The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025005	Klebsiella pneumoniae strain AUSMDU00003562 chromosome, complete genome	5414861	447526	480779	5414861	head,terminase,portal,capsid,protease,integrase,tail,tRNA	uncultured_Caudovirales_phage(73.33%)	33	465129:465146	481124:481141
WP_002919147.1|447526_448474_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|448488_448998_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|449126_450251_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|450222_450696_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|450721_451264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|451268_451841_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|451844_452663_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|452659_452917_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|452892_453447_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|459237_459459_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|459752_462863_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|462875_464015_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|464393_465044_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
465129:465146	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|465319_466546_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|466638_467580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|467761_468046_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|468056_468836_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_106918304.1|469287_469557_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|469549_469738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|469730_470045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|470041_470410_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|470406_470772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|470771_472907_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|473249_473585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|473633_474146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|474409_475576_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|475627_476188_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|476189_477431_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|477427_477763_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|477759_478059_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|478058_478502_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_000113647.1|478777_479134_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|479117_480779_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
481124:481141	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 2
NZ_CP025005	Klebsiella pneumoniae strain AUSMDU00003562 chromosome, complete genome	5414861	1344106	1397674	5414861	terminase,capsid,integrase,holin,tail,tRNA	Salmonella_phage(41.67%)	63	1332851:1332866	1400602:1400617
1332851:1332866	attL	CGCTCCAGCAGCCTGG	NA	NA	NA	NA
WP_004149335.1|1344106_1345381_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002913890.1|1345415_1346036_+	YfgM family protein	NA	NA	NA	NA	NA
WP_002913889.1|1346046_1347225_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_002913888.1|1347338_1348817_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_004151982.1|1348934_1350014_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_004144303.1|1350063_1350282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151981.1|1350265_1351657_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	33.0	6.3e-35
WP_004151980.1|1351815_1353282_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|1353349_1354927_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004243821.1|1355118_1356369_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.1	1.8e-206
WP_004243823.1|1356385_1356577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243826.1|1356573_1357167_-	adenine methylase	NA	T1SA14	Salmonella_phage	91.9	2.1e-109
WP_004243831.1|1357163_1357913_-	hypothetical protein	NA	R9VWB9	Serratia_phage	56.1	3.1e-73
WP_004243833.1|1357909_1358068_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	80.4	2.5e-17
WP_004243834.1|1358060_1358354_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	70.1	1.2e-31
WP_004144294.1|1358463_1358712_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
WP_004243835.1|1358760_1359642_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	82.3	1.7e-131
WP_004243836.1|1359638_1360460_-	exonuclease VIII/RecE-like protein	NA	A0A193GYK2	Enterobacter_phage	80.2	8.1e-131
WP_004243838.1|1360456_1360756_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	53.5	1.8e-19
WP_042651015.1|1360763_1361666_-	hypothetical protein	NA	A0A059VK18	Pseudomonas_phage	51.6	2.8e-36
WP_004152539.1|1362078_1362660_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.8	1.9e-65
WP_004152538.1|1362813_1363047_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|1363193_1363403_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004207253.1|1363402_1364170_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_004152535.1|1364166_1364952_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.4	8.2e-133
WP_004152534.1|1365071_1365419_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	5.0e-50
WP_004152532.1|1365611_1366022_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	42.2	3.1e-14
WP_004152531.1|1366005_1366197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152530.1|1366193_1366619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152529.1|1366615_1367359_+	hypothetical protein	NA	A6N3G8	Burkholderia_virus	59.5	1.5e-19
WP_004141386.1|1367529_1367742_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_004152527.1|1367738_1368407_+	DUF551 domain-containing protein	NA	Q6UAT8	Klebsiella_phage	52.5	1.5e-05
WP_004152526.1|1368399_1368639_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	48.0	4.6e-10
WP_004152525.1|1368638_1368977_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	4.7e-45
WP_004152524.1|1369051_1369309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152523.1|1369386_1369971_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	2.4e-89
WP_020314691.1|1369967_1371443_+	hypothetical protein	NA	Q858H3	Salmonella_phage	92.7	3.2e-279
WP_004152473.1|1371486_1372008_-	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	55.2	7.8e-47
WP_004152472.1|1372713_1372917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152471.1|1372920_1374600_+|tail	tail protein	tail	T1S9Z7	Salmonella_phage	58.9	3.4e-192
WP_004152470.1|1374596_1374902_+	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
WP_004152468.1|1375183_1375582_+	peptidase	NA	T1SAP9	Salmonella_phage	59.5	5.6e-37
WP_004152467.1|1375594_1376602_+|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	92.5	2.7e-181
WP_004152466.1|1376611_1377004_+	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
WP_004152465.1|1376996_1377275_+	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	6.7e-21
WP_032422382.1|1377323_1377935_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	1.2e-46
WP_065887657.1|1377934_1380412_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.2	4.0e-266
WP_004152462.1|1380413_1380884_+	hypothetical protein	NA	Q858G2	Salmonella_phage	55.3	7.3e-44
WP_004152461.1|1380876_1381374_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	40.5	5.7e-23
WP_004152460.1|1381386_1384131_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	39.2	9.1e-94
WP_004152459.1|1384130_1387520_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	42.0	6.3e-121
WP_004152458.1|1387529_1388144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152457.1|1388418_1388817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152456.1|1388821_1389004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152455.1|1389194_1389890_-	hypothetical protein	NA	A0A193GYJ9	Enterobacter_phage	52.7	4.4e-61
WP_004152454.1|1390270_1390468_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	69.8	2.0e-19
WP_004152453.1|1390471_1390729_-	DUF1902 domain-containing protein	NA	A0A0M4R2Z9	Salmonella_phage	54.1	2.3e-12
WP_002913857.1|1391267_1393529_+|tail	tail fiber protein	tail	A0A0A8J9V7	Klebsiella_phage	35.8	3.7e-69
WP_004146394.1|1393791_1394196_+	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_002913854.1|1394182_1394488_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	1.6e-39
WP_002913853.1|1394477_1395107_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.9	1.8e-90
WP_002913851.1|1395103_1395586_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	76.9	2.8e-59
WP_004152009.1|1395805_1397674_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
1400602:1400617	attR	CCAGGCTGCTGGAGCG	NA	NA	NA	NA
>prophage 3
NZ_CP025005	Klebsiella pneumoniae strain AUSMDU00003562 chromosome, complete genome	5414861	1726397	1733304	5414861	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|1726397_1727261_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_002912638.1|1727271_1728045_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.5e-25
WP_002912636.1|1728287_1729181_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_002912635.1|1729426_1730788_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	2.5e-206
WP_002912634.1|1731106_1731829_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
WP_004151135.1|1731825_1733304_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
>prophage 4
NZ_CP025005	Klebsiella pneumoniae strain AUSMDU00003562 chromosome, complete genome	5414861	2078993	2135479	5414861	protease,plate,transposase	Staphylococcus_phage(16.67%)	52	NA	NA
WP_002910830.1|2078993_2079740_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_004199384.1|2080151_2081165_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_004151439.1|2081157_2081958_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_002910767.1|2081944_2082118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910764.1|2082735_2083677_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_002910762.1|2083770_2084760_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004145486.1|2084785_2086117_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_002910759.1|2086144_2087353_+	propionate kinase	NA	NA	NA	NA	NA
WP_004152312.1|2087381_2089676_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	2.3e-159
WP_004219578.1|2090106_2091222_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002910727.1|2091331_2092246_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002910725.1|2092255_2093533_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_002910722.1|2093529_2094405_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
WP_002910721.1|2094401_2095121_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	2.5e-11
WP_002910720.1|2095126_2096020_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910719.1|2096303_2097947_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	9.8e-136
WP_002910717.1|2097996_2098473_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002910715.1|2098571_2099498_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152313.1|2099801_2101097_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	1.3e-61
WP_004152314.1|2101111_2101918_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152315.1|2101892_2102792_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910657.1|2102901_2103384_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_002910654.1|2103574_2104273_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_004899028.1|2104298_2104883_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|2104952_2105282_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_002910647.1|2105368_2105614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910645.1|2105850_2107191_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004152316.1|2107187_2107841_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004152317.1|2107844_2109542_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004152319.1|2112505_2113861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910593.1|2113861_2114371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|2114367_2114874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910586.1|2115110_2115620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153456.1|2117270_2118194_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.1	1.6e-172
WP_004199326.1|2118335_2118518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153085.1|2118514_2118844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910551.1|2118840_2119347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910549.1|2119392_2119623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004155011.1|2119728_2120838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910547.1|2120861_2121167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910544.1|2121188_2122082_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	6.7e-14
WP_004152633.1|2122265_2123159_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_002910539.1|2123334_2124228_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.8e-12
WP_004152632.1|2124403_2125294_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.8	4.1e-11
WP_000019473.1|2125630_2126611_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_029779706.1|2126734_2126971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004227463.1|2127159_2127417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|2127714_2127981_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004198077.1|2127984_2129142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152262.1|2129125_2132536_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_002910495.1|2132669_2134433_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002910494.1|2134432_2135479_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 5
NZ_CP025005	Klebsiella pneumoniae strain AUSMDU00003562 chromosome, complete genome	5414861	2799104	2809991	5414861		Escherichia_phage(87.5%)	9	NA	NA
WP_004151613.1|2799104_2802212_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|2802266_2803532_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2803562_2804651_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|2804737_2804998_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|2805295_2806156_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2806176_2806938_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|2807198_2808101_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|2808112_2809378_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|2809370_2809991_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 6
NZ_CP025005	Klebsiella pneumoniae strain AUSMDU00003562 chromosome, complete genome	5414861	3037487	3077259	5414861	integrase,transposase,terminase	uncultured_Caudovirales_phage(35.42%)	57	3068372:3068386	3074381:3074395
WP_004152576.1|3037487_3038354_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152575.1|3038353_3039127_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|3039123_3040320_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|3040319_3040673_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|3040674_3041328_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152571.1|3041381_3041948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199301.1|3041990_3042173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|3042222_3042564_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|3042563_3043586_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152568.1|3043588_3043891_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152567.1|3043891_3044491_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152566.1|3044490_3046494_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|3046483_3046636_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|3046671_3047097_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_085955245.1|3047423_3048615_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004152178.1|3048556_3048847_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	85.5	2.6e-23
WP_004152177.1|3048857_3050003_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|3050006_3050447_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|3050541_3050928_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|3050927_3051434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|3051430_3051850_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|3051818_3052100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|3052139_3053081_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|3053092_3053587_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|3053590_3054793_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|3054844_3055393_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|3055448_3056900_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|3057137_3058538_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152171.1|3058488_3059241_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152170.1|3059342_3059663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|3059897_3060287_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|3060283_3060814_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|3060816_3061065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|3061470_3062253_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|3062249_3062726_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|3062722_3063685_-	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|3063686_3065345_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|3065921_3066143_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|3066240_3066909_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|3067079_3067394_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|3067386_3067575_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|3067744_3068110_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|3068102_3068357_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004177208.1|3068328_3068547_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
3068372:3068386	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004152156.1|3068543_3068969_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|3068965_3069160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|3069156_3069984_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|3070088_3070607_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|3070612_3071323_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|3071312_3071537_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004152150.1|3071533_3071746_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152149.1|3071742_3072222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152148.1|3072400_3072643_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|3072623_3073805_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|3074001_3074550_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
3074381:3074395	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|3074748_3076281_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|3076497_3077259_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 7
NZ_CP025005	Klebsiella pneumoniae strain AUSMDU00003562 chromosome, complete genome	5414861	3110192	3160271	5414861	integrase,holin,transposase,terminase	Enterobacteria_phage(25.0%)	55	3109974:3109989	3157577:3157592
3109974:3109989	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_002901815.1|3110192_3110864_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
WP_071531199.1|3111050_3111878_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901813.1|3111953_3113219_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_002901812.1|3113220_3113640_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_004152765.1|3113719_3115204_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152776.1|3116101_3116524_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_001067855.1|3117116_3117821_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152703.1|3118069_3120013_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	69.8	1.1e-37
WP_004152702.1|3120254_3120854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152700.1|3121078_3121810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644627.1|3121813_3124768_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	68.3	4.2e-44
WP_004152652.1|3124844_3127913_-	hypothetical protein	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
WP_004152651.1|3127909_3128290_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_004152650.1|3128299_3128782_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	94.4	1.7e-80
WP_004152649.1|3128962_3129427_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	6.7e-58
WP_004152648.1|3129741_3130077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|3130267_3131248_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_019405022.1|3132214_3133327_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.1	5.6e-111
WP_004218551.1|3133310_3134711_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	1.1e-127
WP_004190663.1|3134710_3136018_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
WP_004218556.1|3135995_3137000_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
WP_004218558.1|3137862_3138108_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_004190672.1|3139066_3139342_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_004190674.1|3139338_3139683_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004218565.1|3139679_3140219_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_024940884.1|3140215_3140515_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_022644626.1|3140993_3142040_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
WP_004232548.1|3142265_3142955_-	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_004218534.1|3142954_3143095_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004218533.1|3143091_3143730_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218532.1|3143722_3144391_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004243010.1|3144387_3144555_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218531.1|3144535_3145003_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
WP_004218530.1|3145523_3146552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196831.1|3146759_3147005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218528.1|3147060_3147363_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004201118.1|3147359_3148208_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004201117.1|3148204_3149065_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_001548453.1|3149150_3149372_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201115.1|3149412_3149640_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_004201113.1|3149751_3150450_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_019405077.1|3150472_3150592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201109.1|3150737_3151814_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_004201108.1|3151895_3152099_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004135674.1|3152527_3152722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201105.1|3152810_3153095_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004201103.1|3153110_3153956_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_088224434.1|3153952_3154240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201102.1|3154241_3154922_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_004151898.1|3154918_3155347_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004151899.1|3155343_3156006_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004153574.1|3156213_3157401_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
WP_004151901.1|3157577_3158468_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
3157577:3157592	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_004140266.1|3158467_3159460_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|3159461_3160271_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 8
NZ_CP025005	Klebsiella pneumoniae strain AUSMDU00003562 chromosome, complete genome	5414861	3451148	3466077	5414861	tail	Salmonella_phage(44.44%)	15	NA	NA
WP_074442243.1|3451148_3451313_-	helix-turn-helix domain-containing protein	NA	A0A286S1P7	Klebsiella_phage	85.4	1.3e-11
WP_133060760.1|3451384_3452236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040150096.1|3452496_3452691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064182196.1|3453542_3453737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065887683.1|3453935_3456371_-|tail	phage tail protein	tail	A0A0A8J9V7	Klebsiella_phage	34.7	1.4e-66
WP_074442244.1|3456462_3456615_-	DUF1378 family protein	NA	NA	NA	NA	NA
WP_065887686.1|3456611_3457142_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	48.9	6.3e-36
WP_065887688.1|3457138_3457678_-	lysozyme	NA	H6WRZ4	Salmonella_phage	78.1	7.7e-82
WP_004199490.1|3457679_3457895_-	hypothetical protein	NA	A5LH82	Enterobacteria_phage	61.0	1.1e-12
WP_071838248.1|3458225_3458378_+	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	81.6	1.2e-13
WP_065887690.1|3458408_3458621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065887691.1|3458664_3459015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065887692.1|3459011_3461729_-	hypothetical protein	NA	Q858F8	Salmonella_phage	51.4	1.7e-262
WP_065887694.1|3461728_3463570_-	hypothetical protein	NA	Q858F9	Salmonella_phage	33.1	2.1e-78
WP_065887696.1|3463569_3466077_-	transglycosylase SLT domain-containing protein	NA	Q858G0	Salmonella_phage	26.4	5.8e-55
>prophage 9
NZ_CP025005	Klebsiella pneumoniae strain AUSMDU00003562 chromosome, complete genome	5414861	3471193	3494341	5414861	integrase,tail,head	Pectobacterium_phage(26.09%)	35	3461973:3461987	3495425:3495439
3461973:3461987	attL	AACTGCGCAAACTGA	NA	NA	NA	NA
WP_004191050.1|3471193_3471667_-	hypothetical protein	NA	K4NYY6	Pseudomonas_phage	46.3	1.8e-26
WP_004191051.1|3471705_3472701_-	hypothetical protein	NA	W6MW28	Pseudomonas_phage	60.2	2.7e-104
WP_065887700.1|3472711_3473470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029503969.1|3473456_3473780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064185222.1|3473782_3475447_-|head,tail	phage head-tail adapter protein	head,tail	A0A221SAN2	Ralstonia_phage	39.4	3.1e-105
WP_004141560.1|3475446_3476841_-	hypothetical protein	NA	A0A0E3JIA1	Rhodoferax_phage	36.9	2.4e-58
WP_065887702.1|3476925_3477378_-	DNA-packaging protein	NA	A3EYX3	Salmonella_phage	66.4	1.5e-49
WP_065887704.1|3477384_3477645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065887706.1|3477628_3477862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064172715.1|3477923_3478448_-	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	54.7	8.7e-46
WP_004199525.1|3478488_3478929_-	phage family protein	NA	R9TRJ4	Aeromonas_phage	43.8	4.3e-14
WP_004199527.1|3478934_3479282_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071838911.1|3479269_3479593_-	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	55.8	1.8e-25
WP_065887708.1|3479582_3480176_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	71.6	2.7e-80
WP_029499143.1|3480244_3480436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065887710.1|3480617_3480956_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.2	6.8e-44
WP_065887712.1|3480948_3481176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009308338.1|3481848_3482079_-	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	38.7	2.9e-06
WP_046387637.1|3482081_3482672_-	adenine methylase	NA	A0A0F6TJC3	Escherichia_coli_O157_typing_phage	82.9	4.3e-94
WP_065887721.1|3482799_3483585_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	54.5	1.1e-65
WP_004141586.1|3483624_3483858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065887714.1|3483861_3484512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029499135.1|3484550_3485939_-	AAA family ATPase	NA	Q8HA30	Enterobacteria_phage	47.3	1.5e-105
WP_024623102.1|3485935_3486904_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.5	5.5e-38
WP_016197573.1|3486921_3487080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199487.1|3487163_3487610_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	56.1	7.4e-30
WP_029499131.1|3487670_3487904_-	helix-turn-helix transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	44.4	5.8e-10
WP_029499126.1|3488010_3488466_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	50.0	3.6e-32
WP_077271229.1|3489476_3489710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644594.1|3489717_3489963_+	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	59.5	3.7e-15
WP_065887719.1|3489992_3492122_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.7	1.5e-96
WP_009308318.1|3492121_3492688_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	61.5	2.5e-51
WP_025712917.1|3492689_3492875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004191087.1|3493084_3493309_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	66.7	5.9e-20
WP_025712918.1|3493312_3494341_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	54.4	4.0e-95
3495425:3495439	attR	AACTGCGCAAACTGA	NA	NA	NA	NA
>prophage 10
NZ_CP025005	Klebsiella pneumoniae strain AUSMDU00003562 chromosome, complete genome	5414861	3581990	3674941	5414861	head,lysis,terminase,portal,protease,capsid,integrase,plate,tail,tRNA	Salmonella_phage(56.9%)	93	3637516:3637534	3675016:3675034
WP_002898139.1|3581990_3583283_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3583373_3584717_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3584725_3585337_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|3585459_3589713_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|3589848_3590343_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004141839.1|3590848_3591844_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
WP_002898017.1|3591958_3593725_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3593725_3595447_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3595491_3596193_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3596546_3596765_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3596885_3599165_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3599195_3599513_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3599838_3600060_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3600136_3602077_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3602073_3603189_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3603335_3604994_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3605413_3606109_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3606224_3607124_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3607267_3608920_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3608930_3609899_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|3610110_3610545_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3610696_3612415_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3612453_3613455_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3613465_3614908_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3614995_3616009_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3616005_3616836_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3616867_3618007_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|3618884_3619400_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|3619626_3620355_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3620375_3621107_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3621113_3621830_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3621829_3622498_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3622681_3623413_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3623455_3624928_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3624924_3625641_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3625719_3626847_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3626888_3627377_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3627434_3628280_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3628276_3629230_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|3629240_3630374_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|3630537_3631650_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3631998_3632478_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3632566_3633469_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3634290_3634578_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3634780_3635044_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3635050_3635434_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|3635700_3637386_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3637516:3637534	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3637605_3637824_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3637915_3639016_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|3639012_3639498_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896222.1|3639494_3642122_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896220.1|3642114_3642234_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3642248_3642548_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3642600_3643116_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3643125_3644298_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3644436_3645513_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|3645542_3645746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|3645742_3646474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|3646477_3649429_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|3649430_3650030_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3650022_3650931_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_002896179.1|3650917_3651280_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896177.1|3651276_3651849_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004150857.1|3651943_3652636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3652632_3653079_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3653071_3653503_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896168.1|3653598_3654027_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3654023_3654407_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3654411_3654921_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3654901_3655117_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3655120_3655324_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3655323_3655788_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3655883_3656534_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|3656537_3657596_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|3657612_3658446_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3658588_3660355_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3660354_3661380_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|3661441_3663184_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|3663459_3664137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3664251_3664485_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3664495_3664684_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150862.1|3664837_3667252_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|3667248_3668106_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|3668102_3668330_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|3668329_3668563_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|3668630_3668972_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|3668935_3669136_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|3669143_3669653_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|3669685_3669907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|3670052_3670931_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|3670942_3671887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|3671985_3673470_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151720.1|3673888_3674941_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
3675016:3675034	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 11
NZ_CP025005	Klebsiella pneumoniae strain AUSMDU00003562 chromosome, complete genome	5414861	4048072	4094448	5414861	head,lysis,transposase,integrase,tRNA	Escherichia_phage(25.93%)	64	4041285:4041331	4091520:4091566
4041285:4041331	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004151249.1|4048072_4050550_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
WP_004151250.1|4050536_4050932_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
WP_004199076.1|4050928_4051399_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_004165520.1|4051398_4051818_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.5	1.8e-30
WP_004151253.1|4051917_4055364_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
WP_004151254.1|4055456_4055960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151255.1|4056087_4056873_-	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
WP_004151256.1|4056938_4057652_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
WP_004151257.1|4057641_4057812_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
WP_004151258.1|4057911_4058271_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
WP_004151259.1|4058287_4058758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151260.1|4059051_4059306_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_004151261.1|4059308_4060064_-	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151262.1|4060239_4060917_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
WP_004151263.1|4060969_4061722_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_004151264.1|4061790_4062183_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
WP_004151265.1|4062179_4062605_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004151266.1|4062607_4062970_-	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
WP_004151267.1|4062969_4063143_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
WP_004151268.1|4063142_4063523_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
WP_065887739.1|4063573_4063765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151270.1|4063775_4064870_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	1.7e-123
WP_004151271.1|4064881_4065310_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
WP_004151272.1|4065313_4066699_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
WP_004151273.1|4066771_4067248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151274.1|4067289_4068294_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
WP_004151275.1|4068268_4069690_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
WP_004151276.1|4069702_4071175_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
WP_004151277.1|4071174_4071777_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
WP_004151279.1|4072147_4072477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151280.1|4072582_4073047_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
WP_004151281.1|4073043_4073574_-	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
WP_004151282.1|4073576_4073825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644626.1|4074561_4075608_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
WP_004151283.1|4075835_4076525_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
WP_004151284.1|4076521_4077052_-	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
WP_004151285.1|4077044_4077182_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004151286.1|4077178_4077814_-	protein ninG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_004151287.1|4077806_4077977_-	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
WP_004151288.1|4077976_4078432_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_004151291.1|4078932_4079580_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
WP_004151293.1|4079752_4080595_-	translation repressor RelE	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
WP_004151294.1|4080701_4081208_-	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_004151295.1|4081204_4081498_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004151296.1|4081497_4082928_-	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	66.7	2.6e-185
WP_004151297.1|4082917_4083817_-	hypothetical protein	NA	F1C5C3	Cronobacter_phage	54.9	5.4e-88
WP_001548453.1|4084041_4084263_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004151299.1|4084303_4084537_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_004151300.1|4084664_4085354_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
WP_004151301.1|4085704_4085920_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
WP_004151303.1|4086019_4086214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151304.1|4086302_4086587_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
WP_004151305.1|4086602_4087448_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
WP_004151306.1|4087444_4088125_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
WP_004151308.1|4088121_4088280_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_004151310.1|4088276_4088933_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
WP_004151312.1|4088929_4089697_+	hypothetical protein	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
WP_004151314.1|4089693_4089912_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_004151316.1|4089913_4090129_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151317.1|4090130_4090466_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004151318.1|4090342_4091506_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.3	3.3e-202
WP_004143017.1|4091936_4092803_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
4091520:4091566	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004143016.1|4092804_4093017_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|4093062_4094448_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 12
NZ_CP025005	Klebsiella pneumoniae strain AUSMDU00003562 chromosome, complete genome	5414861	4303985	4315639	5414861	integrase	Enterobacteria_phage(70.0%)	13	4304435:4304449	4327492:4327506
WP_004144574.1|4303985_4305089_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4304435:4304449	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|4305099_4306353_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4306705_4307896_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4307883_4308834_+	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|4308833_4309259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889930.1|4309827_4310394_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_002889919.1|4310411_4310657_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889917.1|4310653_4311391_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889915.1|4311932_4312199_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|4312195_4312753_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|4312749_4312977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4312973_4313294_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4313305_4315639_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4327492:4327506	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 1
NZ_CP025006	Klebsiella pneumoniae strain AUSMDU00003562 plasmid pAUSMDU3562-1, complete sequence	167373	1777	66747	167373	transposase,protease,integrase	uncultured_Caudovirales_phage(26.32%)	59	1038:1051	43463:43476
1038:1051	attL	TCAGCGATGAAGCC	NA	NA	NA	NA
WP_001515717.1|1777_2518_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004152065.1|3661_4609_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_071527918.1|4635_4947_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152067.1|5011_5935_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
WP_004197688.1|6607_6865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152070.1|9901_11179_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_004178088.1|11241_13239_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_085955172.1|14278_15486_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178091.1|16914_17346_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|17596_19072_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|19064_19745_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|19934_21320_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|21348_21702_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004152079.1|21815_23108_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|23118_26265_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_000758228.1|26351_26792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098955.1|26918_29366_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|29406_29604_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|29637_30375_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|30663_31113_-	copper resistance protein	NA	NA	NA	NA	NA
WP_004152083.1|31346_33164_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|33163_34060_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|34099_34480_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|34484_35414_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|35468_36149_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|36145_37546_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_004152085.1|37762_38197_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152086.1|38428_38608_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_031944101.1|40350_40860_+	major intrinsic protein MIP	NA	NA	NA	NA	NA
WP_004152091.1|40909_41407_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152092.1|41738_42065_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085903505.1|42064_42775_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004182005.1|42783_43329_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152095.1|43404_43767_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
43463:43476	attR	TCAGCGATGAAGCC	NA	NA	NA	NA
WP_004152096.1|45663_46200_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152097.1|46232_46658_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152098.1|46670_47960_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152099.1|48007_49759_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152100.1|49776_50139_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152101.1|50188_50539_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152102.1|50896_51166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152103.1|51153_51729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|51759_52254_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152105.1|52297_52666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|52699_52903_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152107.1|52951_53209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152108.1|53284_53539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|53714_53981_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|53968_54451_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020314316.1|54662_56009_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004152113.1|57851_58814_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_009483782.1|58800_59550_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152115.1|59787_59985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152116.1|59984_62780_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152117.1|62894_63464_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152118.1|63498_63780_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004118208.1|64023_64287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118209.1|64301_64565_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000019473.1|65766_66747_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 2
NZ_CP025006	Klebsiella pneumoniae strain AUSMDU00003562 plasmid pAUSMDU3562-1, complete sequence	167373	73216	94498	167373	transposase,integrase	Escherichia_phage(44.44%)	15	66945:66959	95157:95171
66945:66959	attL	TGCCTGATGAGCGCC	NA	NA	NA	NA
WP_004217321.1|73216_73921_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001404364.1|73993_74470_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|74962_75727_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000130000.1|75953_76259_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|76269_77475_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_004152403.1|77901_80799_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.7	2.7e-181
WP_004152402.1|80887_81508_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.5	2.0e-09
WP_004152400.1|82673_83033_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	62.0	3.6e-19
WP_004152398.1|83536_84721_+|transposase	ISAs1-like element ISKpn31 family transposase	transposase	NA	NA	NA	NA
WP_004152397.1|84997_86317_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004199234.1|86566_87448_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152394.1|87735_88515_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|88511_89537_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152392.1|89643_92673_-|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004152391.1|92782_94498_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
95157:95171	attR	TGCCTGATGAGCGCC	NA	NA	NA	NA
