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3337118	3339935	5107874	tRNA	Moumouvirus(100.0%)	1	NA	NA
WP_001520439.1|3337118_3339935_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2P1ELB8	Moumouvirus	26.3	3.5e-77
>prophage 247
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3344722	3345871	5107874		Halovirus(100.0%)	1	NA	NA
WP_029701411.1|3344722_3345871_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 248
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3351374	3357024	5107874		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001520452.1|3351374_3352928_-	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.1	1.2e-34
WP_000349954.1|3353001_3354219_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|3354336_3355479_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787109.1|3355509_3357024_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 249
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3364917	3366878	5107874		Bacillus_phage(50.0%)	4	NA	NA
WP_000624375.1|3364917_3365397_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_001520458.1|3365482_3365716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001520461.1|3365718_3365970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000257196.1|3366029_3366878_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
>prophage 250
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3375966	3381388	5107874		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117011.1|3375966_3378873_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_032152759.1|3379036_3381388_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.2	8.7e-37
>prophage 251
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3387720	3388419	5107874		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916278.1|3387720_3388419_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.1e-23
>prophage 252
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3400908	3402633	5107874		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425672.1|3400908_3402633_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.9e-36
>prophage 253
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3428717	3429761	5107874		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217337.1|3428717_3429761_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 254
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3434006	3434558	5107874		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923726.1|3434006_3434558_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.5e-11
>prophage 255
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3443185	3444610	5107874		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|3443185_3444610_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 256
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3452281	3458743	5107874		Mamastrovirus(33.33%)	5	NA	NA
WP_001550615.1|3452281_3453832_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	4.6e-18
WP_021516789.1|3453878_3456263_-	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|3456468_3457005_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|3457045_3457708_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|3457816_3458743_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 257
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3462005	3462896	5107874	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_021522998.1|3462005_3462896_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	49.8	6.2e-60
>prophage 258
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3472098	3478904	5107874	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_071593646.1|3472098_3473517_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937404.1|3473555_3474482_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|3474518_3474974_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396050.1|3475151_3475856_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294687.1|3475870_3476401_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001520511.1|3476474_3478904_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	31.4	6.0e-41
>prophage 259
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3484042	3484840	5107874		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|3484042_3484840_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 260
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3490751	3491096	5107874		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|3490751_3491096_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 261
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3495025	3496450	5107874	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001520514.1|3495025_3496450_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
>prophage 262
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3508298	3509057	5107874		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001520518.1|3508298_3509057_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 263
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3517885	3522001	5107874		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_000569434.1|3517885_3518482_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
WP_001520523.1|3518518_3522001_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.0	1.7e-209
>prophage 264
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3534833	3535865	5107874		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|3534833_3535865_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 265
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3542385	3550237	5107874		Indivirus(25.0%)	9	NA	NA
WP_000997053.1|3542385_3543189_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	5.4e-39
WP_000648583.1|3543185_3544100_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|3544340_3545141_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_001521855.1|3545218_3545989_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|3546035_3547394_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_021523003.1|3547465_3548221_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001295200.1|3548254_3548977_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|3548973_3549441_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001308374.1|3549505_3550237_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
>prophage 266
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3560713	3563677	5107874		Escherichia_phage(100.0%)	1	NA	NA
WP_029702118.1|3560713_3563677_-	AAA domain-containing protein	NA	A0A1C3S747	Escherichia_phage	28.3	2.3e-74
>prophage 267
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3574641	3581358	5107874		Ralstonia_phage(50.0%)	2	NA	NA
WP_001550647.1|3574641_3576783_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.8	1.8e-25
WP_021516938.1|3576858_3581358_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.5	4.7e-23
>prophage 268
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3587636	3590859	5107874		Caulobacter_phage(50.0%)	4	NA	NA
WP_000284050.1|3587636_3588215_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|3588330_3589098_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|3589068_3589809_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_016233951.1|3590109_3590859_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
>prophage 269
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3601016	3604728	5107874		Streptococcus_phage(66.67%)	3	NA	NA
WP_000749881.1|3601016_3602072_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|3602359_3603463_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_001521908.1|3603474_3604728_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	2.9e-95
>prophage 270
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3616364	3618563	5107874		Acinetobacter_phage(100.0%)	1	NA	NA
WP_021516944.1|3616364_3618563_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	3.3e-38
>prophage 271
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3636782	3637634	5107874		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001521924.1|3636782_3637634_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.5e-47
>prophage 272
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3643680	3646985	5107874		Staphylococcus_phage(50.0%)	4	NA	NA
WP_021516948.1|3643680_3644550_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	7.1e-53
WP_001521928.1|3644709_3645303_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474077.1|3645314_3645551_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046306.1|3645659_3646985_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
>prophage 273
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3652559	3658479	5107874	holin	Catovirus(50.0%)	4	NA	NA
WP_001521934.1|3652559_3654230_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	2.3e-60
WP_000089090.1|3654243_3655716_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001376735.1|3655729_3656317_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131040.1|3656445_3658479_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 274
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3671160	3675698	5107874		Bacillus_virus(50.0%)	4	NA	NA
WP_021523012.1|3671160_3672645_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	4.7e-12
WP_000818902.1|3672637_3673609_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000750344.1|3673605_3674562_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001521951.1|3674648_3675698_+	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.0	1.3e-72
>prophage 275
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3684078	3689673	5107874		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001521955.1|3684078_3685965_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	1.4e-53
WP_000076233.1|3686201_3687461_+	cytosine permease	NA	NA	NA	NA	NA
WP_000952490.1|3688773_3689673_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	1.9e-16
>prophage 276
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3694198	3698478	5107874		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_001521962.1|3694198_3697273_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	97.7	0.0e+00
WP_000805887.1|3697395_3698478_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	98.9	4.1e-191
>prophage 277
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3703888	3705849	5107874		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_001521966.1|3703888_3704839_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	1.9e-35
WP_001013507.1|3704835_3705849_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	3.2e-44
>prophage 278
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3708932	3710042	5107874		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|3708932_3710042_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 279
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3715331	3716099	5107874		Planktothrix_phage(100.0%)	1	NA	NA
WP_001521976.1|3715331_3716099_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.8	2.1e-24
>prophage 280
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3722968	3724126	5107874		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830732.1|3722968_3724126_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
>prophage 281
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3731540	3732656	5107874		Bacillus_phage(100.0%)	1	NA	NA
WP_001521984.1|3731540_3732656_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 282
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3736945	3737857	5107874		Salmonella_phage(100.0%)	1	NA	NA
WP_001298537.1|3736945_3737857_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
>prophage 283
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3741315	3747890	5107874		Bacillus_phage(75.0%)	4	NA	NA
WP_001521993.1|3741315_3744459_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001521994.1|3744455_3745658_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000113933.1|3745847_3746537_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_029702132.1|3746594_3747890_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.4	6.5e-26
>prophage 284
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3756627	3760967	5107874	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
WP_000667319.1|3756627_3757755_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|3757777_3758110_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|3758137_3759985_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|3759995_3760967_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
>prophage 285
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3764278	3767926	5107874	transposase	Escherichia_phage(33.33%)	4	NA	NA
WP_071779335.1|3764278_3765436_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.5	4.0e-200
WP_000543535.1|3765810_3766260_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001522013.1|3766263_3767367_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.8	6.3e-54
WP_001021161.1|3767455_3767926_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 286
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3791282	3796329	5107874	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|3791282_3791906_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|3792031_3793306_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|3793493_3795848_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|3796056_3796329_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 287
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3799469	3800165	5107874		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817227.1|3799469_3800165_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 288
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3809527	3812677	5107874		Leptospira_phage(100.0%)	1	NA	NA
WP_001132480.1|3809527_3812677_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	4.7e-54
>prophage 289
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3819515	3830890	5107874	transposase	Klosneuvirus(20.0%)	10	NA	NA
WP_000127356.1|3819515_3820067_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122011.1|3820195_3822127_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|3822179_3822509_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|3822508_3823114_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678201.1|3823223_3825098_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001220233.1|3825278_3825923_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250117.1|3826054_3827017_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801805.1|3827013_3827973_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	2.5e-14
WP_000671574.1|3828124_3829429_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_100190644.1|3829541_3830890_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
>prophage 290
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3837941	3840446	5107874		uncultured_virus(100.0%)	1	NA	NA
WP_001522043.1|3837941_3840446_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.5	1.0e-115
>prophage 291
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3865517	3867680	5107874		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_100190789.1|3865517_3867680_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	31.1	9.2e-17
>prophage 292
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3873383	3874061	5107874		Bacillus_virus(100.0%)	1	NA	NA
WP_001522056.1|3873383_3874061_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 293
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3877197	3877884	5107874		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110573.1|3877197_3877884_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 294
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3890960	3892742	5107874		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001309310.1|3890960_3892742_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	7.8e-38
>prophage 295
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3898934	3900080	5107874		Streptococcus_phage(100.0%)	1	NA	NA
WP_001522069.1|3898934_3900080_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	42.3	4.8e-49
>prophage 296
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3911516	3914647	5107874	tRNA	Moumouvirus(50.0%)	4	NA	NA
WP_000912350.1|3911516_3912902_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001522081.1|3912937_3913459_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190286.1|3913566_3913779_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|3913780_3914647_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
>prophage 297
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3931072	3931771	5107874		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001328511.1|3931072_3931771_-	RHS repeat-associated core domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	40.4	3.1e-14
>prophage 298
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3940277	3945037	5107874		Ralstonia_phage(33.33%)	3	NA	NA
WP_001522505.1|3940277_3942179_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	6.6e-27
WP_020233798.1|3942915_3944364_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	3.9e-11
WP_000770953.1|3944353_3945037_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 299
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3948182	3951326	5107874		Leptospira_phage(100.0%)	1	NA	NA
WP_001522511.1|3948182_3951326_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	9.8e-60
>prophage 300
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3962754	3968797	5107874		Tupanvirus(50.0%)	3	NA	NA
WP_032152766.1|3962754_3966636_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.6	4.9e-61
WP_021523039.1|3966851_3967985_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140646.1|3967981_3968797_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 301
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3983087	3984910	5107874		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502941.1|3983087_3983717_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
WP_000029780.1|3983689_3984910_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.3	7.9e-58
>prophage 302
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	3988019	3990134	5107874		Bacillus_virus(50.0%)	2	NA	NA
WP_032142912.1|3988019_3989585_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.6	1.7e-44
WP_000278505.1|3989705_3990134_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
>prophage 303
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4004222	4004869	5107874		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|4004222_4004432_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939738.1|4004485_4004869_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 304
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4009687	4012127	5107874		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|4009687_4010899_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231416.1|4011038_4012127_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 305
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4019137	4024261	5107874	tRNA	Staphylococcus_phage(50.0%)	4	NA	NA
WP_001157896.1|4019137_4021720_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	1.2e-183
WP_001044880.1|4021955_4022438_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_020233368.1|4022482_4023418_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631384.1|4023535_4024261_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 306
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4030144	4031224	5107874		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|4030144_4031224_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 307
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4035319	4036984	5107874		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337063.1|4035319_4036984_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.3	6.1e-85
>prophage 308
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4041610	4046136	5107874	transposase,tRNA	Vibrio_phage(50.0%)	3	NA	NA
WP_001522554.1|4041610_4043557_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	9.2e-08
WP_000526135.1|4043780_4044239_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_020233305.1|4044471_4046136_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.7	0.0e+00
>prophage 309
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4050287	4051052	5107874		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773272.1|4050287_4051052_-	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	32.4	5.8e-06
>prophage 310
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4057707	4076013	5107874		Hokovirus(28.57%)	13	NA	NA
WP_000186102.1|4057707_4058385_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	8.9e-27
WP_001522559.1|4058381_4061066_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	6.5e-12
WP_001522564.1|4061058_4061631_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_001522567.1|4061639_4063688_-	potassium-transporting ATPase subunit KdpB	NA	A0A218MNH6	uncultured_virus	27.6	2.3e-25
WP_001522568.1|4063710_4065384_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001365534.1|4065383_4065473_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424926.1|4065784_4065991_+	YbfA family protein	NA	NA	NA	NA	NA
WP_048219329.1|4066238_4070378_+	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	45.5	6.7e-24
WP_000720081.1|4070374_4070878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021523046.1|4070942_4071548_+	RHS repeat-associated core domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	38.3	5.5e-20
WP_001522578.1|4072564_4073074_+	YbgA family protein	NA	NA	NA	NA	NA
WP_021517020.1|4073070_4074489_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.8	4.0e-61
WP_001522583.1|4074531_4076013_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	4.2e-45
>prophage 311
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4079391	4080183	5107874		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114011.1|4079391_4080183_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	27.9	5.8e-09
>prophage 312
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4103939	4105337	5107874		Bordetella_phage(100.0%)	1	NA	NA
WP_001522602.1|4103939_4105337_-	RtcB family protein	NA	A0A291L9X2	Bordetella_phage	32.5	8.8e-37
>prophage 313
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4131351	4134870	5107874		Vibrio_phage(33.33%)	4	NA	NA
WP_001578005.1|4131351_4132071_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	4.1e-22
WP_000951276.1|4132067_4133009_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.9	2.9e-23
WP_000784342.1|4133122_4133503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001109181.1|4133817_4134870_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.1	7.5e-81
>prophage 314
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4139232	4145807	5107874		Tupanvirus(33.33%)	7	NA	NA
WP_001265443.1|4139232_4140249_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
WP_001522634.1|4140511_4141984_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	4.2e-13
WP_001147439.1|4142051_4142840_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|4142968_4143118_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_001522635.1|4143283_4144057_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604037.1|4144056_4144746_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_001522636.1|4144748_4145807_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.1e-20
>prophage 315
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4155998	4157288	5107874		Klosneuvirus(100.0%)	1	NA	NA
WP_001309367.1|4155998_4157288_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
>prophage 316
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4163615	4164524	5107874		Streptococcus_phage(100.0%)	1	NA	NA
WP_001522645.1|4163615_4164524_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	30.7	3.2e-27
>prophage 317
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4175509	4180501	5107874		Anomala_cuprea_entomopoxvirus(50.0%)	4	NA	NA
WP_021551930.1|4175509_4177246_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_021523049.1|4177238_4178234_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001522655.1|4178236_4178908_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_001522656.1|4179136_4180501_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
>prophage 318
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4186580	4190447	5107874		Salmonella_phage(33.33%)	4	NA	NA
WP_000146357.1|4186580_4186847_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_020233042.1|4186920_4187598_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.1e-19
WP_021517034.1|4187639_4189922_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000710619.1|4190186_4190447_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
>prophage 319
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4193987	4199212	5107874		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569080.1|4193987_4194710_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159065.1|4194706_4195366_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|4195504_4196251_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001522673.1|4196654_4197158_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	3.8e-06
WP_001295297.1|4197456_4198344_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|4198578_4198644_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|4198696_4199212_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 320
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4204208	4205804	5107874		Tupanvirus(100.0%)	1	NA	NA
WP_100190792.1|4204208_4205804_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	1.0e-60
>prophage 321
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4213405	4217536	5107874		Citrobacter_phage(50.0%)	3	NA	NA
WP_001522678.1|4213405_4215838_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001522679.1|4215843_4216743_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001522680.1|4216873_4217536_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.6	4.3e-26
>prophage 322
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4220751	4222623	5107874		Planktothrix_phage(100.0%)	1	NA	NA
WP_021523050.1|4220751_4222623_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	30.5	3.6e-17
>prophage 323
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4234912	4236115	5107874		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|4234912_4236115_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 324
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4244680	4338648	5107874	protease,transposase,tail,integrase,head,plate,tRNA	Burkholderia_virus(29.82%)	100	4239663:4239678	4342362:4342377
4239663:4239678	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_001195231.1|4244680_4244938_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_001281701.1|4245237_4245627_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
WP_100190793.1|4245598_4246048_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	44.4	5.2e-23
WP_000206212.1|4246049_4246256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000631813.1|4246245_4246476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000132039.1|4246472_4247156_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
WP_000763553.1|4247152_4247368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299260.1|4247382_4247679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001381531.1|4247688_4247961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|4248249_4248780_-	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000843446.1|4248807_4249077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000960679.1|4249079_4250246_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
WP_001545516.1|4250256_4252026_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	68.3	2.4e-228
WP_000533821.1|4252029_4252944_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	52.5	6.8e-70
WP_000049025.1|4252954_4253263_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	5.5e-24
WP_000200153.1|4253315_4253504_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	6.1e-18
WP_001259268.1|4253554_4254016_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000031883.1|4254012_4254999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001330012.1|4255083_4255671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000149906.1|4255708_4256185_-	ABC transporter ATPase	NA	NA	NA	NA	NA
WP_000793146.1|4256315_4256666_+	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_001104440.1|4256668_4257409_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000264664.1|4257392_4258043_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
WP_000175097.1|4258039_4258366_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_000227700.1|4258365_4258677_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000124060.1|4258676_4259222_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
WP_000167506.1|4259218_4260814_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	6.5e-185
WP_001546013.1|4260813_4262310_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.2	4.8e-166
WP_000117560.1|4262290_4263112_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	1.2e-97
WP_000135513.1|4263114_4263573_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
WP_001273074.1|4263787_4264903_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_001286908.1|4264917_4265871_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_000537457.1|4265880_4266219_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_000271668.1|4266220_4266667_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_001101804.1|4266666_4267131_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_012602372.1|4267127_4267382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729834.1|4267371_4268799_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_000034294.1|4268798_4269320_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
WP_000110114.1|4269322_4269604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084213.1|4269701_4270037_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001202894.1|4269960_4270119_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_021551891.1|4270194_4273407_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	31.2	1.1e-82
WP_000458386.1|4273406_4274291_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_032142594.1|4274287_4274503_+	membrane protein	NA	Q6QIA3	Burkholderia_phage	55.7	3.5e-17
WP_001545521.1|4274490_4275645_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.3	1.2e-84
WP_001404342.1|4275641_4276238_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.7	3.2e-36
WP_000859111.1|4276292_4276640_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_001219102.1|4276630_4277734_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	8.3e-107
WP_000138756.1|4277726_4278305_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_077883632.1|4278307_4280302_+	short-chain fatty acid transporter	NA	A0A0K2FIZ6	Escherichia_phage	44.4	2.7e-39
WP_024240575.1|4280312_4280786_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	51.8	1.8e-34
WP_000072166.1|4280792_4281407_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.5	1.7e-61
WP_001427100.1|4281406_4281919_-|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	47.9	1.3e-33
WP_000904922.1|4281990_4282563_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_001201580.1|4282669_4282957_+	YbjC family protein	NA	NA	NA	NA	NA
WP_000189134.1|4282940_4283663_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|4283723_4284626_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_001522733.1|4284713_4285190_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126102.1|4285540_4286653_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_001522735.1|4286747_4287881_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_001522736.1|4287890_4288835_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061665.1|4288831_4289677_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|4289736_4290225_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001522739.1|4290265_4291393_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	1.8e-27
WP_001522743.1|4291421_4292153_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000464488.1|4292378_4293047_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001688.1|4293046_4293763_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756575.1|4293769_4294501_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027208.1|4294518_4295247_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270660.1|4295464_4295980_-	lipoprotein	NA	NA	NA	NA	NA
WP_001323359.1|4296627_4298397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001160731.1|4298607_4298931_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255153.1|4298927_4299758_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	4.3e-07
WP_001305933.1|4299754_4300768_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136538.1|4300866_4302297_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001522745.1|4302307_4303309_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815339.1|4303345_4305064_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.4	3.1e-31
WP_001522746.1|4305196_4306165_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458825.1|4306176_4307829_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_001522747.1|4307972_4308872_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_021523052.1|4309355_4310051_-	aquaporin Z	NA	NA	NA	NA	NA
WP_001522749.1|4310476_4312135_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_131727183.1|4312131_4313088_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746460.1|4313238_4314354_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188187.1|4314350_4316297_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|4316369_4316594_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|4316916_4317237_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|4317267_4319544_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|4320763_4320982_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|4321266_4321971_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001522751.1|4322012_4323734_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.2e-21
WP_001043595.1|4323734_4325501_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_001522752.1|4325623_4326589_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_000228473.1|4327133_4327628_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_001522753.1|4327762_4331830_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001522754.1|4331988_4332600_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|4332610_4333954_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|4334044_4335337_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850305.1|4335575_4338020_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	5.0e-221
WP_000213098.1|4338030_4338648_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
4342362:4342377	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 325
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4343487	4380473	5107874	tail,terminase,integrase,head,lysis,portal,capsid,plate,holin	Escherichia_phage(46.51%)	44	4330617:4330632	4368688:4368703
4330617:4330632	attL	AAGTTATTCCTGGCAA	NA	NA	NA	NA
WP_000067977.1|4343487_4344285_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_000023391.1|4344316_4345312_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.7	7.1e-190
WP_000072552.1|4345405_4345717_-	helix-turn-helix transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	100.0	4.3e-53
WP_000022051.1|4345821_4346178_+	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	100.0	1.1e-63
WP_000217677.1|4346355_4346856_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_000557703.1|4346920_4347145_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277957.1|4347144_4347447_+	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	99.0	2.2e-46
WP_023148842.1|4347446_4347671_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	5.0e-35
WP_000027664.1|4347667_4347943_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_023148841.1|4347932_4350221_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.2	0.0e+00
WP_016239054.1|4350829_4351150_+	helix-turn-helix transcriptional regulator	NA	E5E3S9	Burkholderia_phage	38.7	5.9e-13
WP_023148839.1|4351115_4352066_+	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	40.8	4.6e-37
WP_023148838.1|4352174_4353539_-	FRG domain-containing protein	NA	Q9AZ51	Lactococcus_phage	34.1	6.7e-05
WP_048219351.1|4354051_4355086_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	7.1e-201
WP_000156861.1|4355085_4356858_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001085952.1|4357031_4357886_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_023148837.1|4357940_4359014_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.2	7.4e-201
WP_000203438.1|4359017_4359761_+|terminase	terminase endonuclease subunit	terminase	Q94MK6	Enterobacteria_phage	97.6	1.6e-122
WP_033559479.1|4359860_4360370_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	98.8	7.3e-90
WP_000846409.1|4360369_4360573_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123123.1|4360576_4360858_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_023148834.1|4360857_4361355_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.2e-92
WP_000736597.1|4361369_4361795_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	95.0	4.7e-58
WP_032152948.1|4361782_4362208_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	96.5	1.4e-65
WP_001440152.1|4362179_4362353_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_001774102.1|4362315_4362783_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.1	9.7e-81
WP_023148832.1|4362775_4363228_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	99.3	2.4e-76
WP_023148831.1|4363330_4364404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024176299.1|4364490_4365120_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	95.2	1.8e-106
WP_000127164.1|4365116_4365464_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_001121453.1|4365468_4366377_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	4.4e-162
WP_001285325.1|4366369_4366900_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_023148827.1|4366910_4368935_+|tail	phage tail fiber repeat-containing domain protein	tail	A0A0A7NV63	Enterobacteria_phage	71.9	6.5e-299
4368688:4368703	attR	AAGTTATTCCTGGCAA	NA	NA	NA	NA
WP_023148826.1|4368936_4369464_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	92.6	8.3e-89
WP_023148825.1|4369754_4370981_+	DUF4263 domain-containing protein	NA	Q858S8	Enterobacteria_phage	99.4	1.1e-181
WP_032152801.1|4371267_4372458_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.1e-224
WP_001251408.1|4372470_4372989_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|4373045_4373321_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|4373353_4373473_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_023148822.1|4373465_4375913_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.0	0.0e+00
WP_023140595.1|4375927_4376407_+|tail	phage tail protein	tail	O64315	Escherichia_phage	98.7	2.5e-84
WP_023148821.1|4376406_4377570_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	4.1e-205
WP_000468308.1|4377652_4377871_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001292809.1|4378190_4380473_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
>prophage 326
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4384571	4385660	5107874		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057149.1|4384571_4385660_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 327
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4390747	4395288	5107874		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|4390747_4391032_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_021523053.1|4391238_4393503_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|4393539_4395288_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
>prophage 328
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4409993	4410542	5107874		Rhodobacter_phage(100.0%)	1	NA	NA
WP_001295932.1|4409993_4410542_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 329
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4414321	4420780	5107874	tRNA	Bandra_megavirus(33.33%)	4	NA	NA
WP_000117881.1|4414321_4415722_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001305916.1|4415890_4417093_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193813.1|4417358_4419971_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	9.1e-19
WP_001090506.1|4420012_4420780_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
>prophage 330
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4436700	4438608	5107874		Tupanvirus(100.0%)	1	NA	NA
WP_000053080.1|4436700_4438608_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
>prophage 331
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4451218	4453273	5107874		Bacillus_phage(100.0%)	1	NA	NA
WP_020232990.1|4451218_4453273_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.7e-20
>prophage 332
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4457506	4458166	5107874	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|4457506_4458166_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 333
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4469160	4482851	5107874	transposase	Bacillus_phage(33.33%)	14	NA	NA
WP_000066490.1|4469160_4469373_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|4469383_4469572_+	cold-shock protein	NA	NA	NA	NA	NA
WP_020232998.1|4469546_4469777_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|4469766_4469940_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001522816.1|4469987_4471061_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_071779334.1|4471132_4473877_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.5	9.2e-38
WP_001522818.1|4473959_4474988_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|4474960_4475653_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001522819.1|4475782_4476955_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_020233001.1|4476954_4479501_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.3	1.5e-71
WP_001522821.1|4479497_4480097_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_100190637.1|4480179_4481527_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
WP_000024560.1|4481625_4481931_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420641.1|4481930_4482851_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	2.5e-11
>prophage 334
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4487155	4489255	5107874		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|4487155_4487329_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_021523061.1|4487411_4488740_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.6	6.9e-233
WP_001028095.1|4488760_4489255_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
>prophage 335
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4504143	4505067	5107874		Cronobacter_phage(100.0%)	1	NA	NA
WP_001304747.1|4504143_4505067_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	3.1e-91
>prophage 336
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4511891	4513259	5107874		Bacillus_phage(100.0%)	1	NA	NA
WP_001522838.1|4511891_4513259_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	1.9e-20
>prophage 337
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4516649	4517483	5107874		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|4516649_4517483_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 338
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4521607	4522141	5107874		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|4521607_4522141_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 339
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4531449	4532370	5107874		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|4531449_4532370_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 340
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4537032	4537278	5107874		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|4537032_4537278_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 341
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4553123	4554065	5107874		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001522863.1|4553123_4554065_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 342
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4567238	4568420	5107874		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000007233.1|4567238_4567973_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.7e-15
WP_000103754.1|4568183_4568420_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 343
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4572403	4574046	5107874		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257007.1|4572403_4573045_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	3.4e-28
WP_001267945.1|4573041_4574046_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
>prophage 344
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4586369	4667544	5107874	tRNA,transposase,terminase,tail,lysis,integrase,head,portal,capsid,holin	Escherichia_phage(35.0%)	96	4587968:4587983	4633387:4633402
WP_000800153.1|4586369_4586627_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
WP_000526135.1|4586840_4587299_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_000598207.1|4587420_4588380_-	L,D-transpeptidase LdtC	NA	NA	NA	NA	NA
4587968:4587983	attL	GTCAGCGTGTCACCAC	NA	NA	NA	NA
WP_024166502.1|4588526_4591973_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_001522877.1|4592100_4593174_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_000284714.1|4593434_4594634_+	lipoprotein-releasing ABC transporter permease subunit LolC	NA	NA	NA	NA	NA
WP_001033689.1|4594626_4595328_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	39.8	5.4e-35
WP_001251363.1|4595327_4596572_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291248.1|4596600_4597512_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952736.1|4597527_4598349_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000720604.1|4598485_4599271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001522885.1|4599267_4599729_-	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_000526135.1|4599858_4600317_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_000759309.1|4600497_4601544_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|4601540_4602335_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074983.1|4602501_4603620_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
WP_000003742.1|4603588_4603858_-	excisionase	NA	NA	NA	NA	NA
WP_100190796.1|4603919_4606376_-	exonuclease	NA	V5UQJ3	Shigella_phage	42.4	7.3e-103
WP_001093951.1|4606453_4606657_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450218.1|4606653_4606842_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000935596.1|4606852_4607707_-	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	3.6e-65
WP_000394557.1|4608237_4608612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379564.1|4608623_4608776_-	DUF1391 family protein	NA	NA	NA	NA	NA
WP_000787428.1|4608982_4609390_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912294.1|4609466_4609694_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705383.1|4609677_4610229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020541.1|4610200_4611241_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	1.0e-90
WP_001403041.1|4611272_4611695_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	89.3	2.8e-71
WP_000450706.1|4611728_4612499_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.4	1.1e-86
WP_001141099.1|4612514_4612907_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_001266130.1|4612903_4613200_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001209475.1|4613196_4613658_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	2.6e-38
WP_000403791.1|4613635_4613992_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	1.1e-57
WP_000137948.1|4614087_4614495_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	60.4	1.0e-22
WP_001229301.1|4614496_4614862_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	99.2	1.9e-68
WP_000208092.1|4614858_4615845_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	41.5	1.8e-44
WP_000813254.1|4616403_4616559_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001309416.1|4616775_4617027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309417.1|4617093_4617372_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.3	6.3e-11
WP_001265256.1|4617373_4618432_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.3	1.8e-90
WP_000140038.1|4618432_4618801_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	2.4e-34
WP_001064909.1|4618793_4619483_+	antiterminator	NA	I6PDF8	Cronobacter_phage	48.1	7.1e-56
WP_001309418.1|4619695_4619893_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	93.8	1.7e-26
WP_000871291.1|4620262_4620598_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_001309419.1|4620843_4621047_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	96.8	2.7e-27
WP_000284506.1|4621354_4621570_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001037014.1|4621574_4622465_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	70.9	2.1e-108
WP_001092866.1|4622501_4623035_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	6.7e-102
WP_001446668.1|4623191_4623374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280932.1|4623388_4623520_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
WP_032142285.1|4623522_4623990_+|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	84.4	6.7e-66
WP_000830178.1|4624300_4624627_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001322427.1|4624749_4625103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235436.1|4625585_4626095_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001309424.1|4626066_4627995_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	1.4e-261
WP_000258993.1|4627978_4628185_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_001322425.1|4628181_4629774_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	4.9e-185
WP_001253888.1|4629763_4631269_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	1.0e-99
WP_000256814.1|4631305_4631653_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	59.1	6.8e-23
WP_029702099.1|4631710_4632739_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	4.1e-116
WP_000201530.1|4632790_4633165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204533.1|4633157_4633511_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
4633387:4633402	attR	GTGGTGACACGCTGAC	NA	NA	NA	NA
WP_000975005.1|4633526_4634102_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	56.8	1.6e-48
WP_000683079.1|4634098_4634494_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235111.1|4634501_4635254_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	2.7e-133
WP_000479111.1|4635267_4635699_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	1.8e-41
WP_000533402.1|4635725_4636139_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082417.1|4636119_4638681_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.5	0.0e+00
WP_000847298.1|4638677_4639007_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001328631.1|4639006_4639705_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	3.2e-128
WP_000194723.1|4639715_4640459_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_032300536.1|4640404_4641037_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	4.2e-103
WP_000514726.1|4641380_4645073_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	86.0	0.0e+00
WP_001233148.1|4645140_4645740_+	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
WP_000216486.1|4645891_4648918_+	membrane protein	NA	A0A0K2FIZ6	Escherichia_phage	54.6	1.4e-55
WP_000885577.1|4648917_4649502_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_000240999.1|4649556_4650225_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937481.1|4650281_4650548_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.8	1.5e-17
WP_000799406.1|4650779_4651643_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|4651626_4652763_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_001522887.1|4653012_4654239_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|4654287_4655409_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000735412.1|4655484_4656945_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|4656944_4657616_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|4657785_4659156_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|4659159_4659801_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000004751.1|4659836_4660943_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001522894.1|4660996_4661458_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_100190797.1|4661467_4662106_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000246191.1|4662438_4662774_-	DUF1493 family protein	NA	NA	NA	NA	NA
WP_000381622.1|4662773_4663223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001522898.1|4663805_4665056_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.1	6.5e-23
WP_020232865.1|4665158_4665482_-	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	62.6	6.3e-39
WP_019842521.1|4666024_4666135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001522899.1|4666187_4666592_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332298.1|4666812_4667544_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	3.5e-53
>prophage 345
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4673089	4675753	5107874		Escherichia_phage(100.0%)	1	NA	NA
WP_001522908.1|4673089_4675753_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	42.0	2.2e-84
>prophage 346
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4687369	4689057	5107874		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|4687369_4687789_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001522918.1|4687788_4689057_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.2	8.7e-209
>prophage 347
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4707013	4707772	5107874		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_029701750.1|4707013_4707772_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.9	2.0e-14
>prophage 348
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4723640	4726392	5107874		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033363.1|4723640_4725320_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	7.9e-24
WP_001298109.1|4725444_4726392_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 349
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4729528	4733536	5107874		Pseudomonas_phage(50.0%)	5	NA	NA
WP_000804726.1|4729528_4730611_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456570.1|4730610_4731444_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200377.1|4731440_4731833_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|4731836_4732646_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|4732681_4733536_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
>prophage 350
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4736812	4737043	5107874		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_001146444.1|4736812_4737043_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 351
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4748177	4758900	5107874		Escherichia_phage(25.0%)	10	NA	NA
WP_000702660.1|4748177_4749716_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571694.1|4749712_4750423_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|4750422_4751100_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555849.1|4752537_4753380_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001314642.1|4753429_4753888_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|4754000_4754906_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193447.1|4754997_4756011_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|4756212_4757121_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|4757265_4757679_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068076.1|4758282_4758900_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	7.8e-54
>prophage 352
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4767311	4769326	5107874		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110954.1|4767311_4768325_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|4768321_4769326_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 353
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4780990	4783948	5107874		Acinetobacter_phage(100.0%)	2	NA	NA
WP_001523118.1|4780990_4782349_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	1.7e-37
WP_000763524.1|4782352_4783948_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
>prophage 354
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4792409	4798412	5107874	protease,transposase	Chrysochromulina_ericina_virus(33.33%)	5	NA	NA
WP_000559277.1|4792409_4793168_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_001523120.1|4793387_4794437_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000526135.1|4794616_4795075_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_001031530.1|4795183_4795435_-	YciN family protein	NA	NA	NA	NA	NA
WP_001295576.1|4795814_4798412_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
>prophage 355
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4803336	4803927	5107874		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|4803336_4803927_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 356
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4811739	4813674	5107874		Lactococcus_phage(100.0%)	1	NA	NA
WP_000484983.1|4811739_4813674_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
>prophage 357
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4822607	4824627	5107874		Salmonella_phage(50.0%)	2	NA	NA
WP_001523129.1|4822607_4823771_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	27.2	9.6e-29
WP_000573407.1|4823820_4824627_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 358
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4837417	4838683	5107874		Klosneuvirus(100.0%)	1	NA	NA
WP_000069237.1|4837417_4838683_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.8	2.7e-24
>prophage 359
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4854125	4855208	5107874		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057972.1|4854125_4855208_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 360
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4872491	4873007	5107874		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945046.1|4872491_4873007_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 361
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4882822	4941252	5107874	tail,terminase,lysis,integrase,holin,tRNA	Escherichia_phage(49.06%)	67	4873718:4873733	4916702:4916717
4873718:4873733	attL	ATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_100190652.1|4882822_4883770_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	2.4e-17
WP_000387388.1|4885086_4886070_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123748.1|4886547_4887921_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001523172.1|4888049_4888985_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040839.1|4889036_4890272_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_000079604.1|4890273_4890489_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|4890588_4890777_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_001443846.1|4890814_4890964_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_000166313.1|4891019_4891829_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_000105140.1|4891821_4894422_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_001344816.1|4894523_4894799_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_001352098.1|4894873_4895044_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|4895043_4895265_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|4895706_4896195_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|4896191_4896347_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000233809.1|4896357_4896492_-	phage protein	NA	NA	NA	NA	NA
WP_000233319.1|4896779_4897199_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|4897278_4897533_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693803.1|4897529_4897952_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001396581.1|4898029_4898818_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_020233967.1|4898824_4899571_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	1.1e-110
WP_000450716.1|4899593_4900355_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.4	3.4e-115
WP_029702111.1|4900370_4900793_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	7.4e-64
WP_000137958.1|4900954_4901458_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	39.7	4.3e-18
WP_000200358.1|4901578_4902352_-	KilA-N domain-containing protein	NA	A0A1L2BWW1	Bacteriophage	42.6	9.6e-09
WP_001445775.1|4902874_4903000_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	90.2	4.0e-10
WP_001445776.1|4903082_4903424_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000940344.1|4904291_4904891_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	2.9e-106
WP_000228032.1|4904890_4905181_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	7.4e-47
WP_000640106.1|4905177_4905720_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	76.3	5.8e-77
WP_001208722.1|4905941_4906511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001328752.1|4906479_4906782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000781775.1|4906858_4907200_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	90.1	6.2e-53
WP_023153991.1|4907203_4907680_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	5.0e-85
WP_001228696.1|4907896_4908082_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|4908278_4909736_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001291105.1|4909873_4910665_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_020233805.1|4910657_4911590_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.1e-83
WP_000126788.1|4911567_4911777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000089448.1|4911780_4912875_+	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	80.5	4.5e-113
WP_000625348.1|4912855_4914157_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_000763701.1|4914159_4915566_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	3.0e-186
WP_001363932.1|4915549_4916662_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	7.1e-114
WP_029702112.1|4916766_4917531_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	9.0e-84
4916702:4916717	attR	TTTTTATTGCTGCGAT	NA	NA	NA	NA
WP_020233804.1|4917629_4918769_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	9.7e-159
WP_000634214.1|4918991_4919387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000524260.1|4919386_4919770_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_001029815.1|4919770_4920151_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_000673077.1|4920147_4920540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001328756.1|4920566_4921529_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	38.6	8.4e-55
WP_122452218.1|4921679_4922039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032139919.1|4922146_4922347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023153989.1|4922510_4925744_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.0	7.4e-103
WP_000024051.1|4925736_4926075_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_001152432.1|4926074_4926773_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
WP_001351716.1|4926778_4927522_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	1.0e-145
WP_021523093.1|4928120_4931600_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_001542091.1|4931667_4932267_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	9.8e-102
WP_032152843.1|4932331_4934731_+|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	55.3	3.9e-133
WP_000654154.1|4934727_4935009_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.2e-17
WP_000235967.1|4935018_4935723_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
WP_000355609.1|4935733_4936027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000836768.1|4937161_4937395_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|4937463_4937577_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_029701979.1|4938180_4939464_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527786.1|4939552_4941013_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.7	5.1e-43
WP_000214712.1|4941048_4941252_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 362
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4946144	4947035	5107874		Bacillus_phage(100.0%)	1	NA	NA
WP_001523326.1|4946144_4947035_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.0	1.1e-19
>prophage 363
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4954539	4956669	5107874		Pandoravirus(50.0%)	3	NA	NA
WP_001523317.1|4954539_4955979_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	3.7e-30
WP_000803518.1|4956035_4956254_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091199.1|4956285_4956669_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 364
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4964416	4965835	5107874		Bacillus_phage(100.0%)	1	NA	NA
WP_021523089.1|4964416_4965835_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.7	6.5e-19
>prophage 365
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	4975293	4983411	5107874		Escherichia_phage(50.0%)	4	NA	NA
WP_032152842.1|4975293_4980714_+	autotransporter barrel domain-containing lipoprotein	NA	A0A2L1IV18	Escherichia_phage	39.0	8.5e-144
WP_001296726.1|4980897_4981164_+	type II toxin-antitoxin system antitoxin HipB	NA	NA	NA	NA	NA
WP_021523084.1|4981163_4981859_+	protein hipA	NA	NA	NA	NA	NA
WP_001551127.1|4982058_4983411_-	SIR2 family protein	NA	Q38324	Lactococcus_phage	30.6	5.6e-20
>prophage 366
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	5007222	5014158	5107874		Bacillus_phage(50.0%)	3	NA	NA
WP_001523278.1|5007222_5008908_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.8	2.2e-10
WP_001523277.1|5008945_5011318_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_023153758.1|5011362_5014158_+	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.8	1.7e-18
>prophage 367
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	5019437	5023244	5107874		Bacillus_virus(50.0%)	2	NA	NA
WP_000426279.1|5019437_5020820_+	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
WP_157787590.1|5020844_5023244_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.2e-09
>prophage 368
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	5027560	5029466	5107874		Planktothrix_phage(100.0%)	2	NA	NA
WP_001523266.1|5027560_5028547_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	3.8e-18
WP_001523264.1|5028539_5029466_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.2	5.9e-13
>prophage 369
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	5032739	5034180	5107874		Tupanvirus(50.0%)	2	NA	NA
WP_000642407.1|5032739_5033750_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
WP_000781370.1|5033895_5034180_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 370
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	5040904	5042005	5107874		Enterobacteria_phage(100.0%)	2	NA	NA
WP_048218999.1|5040904_5041138_+	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	66.7	5.6e-21
WP_075208424.1|5041195_5042005_+	porin	NA	Q1MVN1	Enterobacteria_phage	65.4	2.7e-102
>prophage 371
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	5048667	5050212	5107874		Escherichia_phage(100.0%)	1	NA	NA
WP_001523255.1|5048667_5050212_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 372
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	5054800	5065631	5107874		Tetraselmis_virus(25.0%)	5	NA	NA
WP_001523249.1|5054800_5056777_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	44.1	1.5e-159
WP_020233927.1|5056871_5057921_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	38.0	3.1e-18
WP_021523077.1|5058851_5059250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032153651.1|5059250_5063456_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.9	4.9e-22
WP_001523247.1|5063522_5065631_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.6	5.3e-25
>prophage 373
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	5070526	5072629	5107874		Salmonella_phage(100.0%)	1	NA	NA
WP_001523241.1|5070526_5072629_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	66.2	9.6e-136
>prophage 374
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	5079762	5086812	5107874		Mycoplasma_phage(25.0%)	7	NA	NA
WP_001523231.1|5079762_5080776_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
WP_020233879.1|5080793_5081939_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001523229.1|5082183_5083590_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001270286.1|5083668_5084085_-	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_001306887.1|5084130_5084307_-	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	2.1e-12
WP_000494241.1|5084528_5084759_+	YncJ family protein	NA	NA	NA	NA	NA
WP_024166512.1|5084850_5086812_-	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	27.9	1.6e-23
>prophage 375
NZ_CP024862	Escherichia coli strain AR_0015, complete genome	5107874	5100704	5101653	5107874		Moraxella_phage(50.0%)	2	NA	NA
WP_000731851.1|5100704_5100878_-	hypothetical protein	NA	A0A0R6PI25	Moraxella_phage	59.6	4.4e-07
WP_001390056.1|5101122_5101653_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	43.9	2.0e-18
>prophage 1
NZ_CP024863	Escherichia coli strain AR_0015 plasmid unitig_1_pilon, complete sequence	139059	12761	128958	139059	integrase,protease,transposase	Escherichia_phage(38.46%)	109	73586:73645	85637:88322
WP_085947770.1|12761_14131_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_001276232.1|14290_15010_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845940.1|15006_15441_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_000117179.1|15495_17454_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.4	1.3e-22
WP_000005990.1|17519_17753_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_042045560.1|17815_18313_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	72.3	3.3e-39
WP_000936285.1|18462_20364_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.1	3.1e-32
WP_032143370.1|21249_21438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001348622.1|21658_21871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001348621.1|21896_22460_-	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	1.0e-20
WP_000170714.1|22507_23869_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_000218642.1|23920_24151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001027516.1|25185_25377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271753.1|25373_25796_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001671341.1|25842_26145_-	antirestriction protein	NA	NA	NA	NA	NA
WP_000274437.1|27511_27946_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104873.1|27959_28181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000086185.1|28181_28865_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
WP_001348615.1|29249_30152_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000817036.1|31018_31990_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	99.4	7.0e-174
WP_000772446.1|31989_33156_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000852146.1|33743_34499_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
WP_000016982.1|35272_36079_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_001159868.1|36079_36385_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_023909027.1|36386_36605_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_000215657.1|37238_37436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000642771.1|37432_37717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545983.1|37736_38870_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_023909028.1|39132_42252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261287.1|42558_42789_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044768.1|42785_43202_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_000350635.1|43363_45502_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000246636.1|45966_46962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991832.1|46965_47898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031311986.1|48945_52062_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	2.9e-27
WP_001617890.1|52183_53467_-	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	26.5	2.2e-10
WP_001553856.1|53463_55020_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.5	7.1e-104
WP_001190712.1|55202_55424_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216034.1|55423_55804_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001513661.1|55808_55988_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001513660.1|56015_56375_+	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
WP_000361610.1|57507_58485_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_001066942.1|58769_59510_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_032156742.1|59630_59756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072355.1|60955_62125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086258557.1|62320_62515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001322387.1|63366_63993_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089068.1|64071_65277_+	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_000428546.1|65389_65983_-	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001067858.1|67277_67982_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001389366.1|68739_69213_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000503573.1|69343_70132_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_000679427.1|70337_70685_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|70678_71518_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|71645_71849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|72423_73128_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_100190803.1|73104_73572_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	59.5	1.0e-34
73586:73645	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067855.1|73637_74342_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_100190806.1|74943_75477_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.6	2.0e-13
WP_001067855.1|75501_76206_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_100190803.1|76271_76739_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	59.5	1.0e-34
WP_001067858.1|76715_77420_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001389366.1|78177_78651_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000503573.1|78781_79570_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_000679427.1|79775_80123_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|80116_80956_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|81083_81287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|81861_82566_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_100190803.1|82542_83010_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	59.5	1.0e-34
WP_001067855.1|83075_83780_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_100190806.1|83804_84338_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.6	2.0e-13
WP_001067855.1|84939_85644_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|85787_86342_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|86472_87303_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_001067855.1|87934_88639_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
85637:88322	attR	AAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCTTTAAGCGTGCATAATAAGCCCTACACAAATTGGGAGTTAGACATCATGAGCAACGCAAAAACAAAGTTAGGCATCACAAAGTACAGCATCGTGACCAACAGCAACGATTCCGTCACACTGCGCCTCATGACTGAGCATGACCTTGCGATGCTCTATGAGTGGCTAAATCGATCTCATATCGTCGAGTGGTGGGGCGGAGAAGAAGCACGCCCGACACTTGCTGACGTACAGGAACAGTACTTGCCAAGCGTTTTAGCGCAAGAGTCCGTCACTCCATACATTGCAATGCTGAATGGAGAGCCGATTGGGTATGCCCAGTCGTACGTTGCTCTTGGAAGCGGGGACGGACGGTGGGAAGAAGAAACCGATCCAGGAGTACGCGGAATAGACCAGTTACTGGCGAATGCATCACAACTGGGCAAAGGCTTGGGAACCAAGCTGGTTCGAGCTCTGGTTGAGTTGCTGTTCAATGATCCCGAGGTCACCAAGATCCAAACGGACCCGTCGCCGAGCAACTTGCGAGCGATCCGATGCTACGAGAAAGCGGGGTTTGAGAGGCAAGGTACCGTAACCACCCCATATGGTCCAGCCGTGTACATGGTTCAAACACGCCAGGCATTCGAGCGAACACGCAGTGATGCCTAACCCTTCCATCGAGGGGGACGTCCAAGGGCTGGCGCCCTTGGCCGCCCCTCATGTCAAACGTTGGGCGAACCCGGAGCCTCATTAATTGTTAGCCGTTAAAATTAAGCCCTTTACCAAACCAATACTTATTATGAAAAACACAATACATATCAACTTCGCTATTTTTTTAATAATTGCAAATATTATCTACAGCAGCGCCAGTGCATCAACAGATATCTCTACTGTTGCATCTCCATTATTTGAAGGAACTGAAGGTTGTTTTTTACTTTACGATGCATCCACAAACGCTGAAATTGCTCAATTCAATAAAGCAAAGTGTGCAACGCAAATGGCACCAGATTCAACTTTCAAGATCGCATTATCACTTATGGCATTTGATGCGGAAATAATAGATCAGAAAACCATATTCAAATGGGATAAAACCCCCAAAGGAATGGAGATCTGGAACAGCAATCATACACCAAAGACGTGGATGCAATTTTCTGTTGTTTGGGTTTCGCAAGAAATAACCCAAAAAATTGGATTAAATAAAATCAAGAATTATCTCAAAGATTTTGATTATGGAAATCAAGACTTCTCTGGAGATAAAGAAAGAAACAACGGATTAACAGAAGCATGGCTCGAAAGTAGCTTAAAAATTTCACCAGAAGAACAAATTCAATTCCTGCGTAAAATTATTAATCACAATCTCCCAGTTAAAAACTCAGCCATAGAAAACACCATAGAGAACATGTATCTACAAGATCTGGATAATAGTACAAAACTGTATGGGAAAACTGGTGCAGGATTCACAGCAAATAGAACCTTACAAAACGGATGGTTTGAAGGGTTTATTATAAGCAAATCAGGACATAAATATGTTTTTGTGTCCGCACTTACAGGAAACTTGGGGTCGAATTTAACATCAAGCATAAAAGCCAAGAAAAATGCGATCACCATTCTAAACACACTAAATTTATAAAAAATCTAATGGCAAAATCGCCCAACCCTTCAATCAAGTCGGGACGGCCAAAAGCAAGCTTTTGGCTCCCCTCGCTGGCGCTCGGCGCCCCTTATTTCAAACGTTAGACGGCAAAGTCACAGACCGCGGGATCTCTTATGACCAACTACTTTGATAGCCCCTTCAAAGGCAAGCTGCTTTCTGAGCAAGTGAAGAACCCCAATATCAAAGTTGGGCGGTACAGCTATTACTCTGGCTACTATCATGGGCACTCATTCGATGACTGCGCACGGTATCTGTTTCCGGACCGTGATGACGTTGATAAGTTGATCATCGGTAGTTTCTGCTCTATCGGGAGTGGGGCTTCCTTTATCATGGCTGGCAATCAGGGGCATCGGTACGACTGGGCATCATCTTTCCCGTTCTTTTATATGCAGGAAGAACCTGCATTCTCAAGCGCACTCGATGCCTTCCAAAAAGCAGGTAATACTGTCATTGGCAATGACGTTTGGATCGGCTCTGAGGCAATGGTCATGCCCGGAATCAAGATCGGGCACGGTGCGGTGATAGGCAGCCGCTCGTTGGTGACAAAAGATGTGGGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAG	NA	NA	NA	NA
WP_001393253.1|90960_91293_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000239590.1|91339_92215_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001067858.1|92524_93229_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000027057.1|93813_94674_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001347546.1|94823_95249_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|95260_95965_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|96086_96992_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|96988_98227_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|98226_98811_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|99303_100068_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001067855.1|100207_100912_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_100190804.1|100972_101809_-	APH(6)-I family aminoglycoside O-phosphotransferase	NA	NA	NA	NA	NA
WP_001082319.1|101808_102612_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043265.1|102672_103488_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
WP_000240536.1|103795_104647_-	replication protein	NA	NA	NA	NA	NA
WP_001067855.1|105402_106107_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000134999.1|107066_107708_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000147567.1|108280_108841_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000027057.1|111461_112322_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067858.1|112404_113109_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_072199528.1|113142_114009_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	100.0	1.3e-163
WP_000557454.1|116295_117156_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000587837.1|117168_117711_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|118192_118384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001330846.1|118389_118635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837927.1|118685_119813_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|119849_120554_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001553819.1|120819_123717_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_001398199.1|123853_124255_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|124187_124445_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|124537_125191_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000130640.1|126130_126988_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_031943482.1|126980_127055_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_002431311.1|127416_128958_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
>prophage 1
NZ_CP024865	Escherichia coli strain AR_0015 plasmid unitig_3_pilon, complete sequence	48511	0	47448	48511	capsid,holin,protease,tail,head,portal,plate	Vibrio_phage(32.43%)	66	NA	NA
WP_001019009.1|810_1362_-	hypothetical protein	NA	K4ICN8	Acidithiobacillus_phage	29.4	1.7e-07
WP_001185429.1|1361_1952_-	ParB N-terminal domain-containing protein	NA	A0A067ZI74	Vibrio_phage	58.5	1.6e-40
WP_001705017.1|2508_3204_-	hypothetical protein	NA	A0A1W6JTE1	Pseudomonas_phage	33.8	1.3e-28
WP_004105305.1|3244_4618_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000160645.1|4617_5241_-	ParB N-terminal domain-containing protein	NA	A0A0E3JS81	Verrucomicrobia_phage	43.2	4.1e-34
WP_001523049.1|5475_5886_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	78.6	4.7e-39
WP_001673398.1|6274_6574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100190844.1|6648_6846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100190845.1|6845_7115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095585649.1|7227_7815_-	S-adenosylmethionine-binding protein	NA	G9L699	Escherichia_phage	77.0	9.3e-81
WP_000147212.1|8491_8770_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	52.8	4.0e-18
WP_100190846.1|8766_9312_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	83.4	1.5e-88
WP_000254764.1|9295_9592_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	63.7	2.3e-27
WP_001271967.1|9578_9974_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	82.3	6.1e-52
WP_100190847.1|10360_10876_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	58.2	3.6e-28
WP_000951710.1|10872_11082_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	94.2	8.8e-34
WP_024174960.1|11083_11272_-	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	95.2	1.2e-29
WP_001673392.1|11782_12016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100190849.1|12012_12609_-	ead/Ea22-like family protein	NA	G9L663	Escherichia_phage	67.1	3.0e-58
WP_100190858.1|12595_13222_-	hypothetical protein	NA	A0A077SLQ8	Escherichia_phage	48.6	7.4e-44
WP_100190850.1|13227_13593_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	55.9	3.1e-10
WP_000823235.1|13589_13871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086186122.1|13948_15016_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001250512.1|15184_15562_-	hypothetical protein	NA	A0A2I7R3L8	Vibrio_phage	35.1	6.3e-06
WP_001270825.1|15565_15898_-	DUF1064 domain-containing protein	NA	A8ASP7	Listeria_phage	39.8	2.9e-15
WP_001014473.1|15894_16299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000100624.1|16298_16532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001523092.1|16528_17044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001523091.1|17040_17535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000839976.1|17708_18365_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_100190851.1|18457_18832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000156167.1|18982_19636_+	ParA family protein	NA	A0A219YB79	Aeromonas_phage	32.5	9.2e-21
WP_000730008.1|19679_19928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001705001.1|21057_21249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100190852.1|21245_22388_+	hypothetical protein	NA	G9L689	Escherichia_phage	63.8	4.4e-34
WP_004105254.1|22398_22587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024171748.1|23197_23470_-	helix-turn-helix domain-containing protein	NA	A0A248SLB9	Klebsiella_phage	52.9	3.7e-08
WP_000061763.1|23533_23914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001673380.1|24181_24466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001673379.1|24499_24799_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_000269912.1|24798_25146_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000424604.1|25390_25654_-	hypothetical protein	NA	H6WRY4	Salmonella_phage	46.2	9.8e-14
WP_000356589.1|25677_25965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024171747.1|26608_27445_-	replication initiator protein RepA	NA	NA	NA	NA	NA
WP_100190859.1|28070_28616_+	transferase	NA	NA	NA	NA	NA
WP_001523080.1|28579_29197_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	80.9	3.5e-86
WP_100190853.1|29196_32043_-|tail	phage tail protein	tail	Q858V4	Yersinia_virus	46.6	1.3e-172
WP_023908964.1|32073_32655_-|tail	phage tail protein I	tail	A0A0C5AJ63	Bacteriophage	40.0	3.6e-16
WP_100190854.1|32647_33772_-|plate	baseplate J/gp47 family protein	plate	A0A0C5AEG2	Bacteriophage	43.9	1.8e-85
WP_100190855.1|33768_34089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000635200.1|34085_34553_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_001523073.1|34549_35170_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	51.6	1.0e-29
WP_004105332.1|35172_36174_-	phage late control D family protein	NA	A0A067ZG47	Vibrio_phage	42.5	1.3e-69
WP_064717798.1|36374_38507_-|tail	phage tail tape measure protein	tail	A0A097P6S4	Vibrio_phage	39.6	3.7e-18
WP_000450805.1|39321_39603_-	hypothetical protein	NA	A0A0C5AEP1	Bacteriophage	37.4	1.0e-05
WP_004105328.1|39612_40134_-|tail	phage major tail tube protein	tail	A0A067ZJA9	Vibrio_phage	57.8	1.2e-50
WP_100190856.1|40150_41614_-|tail	phage tail protein	tail	A0A059WKP9	Vibrio_phage	53.2	7.8e-145
WP_001284546.1|41613_41904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609134.1|41904_42390_-	hypothetical protein	NA	A0A067ZIL8	Vibrio_phage	37.4	3.0e-16
WP_004105322.1|42386_42731_-	ATP-binding sugar transporter from pro-phage family protein	NA	NA	NA	NA	NA
WP_001523066.1|42730_43123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100190857.1|43123_44167_-|capsid	major capsid protein	capsid	A0A059WRQ2	Vibrio_phage	47.9	8.8e-74
WP_004105317.1|44187_44571_-|head	bacteriophage lambda head decoration D family protein	head	NA	NA	NA	NA
WP_032150711.1|44580_45648_-|protease	Clp protease ClpP	protease	A0A067ZG37	Vibrio_phage	48.2	1.3e-77
WP_097324547.1|45637_47212_-|portal	phage portal protein	portal	A0A067ZJA4	Vibrio_phage	65.5	1.6e-191
WP_001523057.1|47208_47448_-	hypothetical protein	NA	A0A067ZJ01	Vibrio_phage	52.0	6.8e-14
