The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023345	Salmonella enterica subsp. diarizonae strain HZS154 chromosome, complete genome	5087369	1313704	1352919	5087369	integrase,lysis,head,portal,plate,holin,capsid,tail	Salmonella_phage(30.56%)	56	1313404:1313459	1352997:1353052
1313404:1313459	attL	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCAT	NA	NA	NA	NA
WP_004157630.1|1313704_1313860_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	78.4	1.2e-16
WP_023222894.1|1313888_1314290_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	50.0	8.1e-36
WP_140428317.1|1314545_1315040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088759824.1|1315138_1315408_-	late control protein B	NA	Q53ZE7	Salmonella_virus	56.1	5.3e-15
WP_079791540.1|1315450_1316596_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	53.7	1.1e-101
WP_100212325.1|1316598_1317123_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	61.4	2.2e-41
WP_100212326.1|1317126_1320150_-	hypothetical protein	NA	A4JWX4	Burkholderia_virus	27.6	4.8e-64
WP_088759827.1|1320142_1320265_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_100212517.1|1320279_1320591_-|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	50.5	1.7e-17
WP_088759828.1|1320652_1321168_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	61.0	5.9e-55
WP_100212327.1|1321180_1322359_-|tail	phage tail sheath protein	tail	A0A2H4JCP8	uncultured_Caudovirales_phage	63.9	6.3e-145
WP_079791546.1|1322504_1322879_-	DUF1353 domain-containing protein	NA	A0A0A8J9K3	Ralstonia_phage	41.9	6.4e-19
WP_100212328.1|1323141_1323768_+	hypothetical protein	NA	U3TM45	Ralstonia_phage	29.0	2.1e-14
WP_100212329.1|1323770_1324361_+	DUF4376 domain-containing protein	NA	A0A0K1LK46	Vibrio_phage	38.3	6.2e-16
WP_140711270.1|1324404_1324998_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	60.6	4.1e-36
WP_100212518.1|1325000_1326638_-	hypothetical protein	NA	Q6K1H2	Salmonella_virus	49.1	3.7e-34
WP_100212330.1|1327204_1327732_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	61.5	1.1e-56
WP_100212331.1|1327728_1328634_-|plate	baseplate assembly protein	plate	A0A0M4REB7	Salmonella_phage	54.7	8.7e-86
WP_100212332.1|1328637_1328979_-|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	50.9	3.9e-23
WP_100212333.1|1328978_1329692_-|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	40.9	5.3e-38
WP_100212334.1|1329780_1330215_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	38.0	2.8e-18
WP_100212335.1|1330211_1330670_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	31.3	7.2e-12
WP_100212336.1|1330965_1331436_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	83.0	4.2e-60
WP_100212337.1|1331432_1332395_-	site-specific DNA-methyltransferase	NA	A0A088FRS2	Escherichia_phage	52.2	1.8e-89
WP_100212338.1|1332391_1332805_-	structural protein	NA	A0A0E3GMJ2	Enterobacteria_phage	54.3	4.3e-40
WP_079791562.1|1332801_1333149_-|holin	holin	holin	NA	NA	NA	NA
WP_100212339.1|1333176_1333380_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	52.4	3.7e-13
WP_100212340.1|1333379_1333862_-|head	head completion/stabilization protein	head	M1SNN6	Escherichia_phage	39.2	4.6e-25
WP_100212341.1|1333966_1334608_-	hypothetical protein	NA	A0A1S5NNA5	Burkholderia_phage	42.3	4.0e-37
WP_100212342.1|1334610_1335684_-|capsid	phage major capsid protein, P2 family	capsid	E5FFI6	Burkholderia_phage	55.0	9.6e-100
WP_157819166.1|1335692_1336496_-|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	38.5	2.4e-42
WP_100212344.1|1336650_1338396_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	55.0	3.6e-181
WP_100212345.1|1338395_1339439_+|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	60.2	6.9e-119
WP_100212346.1|1339664_1339910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023221990.1|1339909_1340269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100212347.1|1340381_1340912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100212348.1|1341075_1341426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100212349.1|1341433_1341895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100212350.1|1341887_1344185_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	59.9	5.0e-239
WP_100212351.1|1344181_1344574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100212352.1|1344646_1344883_-	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	58.9	3.1e-11
WP_157819167.1|1345187_1345808_-	AsnC family protein	NA	NA	NA	NA	NA
WP_100212354.1|1345735_1346674_-	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	50.5	2.1e-66
WP_100212355.1|1346670_1346949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100212356.1|1346945_1347479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100212357.1|1347720_1348161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100212358.1|1348236_1348428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157819168.1|1348397_1348601_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_100212360.1|1348606_1348849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100212361.1|1348942_1349650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094882118.1|1349909_1350113_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_100212362.1|1350109_1350316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100212363.1|1350401_1350782_+	helix-turn-helix transcriptional regulator	NA	Q6QID2	Burkholderia_phage	40.7	3.7e-14
WP_100212364.1|1350804_1351182_+	helix-turn-helix transcriptional regulator	NA	A4JWR8	Burkholderia_virus	53.1	1.5e-20
WP_100212365.1|1351204_1351876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100212366.1|1351893_1352919_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	61.5	2.8e-109
1352997:1353052	attR	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCAT	NA	NA	NA	NA
>prophage 2
NZ_CP023345	Salmonella enterica subsp. diarizonae strain HZS154 chromosome, complete genome	5087369	1385121	1444533	5087369	integrase,lysis,tRNA,transposase,tail	Pectobacterium_phage(14.29%)	58	1419589:1419604	1443770:1443785
WP_001025367.1|1385121_1386855_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.6	1.3e-85
WP_053508911.1|1387091_1387661_+	VOC family protein	NA	NA	NA	NA	NA
WP_023248807.1|1387680_1388427_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_063390544.1|1388732_1389704_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_023248805.1|1389700_1390444_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.9	3.2e-25
WP_023248804.1|1390484_1390880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063390543.1|1391132_1391951_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	80.3	1.5e-57
WP_023248802.1|1391947_1392514_-	hydrolase	NA	NA	NA	NA	NA
WP_053508916.1|1392838_1394611_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_053508919.1|1394713_1395166_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_023248799.1|1395195_1395939_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_023248798.1|1395973_1396495_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
WP_023248797.1|1396576_1397188_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568510.1|1397196_1398207_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.9	3.1e-07
WP_023248795.1|1398258_1399044_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_053508920.1|1399040_1399796_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	29.4	8.5e-18
WP_023248793.1|1399874_1400819_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_023248792.1|1400834_1402154_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	2.6e-14
WP_023248791.1|1402270_1403242_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_077950794.1|1403777_1409213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100212368.1|1409313_1409568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023246238.1|1409702_1411145_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_063390541.1|1411268_1412138_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063390540.1|1412479_1413955_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
WP_063390539.1|1414189_1416001_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_053508930.1|1416038_1416680_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_053528953.1|1416777_1417956_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_023246234.1|1418086_1418377_+	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_053528954.1|1418444_1418798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023178693.1|1418891_1419551_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
1419589:1419604	attL	GCGTGTCTTTTGCCAC	NA	NA	NA	NA
WP_023246232.1|1419763_1421815_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_023246231.1|1421853_1422549_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	40.4	2.8e-07
WP_023246230.1|1422572_1423229_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_023246229.1|1423335_1423566_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_023246228.1|1423703_1424078_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_072158693.1|1424078_1424954_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_053528958.1|1424970_1425321_+	YebY family protein	NA	NA	NA	NA	NA
WP_063390538.1|1425698_1426778_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	55.2	1.5e-105
WP_038390080.1|1426758_1427031_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	39.7	4.0e-10
WP_001518052.1|1427103_1427328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063390536.1|1427516_1429610_-	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	51.9	1.1e-197
WP_063390535.1|1429606_1429864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000276802.1|1429957_1430137_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	62.1	4.3e-13
WP_063390534.1|1430124_1430967_-	DNA adenine methylase	NA	A0A0K1LM14	Caulobacter_phage	49.8	1.2e-68
WP_063390533.1|1430963_1431197_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	46.2	1.2e-12
WP_001534364.1|1431231_1432062_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.0e-104
WP_100212369.1|1432054_1433635_-	exodeoxyribonuclease 8	NA	Q9QF34	Lambdoid_phage	75.6	2.2e-116
WP_063390532.1|1433970_1434795_+|tail	phage tail protein	tail	A0A0M4QWS3	Salmonella_phage	94.5	1.4e-151
WP_063390531.1|1434784_1435360_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	86.9	3.9e-92
WP_063390530.1|1435742_1436438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022742709.1|1436438_1437095_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_063390529.1|1437590_1438490_-	SMEK domain-containing protein	NA	NA	NA	NA	NA
WP_022742707.1|1438752_1439895_-	lipopolysaccharide N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_071790729.1|1440787_1440895_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_023245925.1|1441395_1441860_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_063390528.1|1442319_1442769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053529090.1|1443738_1443951_+|lysis	lysis protein	lysis	H9C183	Pectobacterium_phage	39.7	1.9e-07
1443770:1443785	attR	GCGTGTCTTTTGCCAC	NA	NA	NA	NA
WP_032695215.1|1444248_1444533_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP023345	Salmonella enterica subsp. diarizonae strain HZS154 chromosome, complete genome	5087369	1506308	1592082	5087369	integrase,lysis,protease,head,portal,tRNA,holin,capsid,terminase,tail	Enterobacteria_phage(27.03%)	98	1504945:1504959	1584931:1584945
1504945:1504959	attL	TTGCGGATATGGTGG	NA	NA	NA	NA
WP_023247711.1|1506308_1507004_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000290594.1|1507075_1507657_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_023247710.1|1507861_1509547_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	3.8e-34
WP_023247709.1|1509619_1510747_+	ribonuclease D	NA	NA	NA	NA	NA
WP_001185666.1|1510868_1511135_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_023247708.1|1511138_1511951_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_063390516.1|1511974_1512682_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_001525604.1|1512807_1513101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001519895.1|1513150_1513810_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000785857.1|1513887_1514349_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001519337.1|1514699_1514837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023247706.1|1515050_1515224_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_053528974.1|1515295_1515637_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_100212371.1|1515827_1516817_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	54.8	1.6e-101
WP_100212372.1|1516889_1517231_-	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	44.6	7.4e-14
WP_100212373.1|1517343_1517862_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_100212375.1|1518818_1519292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154807663.1|1519421_1519571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100212376.1|1519567_1519759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114048862.1|1519763_1520348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100212378.1|1520652_1520883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100212379.1|1520883_1523013_+	hypothetical protein	NA	V5UQJ3	Shigella_phage	26.3	3.0e-36
WP_100212380.1|1523009_1523405_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	39.3	4.1e-16
WP_100212381.1|1523401_1523644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100212382.1|1524104_1524320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100212383.1|1524319_1524793_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	81.6	4.6e-70
WP_100212522.1|1525150_1526194_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	62.1	5.4e-47
WP_100212384.1|1526341_1527130_+	hypothetical protein	NA	A0A286S260	Klebsiella_phage	37.1	3.1e-31
WP_100212385.1|1527136_1527766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100212386.1|1527762_1529694_+	replication endonuclease	NA	F1BUS0	Erwinia_phage	36.5	9.8e-95
WP_100212387.1|1529818_1530118_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	32.9	2.0e-07
WP_100212523.1|1530138_1531266_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	34.8	5.2e-56
WP_157819169.1|1531262_1531916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100212388.1|1532058_1532400_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_100212389.1|1532542_1533025_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_140711245.1|1534217_1534505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100212390.1|1535750_1536170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100212391.1|1536579_1536861_+	DUF4406 domain-containing protein	NA	A0A1I9KFD3	Aeromonas_phage	63.1	1.5e-23
WP_100212392.1|1536940_1537531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100212393.1|1537511_1537709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100212394.1|1537881_1538124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080070196.1|1538207_1538546_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	37.5	3.8e-10
WP_100212395.1|1538542_1538959_+	structural protein	NA	A0A0E3GMJ2	Enterobacteria_phage	52.8	1.5e-40
WP_100212396.1|1539188_1539653_+|lysis	lysis protein	lysis	S4TNN7	Salmonella_phage	73.4	1.4e-55
WP_100212397.1|1539922_1540216_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	63.7	7.8e-28
WP_100212398.1|1540212_1540551_+	hypothetical protein	NA	S4TTH3	Salmonella_phage	56.0	5.1e-23
WP_100212399.1|1540553_1540907_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	70.3	2.9e-45
WP_100212400.1|1541109_1541574_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.5	2.6e-46
WP_100212401.1|1541527_1543267_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.8	1.0e-138
WP_100212524.1|1543272_1544598_+|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	50.5	8.2e-117
WP_100212402.1|1544573_1545278_+|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	63.5	8.0e-71
WP_100212403.1|1545287_1546514_+|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	62.7	1.2e-130
WP_100212404.1|1546578_1546941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100212405.1|1546948_1547284_+|head,tail	phage gp6-like head-tail connector protein	head,tail	G3ENA1	Psychrobacter_phage	31.8	1.7e-07
WP_100212406.1|1547300_1547630_+|head,tail	head-tail adaptor protein	head,tail	A0A1B5FP90	Escherichia_phage	37.8	1.1e-09
WP_100212407.1|1547619_1548150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100212408.1|1548142_1548508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100212409.1|1548500_1549229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100212410.1|1549237_1549594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100212411.1|1549808_1552289_+	hypothetical protein	NA	A0A0E3GMH8	Enterobacteria_phage	27.6	2.4e-29
WP_100212412.1|1552294_1552624_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	43.5	1.1e-22
WP_070790214.1|1552782_1553919_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	2.3e-112
WP_100212413.1|1554060_1554612_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	68.8	1.7e-63
WP_100212414.1|1554617_1555355_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	76.4	1.8e-113
WP_100212415.1|1555252_1556002_+|tail	tail assembly protein	tail	S5MDP1	Escherichia_phage	63.5	1.2e-61
WP_100212416.1|1556107_1559326_+|tail	phage tail protein	tail	A5LH43	Enterobacteria_phage	51.5	2.5e-300
WP_100212417.1|1559335_1559692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100212418.1|1559691_1560444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100212419.1|1560637_1560790_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_100212420.1|1560914_1562813_+	hypothetical protein	NA	J9Q6E3	Salmonella_phage	61.1	1.9e-21
WP_100212421.1|1562812_1563334_+	hypothetical protein	NA	J9Q7Y6	Salmonella_phage	34.6	2.5e-13
WP_080169491.1|1563393_1563627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139775185.1|1563644_1564040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100212422.1|1564049_1564628_+	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	52.8	9.9e-43
WP_085425567.1|1564751_1565105_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	39.8	1.2e-14
WP_100212423.1|1566726_1567206_-	heme-binding protein	NA	NA	NA	NA	NA
WP_100212424.1|1567586_1568150_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	67.2	4.5e-64
WP_100212425.1|1568407_1570060_+	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_100212426.1|1570119_1570659_+	phase 1 flagellin transcriptional repressor	NA	NA	NA	NA	NA
WP_000943479.1|1571453_1571984_-	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_023247703.1|1572125_1573670_-	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_023247702.1|1573888_1574608_+	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_053528975.1|1574654_1576187_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_023247700.1|1576509_1577808_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_053507883.1|1577821_1578892_+	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_023247698.1|1578955_1580689_-	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_063390515.1|1580784_1581699_-	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_023247696.1|1581937_1582549_+	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_023247695.1|1582562_1583297_-	flagellar brake protein YcgR	NA	NA	NA	NA	NA
WP_053528977.1|1583465_1583720_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_023247693.1|1583782_1585495_-	alpha,alpha-trehalase	NA	NA	NA	NA	NA
1584931:1584945	attR	CCACCATATCCGCAA	NA	NA	NA	NA
WP_001664093.1|1585708_1586983_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_023247692.1|1587377_1587467_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_063390514.1|1587479_1588616_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_053528978.1|1588627_1590172_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_053528979.1|1590246_1591095_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_023247688.1|1591091_1591496_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000993796.1|1591485_1592082_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP023345	Salmonella enterica subsp. diarizonae strain HZS154 chromosome, complete genome	5087369	1933704	1964573	5087369	plate,bacteriocin,transposase	Shigella_phage(25.0%)	22	NA	NA
WP_077950767.1|1933704_1934559_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	55.4	6.1e-81
WP_032695215.1|1934555_1934840_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_100212434.1|1934860_1935301_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_053511082.1|1935321_1935858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053511084.1|1935951_1936245_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_077950785.1|1936253_1939850_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_053511087.1|1939854_1940379_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_053511094.1|1941795_1942413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063390450.1|1942409_1942736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063390449.1|1943160_1944930_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_063390448.1|1944964_1946572_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_063390447.1|1946679_1950051_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_063390446.1|1950043_1951252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053511103.1|1951254_1951518_-	PAAR domain-containing protein	NA	R9U4D0	Rhizobium_phage	50.0	1.2e-06
WP_149866134.1|1951780_1952038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063390444.1|1952314_1952920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077950784.1|1952916_1955136_-	hypothetical protein	NA	Q9ZXE4	Bacillus_phage	34.8	2.8e-13
WP_063390443.1|1955151_1957509_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_063390442.1|1957505_1960163_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.3	5.7e-93
WP_063390441.1|1960348_1960840_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_053511113.1|1962537_1963227_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_053511115.1|1963223_1964573_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
