The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024881	Citrobacter freundii strain AR_0022, complete genome	4919453	491375	500036	4919453	transposase	uncultured_Caudovirales_phage(37.5%)	9	NA	NA
WP_032949075.1|491375_491966_+	DUF4326 domain-containing protein	NA	A0A0S0N995	Pseudomonas_phage	43.0	4.4e-14
WP_100280114.1|493028_494197_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.1	7.1e-165
WP_032949077.1|494480_494990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003840850.1|495164_495407_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	77.9	1.5e-29
WP_071993032.1|495485_495719_+	DNA polymerase V	NA	A0A222YZE2	Escherichia_phage	81.8	6.6e-22
WP_032949079.1|495795_496494_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	67.7	3.8e-89
WP_032950850.1|496579_496900_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	3.2e-19
WP_003030760.1|498235_498661_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	7.3e-51
WP_032949081.1|499550_500036_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	34.9	3.0e-08
>prophage 2
NZ_CP024881	Citrobacter freundii strain AR_0022, complete genome	4919453	951121	1008846	4919453	transposase	Salmonella_phage(21.43%)	57	NA	NA
WP_001567368.1|951121_952525_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|952553_953186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032949282.1|954586_955108_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003843653.1|955218_955977_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_003032441.1|956109_956487_+	GFA family protein	NA	NA	NA	NA	NA
WP_003032440.1|956483_957398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032949281.1|957613_959065_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_032949280.1|959171_959699_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003836300.1|959779_960139_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_032949279.1|960138_961065_-	glutaminase B	NA	NA	NA	NA	NA
WP_032949278.1|961127_962705_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_032949277.1|962808_964197_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_032949276.1|964300_965176_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003032430.1|965398_966595_+	sugar transporter	NA	NA	NA	NA	NA
WP_003032428.1|966631_967297_-	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_003032426.1|967554_967989_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_003032424.1|968007_968391_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	3.6e-09
WP_032949274.1|968421_968640_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_003032420.1|969374_970274_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_032949271.1|970472_971660_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_003032416.1|971703_972402_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	2.6e-13
WP_032949269.1|972411_973209_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A285PWH2	Cedratvirus	26.5	3.1e-10
WP_003843623.1|973208_974282_-	urea ABC transporter permease subunit UrtC	NA	NA	NA	NA	NA
WP_003032410.1|974281_975856_-	urea ABC transporter permease subunit UrtB	NA	NA	NA	NA	NA
WP_032949268.1|975899_977171_-	urea ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003032406.1|977657_977753_+	protein MgtS	NA	NA	NA	NA	NA
WP_032949266.1|978036_978963_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.0	7.2e-19
WP_003836310.1|979160_979379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032949264.1|979667_981713_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_032949263.1|981850_982597_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_003032396.1|982683_983370_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003032393.1|983561_983765_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	2.9e-13
WP_003836323.1|983840_985307_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.4	8.4e-46
WP_003836325.1|985470_986805_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_003836327.1|986865_988080_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.9	1.9e-48
WP_003032384.1|988187_988514_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.9	2.2e-23
WP_003032382.1|988667_989009_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_003032379.1|989044_989605_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_080685897.1|989612_990323_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_100280130.1|990425_990734_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000427623.1|992460_993465_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_003100847.1|993543_994101_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_003100853.1|994094_994466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|994462_994963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100858.1|994959_995286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000215515.1|995540_995897_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|995886_996288_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|996284_996575_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_157843596.1|996733_996898_+	DUF4158 domain-containing protein	NA	A0A1B0V7H9	Salmonella_phage	69.4	7.2e-07
WP_000427623.1|997116_998121_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_004207017.1|998199_1001184_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	54.2	3.5e-301
WP_004207019.1|1001238_1001862_-	recombinase family protein	NA	NA	NA	NA	NA
WP_008786570.1|1002287_1003766_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.6	8.6e-200
WP_004207021.1|1003784_1004612_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	42.0	3.0e-53
WP_004207022.1|1004672_1005668_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	41.6	8.9e-07
WP_000427623.1|1006016_1007021_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000427623.1|1007841_1008846_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP024881	Citrobacter freundii strain AR_0022, complete genome	4919453	1186010	1202748	4919453	tRNA	Tupanvirus(16.67%)	18	NA	NA
WP_003030561.1|1186010_1186790_+	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	27.3	1.2e-11
WP_032949134.1|1186786_1188229_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.3	7.7e-52
WP_003836643.1|1188290_1189004_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003836644.1|1189320_1189785_-	lipoprotein nlpC	NA	A0A1V0DZX6	Clostridioides_phage	38.2	3.5e-14
WP_003030567.1|1189862_1190612_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	9.3e-09
WP_003030569.1|1190611_1191163_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_003832584.1|1191223_1192204_-	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	6.7e-15
WP_003030571.1|1192357_1192657_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_003030574.1|1192661_1195049_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003832580.1|1195064_1196048_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_152659856.1|1196247_1196379_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_003030578.1|1196417_1196774_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_003030583.1|1196829_1197027_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_048997935.1|1197123_1197666_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	8.2e-15
WP_032949132.1|1197669_1199598_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.8	9.7e-127
WP_032950860.1|1199993_1200356_+	GtrA family protein	NA	B9UDL8	Salmonella_phage	71.7	3.6e-43
WP_032949131.1|1200352_1201270_+	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	91.7	1.9e-160
WP_032949129.1|1201272_1202748_+	hypothetical protein	NA	A0A192Y7W8	Salmonella_phage	26.3	1.1e-34
>prophage 4
NZ_CP024881	Citrobacter freundii strain AR_0022, complete genome	4919453	1486585	1494620	4919453		Enterobacteria_phage(33.33%)	8	NA	NA
WP_032949590.1|1486585_1487692_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	31.0	2.9e-43
WP_032949591.1|1487695_1488229_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_032949592.1|1488218_1488617_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_032949593.1|1488623_1489493_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	68.8	5.2e-112
WP_032949594.1|1489492_1490578_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	7.4e-100
WP_032949595.1|1490951_1491845_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	40.3	4.3e-45
WP_032949596.1|1492082_1493078_-	SDR family oxidoreductase	NA	A0A0K1L6Z1	Scale_drop_disease_virus	28.5	1.1e-09
WP_032949597.1|1493225_1494620_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.8	1.7e-19
>prophage 5
NZ_CP024881	Citrobacter freundii strain AR_0022, complete genome	4919453	1536463	1546042	4919453	tRNA,protease	Bacillus_phage(28.57%)	8	NA	NA
WP_003844344.1|1536463_1537867_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.2	5.0e-32
WP_003036797.1|1537863_1538586_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
WP_032936697.1|1538721_1539054_+	YegP family protein	NA	NA	NA	NA	NA
WP_003844346.1|1539213_1540575_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	92.9	4.1e-204
WP_003036804.1|1540845_1543122_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
WP_003036810.1|1543152_1543473_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_003036813.1|1543796_1544021_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
WP_032949617.1|1544095_1546042_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.3	1.6e-39
>prophage 6
NZ_CP024881	Citrobacter freundii strain AR_0022, complete genome	4919453	1584278	1592697	4919453	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_032949635.1|1584278_1586312_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	5.2e-54
WP_003027345.1|1586518_1586977_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	68.0	5.6e-49
WP_003027346.1|1587019_1587490_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	76.9	4.9e-64
WP_003027347.1|1587536_1588256_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_003027348.1|1588252_1589938_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.6	6.7e-281
WP_032949636.1|1590163_1590895_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	93.0	1.4e-105
WP_003027354.1|1590946_1591054_+	protein YohO	NA	NA	NA	NA	NA
WP_032949637.1|1591034_1591766_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_032949638.1|1591749_1592697_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.1	2.6e-08
>prophage 7
NZ_CP024881	Citrobacter freundii strain AR_0022, complete genome	4919453	1943806	1989413	4919453	integrase,holin,terminase,tail	Salmonella_phage(62.22%)	52	1934737:1934752	1993092:1993107
1934737:1934752	attL	GACCTTCACCGCCAGC	NA	NA	NA	NA
WP_071524479.1|1943806_1944010_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	71.4	4.3e-17
WP_032937867.1|1944374_1945253_+	small-conductance mechanosensitive channel MscS	NA	NA	NA	NA	NA
WP_100280158.1|1945475_1945958_-	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	73.8	3.0e-53
WP_100280159.1|1945954_1946581_-	glycoside hydrolase family 19 protein	NA	T1SBJ3	Salmonella_phage	95.7	1.5e-113
WP_100280160.1|1946570_1946879_-|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	97.1	1.1e-48
WP_001275998.1|1946865_1947270_-	membrane protein	NA	T1SA79	Salmonella_phage	100.0	9.9e-66
WP_100280303.1|1947427_1947790_+	GtrA family protein	NA	B9UDL8	Salmonella_phage	95.0	5.4e-55
WP_100280161.1|1947786_1948716_+	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	91.7	5.5e-160
WP_157843598.1|1948657_1950151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100280163.1|1950177_1952226_-|tail	phage tail protein	tail	G9L6E4	Escherichia_phage	47.8	5.8e-154
WP_003037891.1|1952423_1952684_+	hypothetical protein	NA	T1SA06	Salmonella_phage	87.2	4.8e-37
WP_100280164.1|1953004_1953706_+	BRO-like protein	NA	A0A193GYJ9	Enterobacter_phage	57.3	2.2e-68
WP_057069798.1|1953990_1954434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071596422.1|1954545_1955223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003037884.1|1955253_1958145_-	hypothetical protein	NA	G9L6D4	Escherichia_phage	74.9	0.0e+00
WP_003037881.1|1958144_1960835_-	transglycosylase SLT domain-containing protein	NA	G9L6D3	Escherichia_phage	68.3	0.0e+00
WP_100280165.1|1960834_1961416_-	hypothetical protein	NA	Q858G1	Salmonella_phage	97.0	3.6e-61
WP_100280166.1|1961415_1961880_-	hypothetical protein	NA	T1SA73	Salmonella_phage	96.8	7.6e-86
WP_100280167.1|1961879_1964357_-	hypothetical protein	NA	Q858G3	Salmonella_phage	97.8	0.0e+00
WP_000179045.1|1964356_1964962_-	hypothetical protein	NA	T1SAQ2	Salmonella_phage	99.0	6.8e-111
WP_003037867.1|1964961_1965285_-	hypothetical protein	NA	A0A193GYH8	Enterobacter_phage	72.8	1.7e-36
WP_100280168.1|1965336_1965717_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	51.2	1.4e-24
WP_000599566.1|1965727_1966168_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	89.7	7.0e-65
WP_100280169.1|1966219_1967206_-	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	86.3	6.6e-164
WP_100280170.1|1967220_1967925_-	peptidase	NA	Q858G9	Salmonella_phage	86.9	1.1e-72
WP_100280171.1|1967927_1968224_-	hypothetical protein	NA	T1SBI9	Salmonella_phage	95.9	2.9e-46
WP_100280172.1|1968220_1969891_-|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	99.1	0.0e+00
WP_000334867.1|1969905_1970112_-	hypothetical protein	NA	T1SA67	Salmonella_phage	100.0	5.7e-09
WP_100280173.1|1971301_1971721_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	73.6	6.1e-42
WP_000123109.1|1971767_1973249_-	hypothetical protein	NA	M1F3C4	Salmonella_phage	98.6	1.3e-293
WP_100280304.1|1973245_1973839_-|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	98.0	9.7e-102
WP_100280174.1|1973942_1974281_-	hypothetical protein	NA	Q858C6	Salmonella_phage	88.4	5.4e-49
WP_100280175.1|1975088_1975394_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	71.6	7.8e-31
WP_100280177.1|1975811_1975991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100280179.1|1976355_1976718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100280180.1|1976714_1977350_-	hypothetical protein	NA	A0A193GYL1	Enterobacter_phage	40.9	1.4e-21
WP_003847152.1|1977406_1977871_-	hypothetical protein	NA	Q858D2	Salmonella_phage	98.1	1.4e-79
WP_100280305.1|1977991_1978807_-	Pyocin large subunit	NA	T1SA92	Salmonella_phage	97.4	6.5e-149
WP_100280181.1|1978796_1979471_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	85.3	3.1e-112
WP_001278768.1|1979809_1980043_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	100.0	1.2e-39
WP_097514579.1|1980198_1980795_+	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	99.0	1.0e-106
WP_100280183.1|1981165_1981468_+	hypothetical protein	NA	T1SA88	Salmonella_phage	96.0	2.5e-45
WP_100280184.1|1981464_1982286_+	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	97.1	3.5e-158
WP_100280185.1|1982282_1983242_+	recombinase RecT	NA	A0A193GYL3	Enterobacter_phage	83.9	3.8e-148
WP_000816432.1|1983288_1983537_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	81.7	1.5e-32
WP_000041115.1|1983646_1983946_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	99.0	3.1e-48
WP_100280186.1|1983938_1984097_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	92.2	9.3e-20
WP_100280187.1|1984093_1984687_+	adenine methylase	NA	T1SA14	Salmonella_phage	95.9	1.9e-113
WP_000177704.1|1984683_1984863_+	hypothetical protein	NA	T1SA82	Salmonella_phage	100.0	2.4e-24
WP_100280188.1|1984859_1986113_-|integrase	tyrosine-type recombinase/integrase	integrase	T1S9J3	Salmonella_phage	96.9	2.9e-233
WP_003037760.1|1986305_1987883_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_003037756.1|1987946_1989413_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.5	5.7e-87
1993092:1993107	attR	GCTGGCGGTGAAGGTC	NA	NA	NA	NA
>prophage 8
NZ_CP024881	Citrobacter freundii strain AR_0022, complete genome	4919453	2487987	2532836	4919453	integrase,capsid,terminase,tail,tRNA,portal	Cronobacter_phage(48.15%)	44	2499763:2499779	2532925:2532941
WP_016239715.1|2487987_2489178_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	59.6	2.4e-136
WP_003026902.1|2489495_2490254_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A7K9	Microcystis_virus	37.3	3.2e-09
WP_032948043.1|2490420_2490975_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_003026911.1|2491052_2492570_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	1.3e-86
WP_096878465.1|2492579_2493678_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_032950023.1|2493769_2495503_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.3	1.1e-60
WP_003825520.1|2495508_2496222_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_003026928.1|2496245_2497142_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	27.9	2.5e-29
WP_003026933.1|2497255_2497777_+	flavodoxin FldB	NA	NA	NA	NA	NA
WP_003026936.1|2497821_2498229_-	membrane protein	NA	NA	NA	NA	NA
WP_003026938.1|2498209_2498476_-	FAD assembly factor SdhE	NA	NA	NA	NA	NA
WP_003026944.1|2498732_2499713_+|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
2499763:2499779	attL	TTTGTAGGCCGGATAAG	NA	NA	NA	NA
WP_003026947.1|2499806_2500466_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_003026949.1|2500628_2500940_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_003838265.1|2500992_2501721_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044713501.1|2501935_2502445_+	membrane protein	NA	NA	NA	NA	NA
WP_044713451.1|2502954_2504679_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	62.4	2.5e-174
WP_000083769.1|2504686_2505229_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	56.0	4.2e-43
WP_044713454.1|2505200_2505923_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	40.3	1.5e-40
WP_044713455.1|2505912_2506449_-|tail	tail assembly chaperone	tail	F1BUK2	Cronobacter_phage	37.7	8.1e-23
WP_006624192.1|2508701_2509295_-	phage gene	NA	F1BUK5	Cronobacter_phage	64.8	1.2e-72
WP_044713460.1|2509287_2510472_-	phage protein	NA	F1BUK6	Cronobacter_phage	69.2	1.2e-154
WP_006624195.1|2510464_2510800_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	59.6	5.6e-30
WP_044713471.1|2513008_2513713_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	57.1	3.4e-69
WP_044713472.1|2513715_2514747_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	55.5	1.2e-96
WP_044713473.1|2514770_2515820_-|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	51.1	9.3e-31
WP_044713475.1|2515997_2517809_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	54.2	6.2e-184
WP_044713477.1|2517805_2518867_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	61.0	3.0e-122
WP_000247825.1|2518914_2519190_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	57.3	3.1e-26
WP_044713479.1|2519216_2519936_-	DNA adenine methylase	NA	A0A0M4S5U3	Salmonella_phage	67.8	7.6e-85
WP_044713481.1|2520025_2520226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100280198.1|2520330_2522940_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	38.0	3.1e-128
WP_100280199.1|2522948_2523206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100280200.1|2523202_2523430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100280201.1|2523429_2523885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100280202.1|2523884_2524868_-	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	61.0	2.9e-103
WP_044713487.1|2524938_2525322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001656632.1|2525343_2525565_-	DUF2724 domain-containing protein	NA	A0A0M4S6M9	Salmonella_phage	50.0	2.2e-11
WP_024141055.1|2525603_2525864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100280307.1|2525976_2526279_+	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	54.5	1.9e-21
WP_044713489.1|2526416_2527403_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	48.9	1.5e-83
WP_032950025.1|2527630_2529064_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.5	1.1e-29
WP_032950028.1|2529157_2529901_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_032950030.1|2529962_2532836_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.0	3.4e-261
2532925:2532941	attR	TTTGTAGGCCGGATAAG	NA	NA	NA	NA
>prophage 9
NZ_CP024881	Citrobacter freundii strain AR_0022, complete genome	4919453	2672104	2713274	4919453	integrase,capsid,terminase,tail,tRNA,head,portal	Cronobacter_phage(72.22%)	49	2681673:2681719	2714055:2714101
WP_003024694.1|2672104_2673118_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.8	7.4e-110
WP_001144069.1|2673354_2673570_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003024697.1|2673807_2675553_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.8	8.4e-77
WP_003024699.1|2675912_2677760_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_157676228.1|2677772_2677973_-	DUF3156 family protein	NA	NA	NA	NA	NA
WP_032950147.1|2677921_2678971_+	YncE family protein	NA	NA	NA	NA	NA
WP_032950149.1|2678981_2680979_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	27.2	1.9e-08
WP_003024707.1|2681009_2681516_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
2681673:2681719	attL	CTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCAAA	NA	NA	NA	NA
WP_100280207.1|2681853_2682672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100280209.1|2683222_2683477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157843606.1|2683652_2685353_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	80.2	2.0e-224
WP_044713177.1|2685355_2685901_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	73.6	3.5e-66
WP_100280211.1|2685872_2686598_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	55.2	2.1e-66
WP_157843599.1|2686587_2687043_-|tail	tail fiber assembly protein	tail	Q2A0A8	Sodalis_phage	32.9	5.8e-14
WP_100280213.1|2687133_2689137_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	78.4	1.0e-147
WP_157843600.1|2689146_2689734_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	3.4e-91
WP_100280215.1|2689726_2690911_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	81.2	2.9e-182
WP_000004502.1|2690907_2691237_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	68.8	9.3e-38
WP_100280216.1|2691233_2693294_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.2	4.0e-272
WP_021293731.1|2693481_2693739_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	57.3	2.9e-18
WP_032950211.1|2693843_2694224_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	64.0	1.4e-29
WP_000175561.1|2694223_2694565_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	94.1	6.9e-52
WP_001738730.1|2694551_2694854_-	Holin from bacteriophage origin	NA	A0A0M5M1H1	Salmonella_phage	55.3	1.4e-19
WP_000044253.1|2694864_2695320_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.8	5.9e-59
WP_100280217.1|2695316_2696444_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	81.6	4.0e-173
WP_100280218.1|2696440_2697148_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	75.6	6.3e-100
WP_100280219.1|2697144_2697651_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	68.1	2.3e-64
WP_000447491.1|2697647_2698136_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	1.1e-63
WP_032950218.1|2698196_2698898_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	69.4	3.5e-90
WP_003838043.1|2698901_2699924_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.8	1.0e-159
WP_100280220.1|2699985_2700789_-|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	56.8	9.8e-81
WP_024232391.1|2700950_2702726_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	83.6	5.2e-292
WP_000038862.1|2702722_2703784_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	78.1	2.7e-163
WP_012602735.1|2703780_2704104_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	93.3	4.7e-50
WP_000364823.1|2704077_2704284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157843607.1|2704403_2706419_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.9	2.2e-299
WP_003838016.1|2706420_2706633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100280222.1|2706629_2707499_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	81.3	2.9e-131
WP_100280223.1|2707489_2707723_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_003838010.1|2707790_2708192_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	2.2e-49
WP_100280224.1|2708191_2708620_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	52.8	1.3e-26
WP_100280225.1|2708609_2708837_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_100280308.1|2708846_2709350_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	71.3	3.9e-59
WP_100280226.1|2709380_2709602_-	regulator	NA	NA	NA	NA	NA
WP_100280227.1|2709739_2710327_+	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	40.9	1.9e-33
WP_157843601.1|2710340_2711450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100280229.1|2711446_2711764_+	STAS-like domain-containing protein	NA	A0A2H4J4X6	uncultured_Caudovirales_phage	48.5	1.9e-16
WP_157843602.1|2711960_2712233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100280231.1|2712233_2713274_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	59.2	9.3e-116
2714055:2714101	attR	CTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCAAA	NA	NA	NA	NA
>prophage 10
NZ_CP024881	Citrobacter freundii strain AR_0022, complete genome	4919453	2888283	2978363	4919453	protease,tail,head,tRNA,transposase,plate	Shigella_phage(46.51%)	94	NA	NA
WP_047389403.1|2888283_2888529_+	DNA-binding protein	NA	A0A2I7S995	Vibrio_phage	50.8	3.0e-09
WP_100280237.1|2888488_2890513_+|transposase	transposase	transposase	C9DGL1	Escherichia_phage	48.1	1.5e-162
WP_047389405.1|2890580_2891531_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	42.1	1.4e-54
WP_047389407.1|2891527_2891767_+	hypothetical protein	NA	A0A0C4UQY4	Shigella_phage	40.8	4.6e-10
WP_047389409.1|2891770_2892019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047389411.1|2892008_2892533_+	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	77.0	1.5e-69
WP_052132589.1|2892617_2892884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047389415.1|2892876_2893359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047389417.1|2893355_2893796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047389420.1|2893792_2894041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052132590.1|2894037_2894844_+	hypothetical protein	NA	A0A1W6JPA7	Morganella_phage	36.8	4.5e-09
WP_047389421.1|2894843_2895056_+	hypothetical protein	NA	O64352	Escherichia_phage	65.1	1.1e-07
WP_047389422.1|2895052_2895499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047389423.1|2895488_2895986_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	44.0	3.5e-28
WP_047389424.1|2896026_2896461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047389425.1|2896532_2896952_+	positive regulator of late transcription	NA	A0A0C4UQZ9	Shigella_phage	65.9	5.9e-45
WP_047389427.1|2897066_2897570_+	lysozyme	NA	C9DGM9	Escherichia_phage	72.9	1.3e-67
WP_071698591.1|2897556_2897943_+	hypothetical protein	NA	A0A0C4UR28	Shigella_phage	47.6	2.1e-20
WP_157843604.1|2898101_2898299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052132598.1|2898318_2898597_+	DUF2730 family protein	NA	C9DGN2	Escherichia_phage	69.6	1.4e-31
WP_080753842.1|2898596_2898884_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	84.2	1.6e-38
WP_047389432.1|2898893_2899472_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	80.7	7.8e-80
WP_047389434.1|2899480_2899660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047389436.1|2899650_2899842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052132591.1|2899838_2901512_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	82.4	8.7e-265
WP_047389438.1|2901511_2903047_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	75.8	6.2e-225
WP_100280239.1|2903027_2904362_+|head	phage head morphogenesis protein	head	C9DGN7	Escherichia_phage	71.8	4.6e-184
WP_047389442.1|2904481_2904940_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	63.9	1.9e-49
WP_047389685.1|2905139_2906249_+|protease	protease	protease	C9DGP0	Escherichia_phage	64.3	3.9e-120
WP_047389444.1|2906245_2907166_+|head	head protein	head	A0A0C4UQR9	Shigella_phage	73.2	4.8e-132
WP_052132599.1|2907262_2907709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047389446.1|2907708_2908131_+	DUF1320 family protein	NA	A0A0C4UR02	Shigella_phage	62.1	1.9e-43
WP_047389447.1|2908130_2908664_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	71.0	1.3e-73
WP_047389448.1|2908660_2908879_+	DUF2635 domain-containing protein	NA	A0A0C4UR31	Shigella_phage	62.7	1.0e-08
WP_047389452.1|2908875_2910390_+|tail	tail protein	tail	C9DGP7	Escherichia_phage	65.7	4.0e-184
WP_047389454.1|2910399_2910756_+|tail	tail protein	tail	C9DGP8	Escherichia_phage	70.3	4.7e-43
WP_052132592.1|2910765_2911221_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	62.7	6.6e-42
WP_047389456.1|2911350_2913303_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	44.8	2.9e-134
WP_047389458.1|2913314_2914745_+	hypothetical protein	NA	A0A0C4UR32	Shigella_phage	46.8	1.1e-95
WP_047389460.1|2914737_2915871_+|plate	baseplate protein	plate	C9DGQ3	Escherichia_phage	67.1	1.2e-140
WP_047389461.1|2915867_2916458_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	61.7	4.0e-63
WP_047389463.1|2916454_2916892_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	69.0	6.8e-52
WP_047389464.1|2916893_2917976_+|plate	baseplate J/gp47 family protein	plate	C9DGQ6	Escherichia_phage	56.0	5.0e-112
WP_047389466.1|2917966_2918551_+	DUF2313 domain-containing protein	NA	C9DGQ7	Escherichia_phage	40.9	4.7e-32
WP_052132593.1|2918563_2919685_+	hypothetical protein	NA	A0A0C4UQS2	Shigella_phage	40.3	1.6e-17
WP_047389468.1|2919686_2920118_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	58.3	1.1e-41
WP_047389470.1|2920372_2920942_+	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	71.4	1.0e-71
WP_047389472.1|2921039_2921588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003844840.1|2921676_2924013_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.8	1.7e-40
WP_100280240.1|2924218_2925148_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	32.8	6.7e-17
WP_003839922.1|2925832_2930293_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_016151062.1|2930305_2931724_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003025099.1|2931923_2933006_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	90.0	2.2e-75
WP_003844832.1|2933143_2934394_+	cytosine permease	NA	NA	NA	NA	NA
WP_032950322.1|2934383_2935664_+	cytosine deaminase	NA	NA	NA	NA	NA
WP_003025108.1|2935722_2936190_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_032950323.1|2936192_2937062_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_032950325.1|2937168_2938659_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	24.2	1.1e-08
WP_003839909.1|2938769_2939663_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_003844825.1|2939922_2940714_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_032950327.1|2941074_2942442_+	anaerobic C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_003025130.1|2942498_2943002_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	7.3e-26
WP_003025132.1|2943007_2943646_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_003025138.1|2943962_2944355_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_003025141.1|2944370_2944799_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_003025144.1|2945017_2946145_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_003025147.1|2946337_2946736_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_003025151.1|2946904_2948272_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	2.5e-20
WP_003025154.1|2948361_2949429_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_003025158.1|2949485_2950421_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_003025162.1|2950857_2951328_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_003025165.1|2951704_2951971_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_032950328.1|2952028_2952307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003025171.1|2952426_2954394_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_003025174.1|2954399_2955332_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_003025177.1|2955339_2955543_-	AaeX family protein	NA	NA	NA	NA	NA
WP_003839896.1|2955727_2956657_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_003025183.1|2956743_2958189_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_032950330.1|2958350_2962166_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_003025190.1|2962277_2963747_-	ribonuclease G	NA	NA	NA	NA	NA
WP_003025192.1|2963736_2964330_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_003025196.1|2964337_2964826_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003025198.1|2964826_2965849_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000913396.1|2965915_2966959_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_016151068.1|2967265_2969206_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_032950332.1|2969431_2970406_+	oxidoreductase	NA	NA	NA	NA	NA
WP_003025206.1|2970525_2971530_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_032950334.1|2971530_2972130_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_003025210.1|2972522_2972993_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_003025213.1|2973003_2974353_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_003025216.1|2974460_2974703_+	YhdT family protein	NA	NA	NA	NA	NA
WP_032950336.1|2974692_2976144_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_003839878.1|2976155_2977037_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_003025224.1|2977397_2978363_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
>prophage 11
NZ_CP024881	Citrobacter freundii strain AR_0022, complete genome	4919453	4034446	4045357	4919453		Enterobacteria_phage(87.5%)	10	NA	NA
WP_032948422.1|4034446_4035022_-	hypothetical protein	NA	Q7M2A1	Enterobacteria_phage	50.8	1.9e-38
WP_032948423.1|4035038_4035281_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	59.3	1.1e-19
WP_032948425.1|4035277_4036081_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	26.5	5.1e-13
WP_016242327.1|4036633_4036900_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	64.8	2.8e-24
WP_032948426.1|4036896_4037451_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	73.9	3.9e-36
WP_032948427.1|4037443_4037743_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	69.7	5.3e-32
WP_032948429.1|4037735_4038185_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	67.3	1.7e-45
WP_032950782.1|4038289_4038517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032948430.1|4038513_4038834_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_100280269.1|4040428_4045357_+	class I SAM-dependent DNA methyltransferase	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	21.3	1.8e-28
