The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027205	Escherichia coli strain WCHEC025943 chromosome, complete genome	4817065	1083970	1097153	4817065		Escherichia_phage(50.0%)	12	NA	NA
WP_001374723.1|1083970_1084732_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	2.0e-59
WP_000254708.1|1084725_1085352_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|1085491_1086631_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1086693_1087686_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104456.1|1087779_1089144_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|1089232_1090009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001278994.1|1090013_1090652_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1090648_1091911_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1091907_1092816_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1093011_1093779_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141340.1|1093829_1094486_-	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001272924.1|1094591_1097153_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 2
NZ_CP027205	Escherichia coli strain WCHEC025943 chromosome, complete genome	4817065	1458101	1503041	4817065	lysis,terminase,portal,coat,holin,head	Enterobacteria_phage(48.28%)	64	NA	NA
WP_000194515.1|1458101_1459535_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
WP_001274871.1|1459750_1460665_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_069917121.1|1462513_1462714_-	excisionase	NA	K7P7V0	Enterobacteria_phage	98.5	2.7e-32
WP_000545745.1|1463099_1463267_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_100728198.1|1463302_1463614_-	hypothetical protein	NA	A0A1I9LJL8	Stx_converting_phage	97.1	1.1e-53
WP_097502961.1|1463788_1464406_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	56.2	9.2e-55
WP_100728197.1|1464407_1464833_-	hypothetical protein	NA	A0A077SLK5	Escherichia_phage	85.5	6.4e-31
WP_100728196.1|1464819_1465053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100728195.1|1465049_1465610_-	hypothetical protein	NA	Q76H44	Enterobacteria_phage	69.4	2.3e-60
WP_100728194.1|1465606_1465771_-	DUF2737 domain-containing protein	NA	A0A2I6PID4	Escherichia_phage	96.3	2.3e-21
WP_000855558.1|1465767_1466058_-	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	100.0	3.7e-46
WP_001111278.1|1466068_1466362_-	hypothetical protein	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
WP_000098523.1|1466375_1466882_-	single-stranded DNA-binding protein	NA	K7PHK1	Enterobacteria_phage	98.8	6.8e-80
WP_000018646.1|1466878_1467346_-	hypothetical protein	NA	A0A2I7QWC6	Vibrio_phage	62.0	1.2e-46
WP_100728193.1|1467346_1468054_-	recombinase	NA	K7PKU3	Enterobacteria_phage	99.6	2.2e-137
WP_000776961.1|1468554_1468866_-	superinfection exclusion protein	NA	A0A0N7BTN9	Escherichia_phage	98.1	4.6e-55
WP_000394299.1|1469041_1469293_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_085461547.1|1469355_1469580_-	hypothetical protein	NA	K7PJZ1	Enterobacterial_phage	98.6	8.8e-32
WP_016063037.1|1469583_1469847_-	hypothetical protein	NA	K7PKE4	Enterobacteria_phage	100.0	1.7e-29
WP_000233126.1|1470214_1470583_-	hypothetical protein	NA	K7PJJ3	Enterobacteria_phage	100.0	1.3e-56
WP_000428318.1|1470600_1471317_-	helix-turn-helix domain-containing protein	NA	K7PGR7	Enterobacteria_phage	100.0	9.2e-123
WP_000620665.1|1471423_1471618_+	hypothetical protein	NA	K7PLQ6	Enterobacteria_phage	100.0	1.8e-28
WP_053294781.1|1471726_1472005_+	hypothetical protein	NA	K7P7A2	Enterobacteria_phage	97.8	8.1e-43
WP_000166207.1|1472039_1472186_+	DUF2740 domain-containing protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000067068.1|1472178_1473039_+	replication protein	NA	K7PL20	Enterobacteria_phage	99.7	4.3e-159
WP_078233029.1|1473146_1475027_+	bifunctional DNA primase/helicase	NA	K7PK08	Enterobacteria_phage	99.7	0.0e+00
WP_012602761.1|1475086_1475545_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.3e-81
WP_000153280.1|1475541_1476069_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_001254255.1|1476065_1476242_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_074501635.1|1476244_1476604_+	DUF2591 domain-containing protein	NA	K7PH48	Enterobacterial_phage	73.3	7.5e-41
WP_100728192.1|1476596_1476773_+	protein ninF	NA	Q76H71	Enterobacteria_phage	98.3	1.5e-26
WP_085457006.1|1476765_1477377_+	recombination protein NinG	NA	A0A2D1GLP2	Escherichia_phage	98.0	8.7e-98
WP_000144614.1|1477373_1477580_+	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_100728191.1|1477557_1478229_+	serine/threonine protein phosphatase	NA	Q716B9	Shigella_phage	99.1	2.4e-133
WP_100728190.1|1478219_1478738_+	DUF1133 domain-containing protein	NA	Q716B8	Shigella_phage	97.7	5.0e-94
WP_000783734.1|1479334_1479658_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229392.1|1479641_1480118_+	lysozyme	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_100728189.1|1480114_1480552_+|lysis	lysis protein	lysis	Q716B4	Shigella_phage	97.2	2.5e-70
WP_001543881.1|1480539_1480692_+	hypothetical protein	NA	C6ZR68	Salmonella_phage	100.0	1.2e-21
WP_001059339.1|1480893_1481418_+	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	94.2	4.5e-87
WP_100728188.1|1481718_1481961_+	DUF2560 domain-containing protein	NA	A5VW77	Enterobacteria_phage	98.8	1.4e-35
WP_000729922.1|1481996_1482485_+	DNA-packaging protein gp3	NA	A0A0M3ULC0	Salmonella_phage	100.0	5.0e-88
WP_001549451.1|1482462_1483959_+|terminase	large terminase	terminase	A0A2D1GLW6	Escherichia_phage	93.8	8.2e-283
WP_100728187.1|1483958_1486160_+|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	96.8	0.0e+00
WP_100728186.1|1486250_1487144_+	scaffolding protein	NA	A0A088CPT0	Enterobacteria_phage	97.3	5.9e-127
WP_100728185.1|1487162_1488416_+|coat	coat protein	coat	A0A088CQ56	Enterobacteria_phage	98.1	2.9e-233
WP_001462613.1|1488457_1488646_+	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	98.4	6.5e-28
WP_001140510.1|1488626_1489088_+|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_100728184.1|1489097_1490516_+	hypothetical protein	NA	A0A2D1GM00	Escherichia_phage	99.2	9.2e-276
WP_021529423.1|1490518_1491013_+	hypothetical protein	NA	A0A1U9HWQ1	Salmonella_phage	46.0	5.1e-32
WP_033558932.1|1491012_1491714_+	hypothetical protein	NA	G5DA78	Enterobacteria_phage	98.3	2.5e-117
WP_053897305.1|1491713_1492169_+	hypothetical protein	NA	A0A2D1GLX4	Escherichia_phage	99.3	8.8e-87
WP_000964868.1|1492171_1492864_+	DNA transfer protein	NA	A5VW66	Enterobacteria_phage	97.8	4.4e-114
WP_100728183.1|1492874_1494260_+	acyltransferase	NA	I6RSG0	Salmonella_phage	95.4	6.3e-245
WP_100728182.1|1494259_1496077_+	DNA transfer protein	NA	A0A2H4FNB8	Salmonella_phage	97.5	3.2e-289
WP_000726435.1|1496094_1496283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000757526.1|1496313_1496679_+	hypothetical protein	NA	A0A192Y6W5	Salmonella_phage	100.0	2.1e-67
WP_052894918.1|1496692_1496917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100728181.1|1496942_1497128_+	hypothetical protein	NA	I6RSG3	Salmonella_phage	65.6	1.8e-06
WP_021557681.1|1497205_1497742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100728180.1|1497741_1497978_-	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	61.0	4.5e-18
WP_001549438.1|1498066_1498240_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_100728179.1|1498302_1499205_+	phage antirepressor Ant	NA	Q0H8C7	Salmonella_phage	97.3	4.3e-170
WP_033813223.1|1501883_1503041_-	DUF4102 domain-containing protein	NA	A5VW56	Enterobacteria_phage	99.5	4.8e-222
>prophage 3
NZ_CP027205	Escherichia coli strain WCHEC025943 chromosome, complete genome	4817065	1750462	1759904	4817065		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569361.1|1750462_1751389_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|1751393_1752125_+	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
WP_001216963.1|1752105_1752213_-	membrane protein	NA	NA	NA	NA	NA
WP_001240401.1|1752272_1753004_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1753225_1754911_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1754907_1755627_+	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_001295430.1|1755673_1756144_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1756184_1756646_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001374182.1|1756770_1758771_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001292773.1|1758767_1759904_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 4
NZ_CP027205	Escherichia coli strain WCHEC025943 chromosome, complete genome	4817065	2314200	2328303	4817065		Escherichia_phage(22.22%)	18	NA	NA
WP_000041556.1|2314200_2316627_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
WP_001307224.1|2316825_2317131_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2317238_2317949_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2317951_2318512_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2318546_2318888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000598292.1|2319022_2319349_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_071524890.1|2319385_2319574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295394.1|2319554_2320769_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836058.1|2320780_2321800_+	starvation-sensing protein RspB	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001360138.1|2321857_2321968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001344508.1|2321987_2323283_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.3	6.7e-156
WP_000005552.1|2323302_2323554_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_001372999.1|2323626_2326098_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.8	6.1e-57
WP_001083281.1|2326191_2326383_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
WP_000854559.1|2326379_2326568_-	division inhibition protein DicB	NA	NA	NA	NA	NA
WP_072163420.1|2326651_2326894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077248838.1|2326820_2327840_+	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	1.0e-58
WP_001373616.1|2327880_2328303_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	85.6	2.0e-61
>prophage 5
NZ_CP027205	Escherichia coli strain WCHEC025943 chromosome, complete genome	4817065	2739209	2749987	4817065	integrase	Enterobacteria_phage(40.0%)	11	2737182:2737205	2748690:2748713
2737182:2737205	attL	AACGGGCGTGTTATACGCCCGTTG	NA	NA	NA	NA
WP_000379042.1|2739209_2741165_-	ATPase AAA	NA	K4I1H4	Acidithiobacillus_phage	28.6	7.5e-26
WP_001753331.1|2743529_2744069_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	65.6	7.5e-61
WP_072163463.1|2744251_2744563_+	recombinase	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	2.4e-43
WP_001372461.1|2744559_2745240_+	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	5.1e-131
WP_000149533.1|2745236_2745395_+	DUF1317 domain-containing protein	NA	M1FJ61	Enterobacteria_phage	88.5	6.4e-21
WP_001678641.1|2745391_2746456_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	64.8	1.7e-133
WP_001678640.1|2746609_2746828_+	prokaryotic dksA/traR C4-type zinc finger family protein	NA	M1FQT7	Enterobacteria_phage	94.4	3.2e-34
WP_000488406.1|2746875_2747115_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000088653.1|2747254_2747491_+	excisionase	NA	NA	NA	NA	NA
WP_000741339.1|2747480_2748623_+|integrase	integrase	integrase	O21929	Phage_21	99.7	8.1e-206
WP_000444487.1|2748736_2749987_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
2748690:2748713	attR	CAACGGGCGTATAACACGCCCGTT	NA	NA	NA	NA
>prophage 6
NZ_CP027205	Escherichia coli strain WCHEC025943 chromosome, complete genome	4817065	2878794	2896698	4817065	transposase	Stx2-converting_phage(42.86%)	18	NA	NA
WP_021513032.1|2878794_2879253_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	5.5e-12
WP_000976514.1|2879981_2881127_-	class C beta-lactamase CMY-2	NA	NA	NA	NA	NA
WP_000608644.1|2881450_2882713_-|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000547185.1|2882978_2884307_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_071586880.1|2884538_2884718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000179884.1|2884680_2884857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072129716.1|2885100_2885883_-|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	99.2	1.7e-138
WP_086598318.1|2886915_2887059_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_060621365.1|2887612_2889151_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.4	3.2e-298
WP_000612591.1|2889200_2889548_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_021566758.1|2889544_2889925_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	1.2e-65
WP_000107485.1|2890379_2891393_-	DUF4432 domain-containing protein	NA	NA	NA	NA	NA
WP_000998346.1|2891404_2892721_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000350265.1|2892748_2893669_-	ribokinase	NA	NA	NA	NA	NA
WP_001295538.1|2893974_2894757_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001387298.1|2894758_2894857_-	acetolactate synthase	NA	NA	NA	NA	NA
WP_077249141.1|2894984_2895185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104976704.1|2895469_2896698_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	2.7e-170
>prophage 7
NZ_CP027205	Escherichia coli strain WCHEC025943 chromosome, complete genome	4817065	3137115	3147209	4817065	integrase,transposase	Salmonella_phage(90.0%)	13	3136785:3136798	3147251:3147264
3136785:3136798	attL	AAAACAATAAGTTA	NA	NA	NA	NA
WP_001376441.1|3137115_3137304_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	95.2	2.0e-24
WP_001376443.1|3137462_3139856_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	93.7	0.0e+00
WP_001544405.1|3139852_3140710_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.8	9.5e-159
WP_000752610.1|3140706_3140934_-	hypothetical protein	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
WP_001244224.1|3140933_3141167_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
WP_000996717.1|3141234_3141576_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_000956192.1|3141693_3141990_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
WP_000460892.1|3141997_3142507_-	hypothetical protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000188448.1|3142539_3142761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001680871.1|3142906_3143785_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.4	1.7e-30
WP_001678408.1|3143796_3144741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100728251.1|3144861_3146082_+|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_001372563.1|3146156_3147209_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.4e-106
3147251:3147264	attR	TAACTTATTGTTTT	NA	NA	NA	NA
>prophage 8
NZ_CP027205	Escherichia coli strain WCHEC025943 chromosome, complete genome	4817065	3226792	3253996	4817065	lysis,terminase,integrase,capsid,tail	Enterobacteria_phage(47.06%)	52	3228708:3228722	3254070:3254084
WP_001356070.1|3226792_3228082_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	3.4e-19
WP_000767389.1|3228140_3228617_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_071524634.1|3228531_3228711_+	hypothetical protein	NA	NA	NA	NA	NA
3228708:3228722	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001753290.1|3229362_3230694_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
WP_072163407.1|3230767_3230944_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.5	9.4e-21
WP_041983107.1|3231135_3231762_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_072035100.1|3231706_3231844_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
WP_001372490.1|3232652_3233213_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.8	4.9e-87
WP_001324960.1|3233352_3233496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105084.1|3233601_3233835_+	hypothetical protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000079508.1|3233891_3234302_+	hypothetical protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001390120.1|3234347_3234512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001139678.1|3234653_3234806_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_000092273.1|3234793_3235261_-|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	96.8	1.6e-75
WP_001372488.1|3235257_3235755_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.0	1.6e-89
WP_000839582.1|3235754_3235970_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_003953600.1|3236157_3236745_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001470134.1|3236753_3236888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000592543.1|3237239_3238199_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780581.1|3238391_3238916_+	membrane protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_001204777.1|3239071_3239449_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000971068.1|3239534_3239675_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001372483.1|3239671_3240034_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	1.5e-60
WP_001372487.1|3240030_3240321_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	4.8e-46
WP_000224914.1|3240313_3240484_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001372486.1|3240483_3240939_-	DNA base-flipping protein	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_072157016.1|3240935_3241037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000825400.1|3241129_3241582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000720581.1|3241578_3242139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001403556.1|3242395_3242587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000145917.1|3242623_3242917_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001372464.1|3242913_3243615_-	replication P family protein	NA	K7P6G2	Enterobacteria_phage	99.6	3.8e-129
WP_077249941.1|3243611_3244631_-	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	63.4	1.7e-109
WP_001182899.1|3244627_3245167_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_001067458.1|3245236_3245467_-	antirepressor	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000259990.1|3245505_3246261_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
WP_000389051.1|3246383_3247133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000210934.1|3247129_3247957_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_000233576.1|3248465_3248672_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995439.1|3248747_3249044_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|3249049_3249835_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_001372450.1|3249831_3250512_+	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	3.0e-131
WP_072126246.1|3250508_3250691_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	2.2e-28
WP_023148020.1|3250663_3250855_+	DUF1382 domain-containing protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.8e-26
WP_001395510.1|3250865_3251147_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000763365.1|3251245_3251467_+	conjugal transfer protein TraR	NA	A0A0N7C211	Escherichia_phage	97.3	1.4e-34
WP_000711109.1|3251677_3252208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001663483.1|3252098_3252350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071525073.1|3252404_3252590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545745.1|3252522_3252690_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001303849.1|3252729_3252948_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533646.1|3252925_3253996_+|integrase	integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
3254070:3254084	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 9
NZ_CP027205	Escherichia coli strain WCHEC025943 chromosome, complete genome	4817065	3741487	3757175	4817065	integrase,tail	Shigella_phage(38.89%)	20	3738591:3738650	3753260:3753319
3738591:3738650	attL	CTTATTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000355482.1|3741487_3742261_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	37.7	4.1e-36
WP_072195243.1|3742330_3742459_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.6	1.7e-11
WP_086711726.1|3742513_3745657_-	hypothetical protein	NA	K7PGT9	Enterobacteria_phage	57.4	9.3e-260
WP_001250269.1|3745646_3745826_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515846.1|3746001_3746559_-	protein YmfL	NA	S5FXP0	Shigella_phage	96.2	1.5e-96
WP_000205494.1|3746596_3746797_-	cell division protein	NA	NA	NA	NA	NA
WP_000450738.1|3746894_3747521_+	LexA family transcriptional repressor	NA	K7PM82	Enterobacteria_phage	48.8	2.5e-47
WP_001312635.1|3747751_3748249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071598370.1|3748282_3748537_-	hypothetical protein	NA	U5P0J5	Shigella_phage	95.2	4.8e-42
WP_077250330.1|3748445_3748670_-	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	66.2	1.2e-15
WP_000135680.1|3748742_3749105_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081269.1|3749170_3749995_+	DUF2303 domain-containing protein	NA	U5P439	Shigella_phage	99.6	6.0e-150
WP_001371719.1|3750122_3750659_+	HD family hydrolase	NA	S5MW55	Escherichia_phage	98.3	2.0e-98
WP_024176184.1|3750649_3751528_+	hypothetical protein	NA	A0A2R2Z314	Escherichia_phage	92.4	5.3e-165
WP_000206058.1|3751524_3751869_+	hypothetical protein	NA	U5P0J0	Shigella_phage	80.7	2.0e-30
WP_000433939.1|3751868_3752219_+	DNA-binding protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
WP_064734231.1|3752320_3753259_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	4.7e-183
WP_000893260.1|3753463_3754717_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
3753260:3753319	attR	CTTATTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|3754728_3755832_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|3756119_3757175_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 10
NZ_CP027205	Escherichia coli strain WCHEC025943 chromosome, complete genome	4817065	4143052	4149611	4817065	transposase	uncultured_Caudovirales_phage(16.67%)	7	NA	NA
WP_000684856.1|4143052_4144009_+	Fe3+ dicitrate ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|4144009_4144777_+	Fe(3+) dicitrate transport ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_001333167.1|4145334_4145748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001254876.1|4146643_4147795_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
WP_000747102.1|4147714_4148065_-|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
WP_000227281.1|4148165_4148738_+	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000594911.1|4148786_4149611_-	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
>prophage 1
NZ_CP027199	Escherichia coli strain WCHEC025943 plasmid p1_025943, complete sequence	95895	0	23731	95895		Escherichia_phage(65.22%)	24	NA	NA
WP_001076427.1|0_861_+	replication protein RepA	NA	Q71TL8	Escherichia_phage	100.0	4.7e-158
WP_001285362.1|1418_2615_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_000038866.1|2631_3633_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
WP_063119529.1|3858_5565_+	hypothetical protein	NA	Q71TM1	Escherichia_phage	99.8	0.0e+00
WP_000085137.1|5625_7215_+	hypothetical protein	NA	Q71TB2	Escherichia_phage	98.9	2.9e-302
WP_023155381.1|7224_8040_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	98.2	2.4e-111
WP_000035301.1|8075_8657_+	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	97.4	7.3e-102
WP_000509939.1|8668_9178_+	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
WP_001352007.1|9293_9449_-	type I toxin-antitoxin system hok family toxin	NA	A0A1I9LJU7	Stx_converting_phage	90.2	4.0e-15
WP_001369095.1|9630_9876_-	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	45.0	3.5e-13
WP_024187338.1|9926_10772_-	hypothetical protein	NA	Q1MVK3	Enterobacteria_phage	98.9	1.5e-151
WP_100728220.1|10801_11602_-	DNA-binding protein	NA	Q1MVK4	Enterobacteria_phage	99.6	1.6e-147
WP_097308143.1|11766_12810_-	phage antirepressor Ant	NA	Q71TN2	Escherichia_phage	92.5	2.7e-171
WP_000245703.1|12806_13028_-	hypothetical protein	NA	Q38557	Escherichia_phage	97.3	3.6e-38
WP_032326155.1|13428_14103_+	hypothetical protein	NA	Q71TC4	Escherichia_phage	92.0	2.0e-18
WP_000846124.1|14361_14631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000188919.1|14689_15256_+	hypothetical protein	NA	Q71TN7	Escherichia_phage	98.9	3.3e-99
WP_000523980.1|15266_15878_+	hypothetical protein	NA	Q71TN8	Escherichia_phage	99.5	2.9e-109
WP_000926353.1|15892_16774_+	hypothetical protein	NA	Q71TC9	Escherichia_phage	100.0	2.2e-174
WP_100728219.1|16855_20596_+	transglycosylase	NA	Q1MVL3	Enterobacteria_phage	86.8	0.0e+00
WP_000002800.1|20595_20952_+	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_029487598.1|20948_22382_+	bleomycin hydrolase	NA	Q71TP2	Escherichia_phage	99.4	3.4e-270
WP_001561131.1|22381_23218_+	hypothetical protein	NA	A0A077SLH5	Escherichia_phage	99.6	1.5e-153
WP_029487597.1|23296_23731_+	hypothetical protein	NA	Q71TD4	Escherichia_phage	98.6	3.7e-74
>prophage 2
NZ_CP027199	Escherichia coli strain WCHEC025943 plasmid p1_025943, complete sequence	95895	28467	95578	95895	holin,transposase,head,portal,terminase	Escherichia_phage(63.64%)	79	NA	NA
WP_000332809.1|28467_28749_+	hypothetical protein	NA	Q71TD9	Escherichia_phage	97.8	8.7e-45
WP_000887652.1|28816_29146_+|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_000580776.1|29142_29586_+	hypothetical protein	NA	A0A077SK09	Escherichia_phage	100.0	1.3e-82
WP_000164724.1|29572_30175_+	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	99.5	1.6e-99
WP_097434456.1|30176_32096_+	hypothetical protein	NA	A0A1B0V7H1	Salmonella_phage	98.6	0.0e+00
WP_096935682.1|32092_32458_+	ddrA	NA	Q1MVM8	Enterobacteria_phage	96.7	1.5e-44
WP_100728218.1|32470_35458_+	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	99.0	0.0e+00
WP_001165936.1|35447_35756_+	hypothetical protein	NA	O21974	Escherichia_phage	97.1	5.4e-48
WP_046644916.1|35786_36581_-	hypothetical protein	NA	Q71TF1	Escherichia_phage	95.8	1.5e-142
WP_042032564.1|36783_37272_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	99.4	1.9e-87
WP_100728217.1|37441_37999_+	lysozyme	NA	Q71TF3	Escherichia_phage	98.4	6.7e-105
WP_072021472.1|38134_38311_+|holin	antiholin	holin	Q71TR5	Escherichia_phage	94.8	2.3e-27
WP_029487755.1|38290_39310_-|head	head processing protein	head	Q71TR6	Escherichia_phage	96.5	2.2e-178
WP_100728216.1|39302_41012_-|portal	phage portal protein	portal	Q71TR7	Escherichia_phage	99.5	0.0e+00
WP_004199413.1|41783_44801_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
WP_100728243.1|45603_51096_+	helicase	NA	A0A077SK04	Escherichia_phage	98.7	0.0e+00
WP_000224043.1|51129_51570_+	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_000747846.1|51566_51815_+	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_100728241.1|51861_53169_-	SIR2 family protein	NA	NA	NA	NA	NA
WP_023156639.1|53225_53867_-	hypothetical protein	NA	A0A077SK30	Escherichia_phage	98.1	1.6e-113
WP_000848374.1|54055_54616_-	recombinase	NA	Q5QBN4	Enterobacteria_phage	99.5	2.9e-100
WP_097434472.1|54865_55177_-	lysogeny establishment protein	NA	Q5QBN5	Enterobacteria_phage	99.0	3.0e-46
WP_016240429.1|55227_56259_-	recombinase cre	NA	Q71TG5	Escherichia_phage	98.8	4.6e-192
WP_000542335.1|56266_56488_-	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	98.6	1.3e-35
WP_001312283.1|56899_57013_+	hypothetical protein	NA	Q5XLQ7	Enterobacteria_phage	100.0	3.2e-14
WP_012817944.1|57031_57127_+	hypothetical protein	NA	Q38402	Escherichia_phage	100.0	2.8e-11
WP_000874156.1|57092_57302_+	hypothetical protein	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
WP_000611666.1|57412_58264_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	2.8e-158
WP_100728242.1|58296_59319_-	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	86.3	3.2e-161
WP_001352368.1|59343_60552_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_072157203.1|60743_61307_-	transcriptional regulator	NA	Q38557	Escherichia_phage	80.3	4.1e-25
WP_089046482.1|61303_62788_-|terminase	terminase	terminase	Q5QBP2	Enterobacteria_phage	99.6	2.1e-291
WP_000219605.1|62787_63981_-|terminase	terminase	terminase	Q5QBP3	Enterobacteria_phage	99.0	4.1e-208
WP_001312282.1|64067_64520_-	late promoter-activating protein (Gp10)	NA	Q71T63	Escherichia_phage	99.3	6.7e-79
WP_000648824.1|64608_65652_-	DUF968 domain-containing protein	NA	A0A1B0VBU2	Salmonella_phage	99.7	3.0e-207
WP_000113018.1|65679_65859_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	1.2e-23
WP_001216034.1|65863_66244_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001190712.1|66243_66465_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_000506726.1|66537_66927_-	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	99.2	1.4e-69
WP_001283837.1|67050_67302_-	DNA polymerase III subunit theta	NA	A0A077SLL5	Escherichia_phage	100.0	1.4e-38
WP_001344848.1|67475_67685_+	hypothetical protein	NA	A0A222YY00	Escherichia_phage	98.6	1.1e-31
WP_033553822.1|68508_68883_-	hypothetical protein	NA	A0A1B0VBU7	Salmonella_phage	96.8	9.2e-66
WP_033553821.1|68889_69183_-	hypothetical protein	NA	A0A077SK23	Escherichia_phage	92.8	1.2e-44
WP_000517420.1|69361_69595_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	100.0	2.5e-37
WP_033553819.1|69671_69932_-	hypothetical protein	NA	A0A077SLR0	Escherichia_phage	96.5	9.3e-41
WP_100728230.1|69928_70726_-	DUF551 domain-containing protein	NA	A0A192Y7X3	Salmonella_phage	46.1	8.8e-50
WP_100728229.1|70727_71372_-	hypothetical protein	NA	K7P6J7	Enterobacteria_phage	56.0	1.1e-53
WP_089046486.1|71368_72019_-	hypothetical protein	NA	A0A0F6TJR7	Escherichia_coli_O157_typing_phage	82.1	1.1e-26
WP_023352820.1|72015_72255_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	97.5	1.3e-36
WP_000158004.1|72247_72451_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	95.5	5.2e-31
WP_023153717.1|72534_73263_-	hypothetical protein	NA	Q71T76	Escherichia_phage	99.1	1.7e-140
WP_000021768.1|73457_73964_-	hypothetical protein	NA	A0A1B0VAK0	Salmonella_phage	99.4	1.8e-93
WP_000107690.1|74036_75299_-	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	99.8	1.6e-234
WP_000267620.1|75300_75519_-	hypothetical protein	NA	Q71TI9	Escherichia_phage	100.0	3.4e-36
WP_000684845.1|75600_76302_-	hypothetical protein	NA	Q1MVG6	Enterobacteria_phage	100.0	4.2e-144
WP_001354545.1|76298_76976_-	calcineurin phosphoesterase	NA	A0A077SLQ6	Escherichia_phage	100.0	7.6e-135
WP_076487244.1|76972_77599_-	norphogenetic protein	NA	A0A077SK52	Escherichia_phage	99.0	4.0e-122
WP_100728228.1|77496_78159_-	norphogenetic protein	NA	Q71T83	Escherichia_phage	98.6	9.4e-122
WP_000095381.1|78100_78256_-	hypothetical protein	NA	Q71TJ4	Escherichia_phage	96.1	2.7e-19
WP_050858714.1|78322_78901_-	norphogenetic protein	NA	Q71T85	Escherichia_phage	99.5	1.5e-107
WP_100728227.1|78903_79149_-	hypothetical protein	NA	Q71T86	Escherichia_phage	98.8	2.1e-39
WP_000235786.1|79295_79673_+	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_063270113.1|79682_80900_+	hypothetical protein	NA	A0A077SL53	Escherichia_phage	99.8	4.1e-224
WP_000896806.1|80903_81632_+	hypothetical protein	NA	Q71TJ9	Escherichia_phage	100.0	4.2e-139
WP_046659850.1|81618_82404_+	hypothetical protein	NA	A0A1B0V7N6	Salmonella_phage	99.6	2.7e-144
WP_000212018.1|82405_83422_+	hypothetical protein	NA	A0A077SLQ1	Escherichia_phage	100.0	3.5e-192
WP_000535208.1|83414_84047_+	hypothetical protein	NA	Q1MVH8	Enterobacteria_phage	100.0	9.0e-90
WP_023155375.1|84093_85092_-	hypothetical protein	NA	Q71TK3	Escherichia_phage	99.1	1.4e-193
WP_001276603.1|85091_86456_-	replicative DNA helicase	NA	O80281	Escherichia_phage	99.8	1.6e-253
WP_100728226.1|86446_86662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100728225.1|87092_87518_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	99.3	1.8e-70
WP_001068935.1|87709_87901_+	hypothetical protein	NA	Q71T98	Escherichia_phage	100.0	6.0e-29
WP_100728224.1|89075_92117_-	DNA methyltransferase	NA	A0A077SL51	Escherichia_phage	86.8	0.0e+00
WP_100728223.1|92113_93019_-	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	96.0	5.0e-158
WP_100728222.1|93011_93296_-	hypothetical protein	NA	Q71TA2	Escherichia_phage	98.9	7.7e-49
WP_001369296.1|93569_93749_+	hypothetical protein	NA	A0A1B0V758	Salmonella_phage	98.3	6.8e-27
WP_100728221.1|93757_94546_+	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	92.3	8.6e-114
WP_000007771.1|94585_95008_+	hypothetical protein	NA	Q71TL5	Escherichia_phage	85.7	7.4e-56
WP_001281114.1|95185_95578_+	hypothetical protein	NA	A0A1B0VBK3	Salmonella_phage	100.0	2.4e-72
>prophage 1
NZ_CP027200	Escherichia coli strain WCHEC025943 plasmid p2_025943, complete sequence	75779	2223	42244	75779	transposase,integrase,protease	Salmonella_phage(25.0%)	41	NA	NA
WP_001067855.1|2223_2928_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_023145375.1|3148_3463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000845048.1|3401_4415_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_063840321.1|4706_5261_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001749986.1|5357_5810_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_001749985.1|5942_6416_+	trimethoprim-resistant dihydrofolate reductase DfrA27	NA	G3MBI7	Bacillus_virus	29.1	1.4e-15
WP_001749984.1|6596_7442_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA16	NA	NA	NA	NA	NA
WP_000679427.1|7558_7906_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|7899_8739_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|9143_10685_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_012372818.1|11277_12033_-	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_000027057.1|12202_13063_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_086528360.1|13245_13653_-	resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	1.0e-57
WP_001067855.1|13658_14363_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557454.1|14595_15456_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000587837.1|15468_16011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|16492_16684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001330846.1|16689_16935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080861.1|16985_18122_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000971921.1|18236_19607_+|transposase	IS1182 family transposase ISCfr1	transposase	NA	NA	NA	NA
WP_000027057.1|20427_21288_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000480968.1|21518_22355_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082320.1|22354_23158_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|23218_24034_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000954592.1|24363_24540_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_000427619.1|24721_25726_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_072652147.1|25804_28771_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
WP_001067855.1|29141_29846_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004201280.1|29915_30389_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_000845048.1|30544_31558_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004193519.1|31496_32111_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001161490.1|32286_32847_+|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_015058874.1|32850_33447_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	85.1	4.7e-64
WP_015058875.1|33478_34156_-	TetA resistance protein	NA	NA	NA	NA	NA
WP_000804064.1|34234_35434_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|35465_36350_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001351729.1|36487_36880_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_001262767.1|38849_40622_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_012602142.1|40805_40910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012602143.1|40906_41371_-	Plasmid stable inheritance protein	NA	NA	NA	NA	NA
WP_000616807.1|41590_42244_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP027200	Escherichia coli strain WCHEC025943 plasmid p2_025943, complete sequence	75779	55543	62131	75779		Escherichia_phage(33.33%)	10	NA	NA
WP_000086160.1|55543_56227_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
WP_032155763.1|56302_56608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077250718.1|56611_57583_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_072652239.1|57551_57821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000618110.1|57931_58180_+	protein ImpC	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_000109071.1|58176_58614_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_064198699.1|58613_59885_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.2	3.2e-142
WP_077248911.1|59889_60318_-	plasmid stability protein	NA	NA	NA	NA	NA
WP_001103697.1|60286_61258_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	1.3e-66
WP_000633913.1|61486_62131_+	chromosome partitioning protein ParA	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
>prophage 1
NZ_CP027202	Escherichia coli strain WCHEC025943 plasmid pMCR1_025943, complete sequence	265538	96406	177677	265538	transposase,integrase	Escherichia_phage(48.28%)	84	100030:100089	150266:151086
WP_001067858.1|96406_97111_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001137892.1|97236_97821_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|97820_99059_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|99055_99961_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
100030:100089	attL	CGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATT	NA	NA	NA	NA
WP_001067855.1|100082_100787_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_071525219.1|100777_100966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000105383.1|101053_102490_+	glutathione synthase	NA	NA	NA	NA	NA
WP_100250258.1|102803_103070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100728247.1|103157_103829_-	replication initiation protein	NA	NA	NA	NA	NA
WP_001067858.1|103838_104543_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000130000.1|104725_105031_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|105041_106247_-	chromate transporter	NA	NA	NA	NA	NA
WP_011058339.1|107462_107549_+	tetracycline resistance protein	NA	NA	NA	NA	NA
WP_100728246.1|107564_109484_+	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	98.0	0.0e+00
WP_104976713.1|109559_110165_+	DDE domain-containing protein	NA	A0A077SL39	Escherichia_phage	99.5	7.0e-116
WP_000490638.1|110939_111605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001426317.1|111662_112043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193209.1|112685_113504_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001572381.1|113500_114706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000121165.1|114769_114973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000078514.1|114985_116305_-	DUF1173 domain-containing protein	NA	NA	NA	NA	NA
WP_000833382.1|116555_117983_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_001572389.1|118197_118713_+	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000975182.1|118715_119612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015059496.1|119833_120067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001046767.1|120112_120367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136338.1|120404_120692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572393.1|120728_120959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185304.1|121295_121757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074418.1|121786_122194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029698059.1|122244_122562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031613424.1|122938_123289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001351729.1|125153_125546_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|125683_126568_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|126599_127799_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_015058875.1|127877_128555_+	TetA resistance protein	NA	NA	NA	NA	NA
WP_000844627.1|128586_128829_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000480968.1|129134_129971_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|129970_130774_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|130834_131650_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000027057.1|131811_132672_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_072692456.1|132854_133331_-	recombinase	NA	Q1MVP4	Enterobacteria_phage	100.0	2.5e-76
WP_001067858.1|133379_134084_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_106066843.1|133974_134283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|134635_135340_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_015057121.1|135230_136190_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
WP_032491824.1|136338_137130_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA22	NA	NA	NA	NA	NA
WP_072692450.1|137261_138083_+	lincosamide nucleotidyltransferase Lnu(F)	NA	NA	NA	NA	NA
WP_001067855.1|138235_138940_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001322943.1|139560_139752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001082319.1|140775_141579_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|141578_142415_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000018321.1|142750_143566_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	4.8e-160
WP_001201005.1|143719_144595_-	acyl-CoA--6-aminopenicillanic acid acyl-transferase	NA	NA	NA	NA	NA
WP_000602738.1|146249_147002_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_000742814.1|147423_148449_-	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_000171321.1|148435_148657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001199192.1|148677_149454_-	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
WP_001067855.1|149567_150272_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_106066844.1|150351_150603_+	tetracycline resistance protein	NA	NA	NA	NA	NA
WP_001255015.1|150869_151175_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
150266:151086	attR	AATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCGTCCTGCTTGCTTCGGGTGGCATCGGAATGCCGGCGCTGCAAGCAATGTTGTCCAGGCAGGTGGATGAGGAACGTCAGGGGCAGCTGCAAGGCTCACTGGCGGCGCTCACCAGCCTGACCTCGATCGTCGGACCCCTCCTCTTCACGGCGATCTATGCGGCTTCTATAACAACGTGGAACGGGTGGGCATGGATTGCAGGCGCTGCCCTCTACTTGCTCTGCCTGCCGGCGCTGCGTCGCGGGCTTTGGAGAAATTCTTCAAATTCCCGTTGCACATAGCCCGGCAATTCCTTTCCCTGCTCTGCCATAAGCGCAGCGAATGCCGGGTAATACTCGTCAACGATCTGATAGAGAAGGGTTTGCTCGGGTCGGTGGCTCTGGTAACGACCAGTATCCCGATCCCGGCTGGCCGTCCTGGCCGCCACATGAGGCATGTTCCGCGTCCTTGCAATACTGTGTTTACATACAGTCTATCGCTTAGCGGAAAGTTCTTTTACCCTCAGCCGAAATGCCTGCCGTTGCTAGACATTGCCAGCCAGTGCCCGTCACTCCGCGGTCTTCACTGCGTGATCGAGTTGATCGACACCCGCCGTGACACGCTCCATGAAGTGCCTGCCTGCGTCTGTTAGCCGAACGCCCCGCGCATGGCGCTCAAATAGCAGGACACCAAGGTTATCCTCCAGCGCTTTCACACGCGCGCTGACGCTCGACTGGCTGATACCAAGTGCCTTGGCCGCATGCCGAAAATTCAGATGCTCGGCG	NA	NA	NA	NA
WP_063122217.1|151202_152417_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	25.4	1.5e-16
WP_001447541.1|152633_153518_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001067784.1|154442_155147_+|transposase	IS6 family transposase IS1006	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_100728245.1|155231_155651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100728244.1|155641_158593_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_000147567.1|158595_159156_-|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_013362812.1|161173_162142_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_013188475.1|162176_163052_-	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_000434930.1|163556_164183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|164780_165485_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000376616.1|165709_165913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001993321.1|165931_166111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|166040_166880_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_072644484.1|167060_167225_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001067858.1|168615_169320_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_077249982.1|169265_169445_-	hypothetical protein	NA	Q1MVP5	Enterobacteria_phage	85.7	7.3e-05
WP_063102497.1|169513_169900_+	bleomycin binding protein	NA	NA	NA	NA	NA
WP_089079287.1|170219_170612_-	NimC/NimA family protein	NA	NA	NA	NA	NA
WP_001067858.1|170946_171651_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_089079288.1|171970_173146_+	multidrug efflux RND transporter periplasmic adaptor subunit OqxA	NA	NA	NA	NA	NA
WP_058914901.1|173169_176322_+	multidrug efflux RND transporter permease subunit OqxB	NA	NA	NA	NA	NA
WP_000888203.1|176391_176871_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001067858.1|176972_177677_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
