The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025008	Klebsiella pneumoniae strain AUSMDU00008119 chromosome, complete genome	5449340	446326	479583	5449340	portal,tail,integrase,protease,terminase,capsid,tRNA,head	uncultured_Caudovirales_phage(73.33%)	33	463933:463950	479928:479945
WP_002919147.1|446326_447274_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|447288_447798_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|447926_449051_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|449022_449496_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|449521_450064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|450068_450641_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|450644_451463_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|451459_451717_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|451692_452247_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|458041_458263_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|458556_461667_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|461679_462819_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|463197_463848_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
463933:463950	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|464123_465350_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|465442_466384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|466565_466850_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|466860_467640_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_106918304.1|468091_468361_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|468353_468542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|468534_468849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|468845_469214_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|469210_469576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|469575_471711_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|472053_472389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|472437_472950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|473213_474380_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|474431_474992_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|474993_476235_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|476231_476567_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|476563_476863_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|476862_477306_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_000113647.1|477581_477938_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|477921_479583_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
479928:479945	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 2
NZ_CP025008	Klebsiella pneumoniae strain AUSMDU00008119 chromosome, complete genome	5449340	1342912	1396480	5449340	tail,integrase,terminase,capsid,tRNA,holin	Salmonella_phage(41.67%)	63	1331657:1331672	1399408:1399423
1331657:1331672	attL	CGCTCCAGCAGCCTGG	NA	NA	NA	NA
WP_004149335.1|1342912_1344187_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002913890.1|1344221_1344842_+	YfgM family protein	NA	NA	NA	NA	NA
WP_002913889.1|1344852_1346031_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_002913888.1|1346144_1347623_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_004151982.1|1347740_1348820_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_004144303.1|1348869_1349088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151981.1|1349071_1350463_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	33.0	6.3e-35
WP_004151980.1|1350621_1352088_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|1352155_1353733_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004243821.1|1353924_1355175_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.1	1.8e-206
WP_004243823.1|1355191_1355383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243826.1|1355379_1355973_-	adenine methylase	NA	T1SA14	Salmonella_phage	91.9	2.1e-109
WP_004243831.1|1355969_1356719_-	hypothetical protein	NA	R9VWB9	Serratia_phage	56.1	3.1e-73
WP_004243833.1|1356715_1356874_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	80.4	2.5e-17
WP_004243834.1|1356866_1357160_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	70.1	1.2e-31
WP_004144294.1|1357269_1357518_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
WP_004243835.1|1357566_1358448_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	82.3	1.7e-131
WP_004243836.1|1358444_1359266_-	exonuclease VIII/RecE-like protein	NA	A0A193GYK2	Enterobacter_phage	80.2	8.1e-131
WP_004243838.1|1359262_1359562_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	53.5	1.8e-19
WP_042651015.1|1359569_1360472_-	hypothetical protein	NA	A0A059VK18	Pseudomonas_phage	51.6	2.8e-36
WP_004152539.1|1360884_1361466_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.8	1.9e-65
WP_004152538.1|1361619_1361853_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|1361999_1362209_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004207253.1|1362208_1362976_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_004152535.1|1362972_1363758_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.4	8.2e-133
WP_004152534.1|1363877_1364225_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	5.0e-50
WP_004152532.1|1364417_1364828_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	42.2	3.1e-14
WP_004152531.1|1364811_1365003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152530.1|1364999_1365425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152529.1|1365421_1366165_+	hypothetical protein	NA	A6N3G8	Burkholderia_virus	59.5	1.5e-19
WP_004141386.1|1366335_1366548_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_004152527.1|1366544_1367213_+	DUF551 domain-containing protein	NA	Q6UAT8	Klebsiella_phage	52.5	1.5e-05
WP_004152526.1|1367205_1367445_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	48.0	4.6e-10
WP_004152525.1|1367444_1367783_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	4.7e-45
WP_004152524.1|1367857_1368115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152523.1|1368192_1368777_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	2.4e-89
WP_020314691.1|1368773_1370249_+	hypothetical protein	NA	Q858H3	Salmonella_phage	92.7	3.2e-279
WP_004152473.1|1370292_1370814_-	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	55.2	7.8e-47
WP_004152472.1|1371519_1371723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152471.1|1371726_1373406_+|tail	tail protein	tail	T1S9Z7	Salmonella_phage	58.9	3.4e-192
WP_004152470.1|1373402_1373708_+	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
WP_004152468.1|1373989_1374388_+	peptidase	NA	T1SAP9	Salmonella_phage	59.5	5.6e-37
WP_004152467.1|1374400_1375408_+|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	92.5	2.7e-181
WP_004152466.1|1375417_1375810_+	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
WP_004152465.1|1375802_1376081_+	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	6.7e-21
WP_004153043.1|1376129_1376741_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	1.2e-46
WP_004152463.1|1376740_1379218_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.5	3.6e-267
WP_004243848.1|1379219_1379690_+	hypothetical protein	NA	Q858G2	Salmonella_phage	55.9	5.0e-45
WP_004243851.1|1379682_1380180_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	41.7	7.5e-23
WP_004243852.1|1380192_1382937_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	39.2	1.2e-93
WP_004243853.1|1382936_1386326_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	42.0	6.3e-121
WP_004152458.1|1386335_1386950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152457.1|1387224_1387623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152456.1|1387627_1387810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152455.1|1388000_1388696_-	hypothetical protein	NA	A0A193GYJ9	Enterobacter_phage	52.7	4.4e-61
WP_004152454.1|1389076_1389274_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	69.8	2.0e-19
WP_004152453.1|1389277_1389535_-	DUF1902 domain-containing protein	NA	A0A0M4R2Z9	Salmonella_phage	54.1	2.3e-12
WP_002913857.1|1390073_1392335_+|tail	tail fiber protein	tail	A0A0A8J9V7	Klebsiella_phage	35.8	3.7e-69
WP_004146394.1|1392597_1393002_+	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_002913854.1|1392988_1393294_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	1.6e-39
WP_002913853.1|1393283_1393913_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.9	1.8e-90
WP_002913851.1|1393909_1394392_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	76.9	2.8e-59
WP_004152009.1|1394611_1396480_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
1399408:1399423	attR	CCAGGCTGCTGGAGCG	NA	NA	NA	NA
>prophage 3
NZ_CP025008	Klebsiella pneumoniae strain AUSMDU00008119 chromosome, complete genome	5449340	1725204	1732111	5449340	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|1725204_1726068_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_002912638.1|1726078_1726852_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.5e-25
WP_002912636.1|1727094_1727988_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_002912635.1|1728233_1729595_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	2.5e-206
WP_002912634.1|1729913_1730636_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
WP_004151135.1|1730632_1732111_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
>prophage 4
NZ_CP025008	Klebsiella pneumoniae strain AUSMDU00008119 chromosome, complete genome	5449340	2074201	2130687	5449340	protease,plate,transposase	Staphylococcus_phage(16.67%)	52	NA	NA
WP_002910830.1|2074201_2074948_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_004199384.1|2075359_2076373_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_004151439.1|2076365_2077166_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_002910767.1|2077152_2077326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910764.1|2077943_2078885_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_002910762.1|2078978_2079968_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004145486.1|2079993_2081325_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_002910759.1|2081352_2082561_+	propionate kinase	NA	NA	NA	NA	NA
WP_004152312.1|2082589_2084884_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	2.3e-159
WP_004219578.1|2085314_2086430_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002910727.1|2086539_2087454_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002910725.1|2087463_2088741_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_002910722.1|2088737_2089613_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
WP_002910721.1|2089609_2090329_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	2.5e-11
WP_002910720.1|2090334_2091228_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910719.1|2091511_2093155_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	9.8e-136
WP_002910717.1|2093204_2093681_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002910715.1|2093779_2094706_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152313.1|2095009_2096305_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	1.3e-61
WP_004152314.1|2096319_2097126_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152315.1|2097100_2098000_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910657.1|2098109_2098592_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_002910654.1|2098782_2099481_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_004899028.1|2099506_2100091_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|2100160_2100490_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_002910647.1|2100576_2100822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910645.1|2101058_2102399_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004152316.1|2102395_2103049_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004152317.1|2103052_2104750_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004152319.1|2107713_2109069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910593.1|2109069_2109579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|2109575_2110082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910586.1|2110318_2110828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153456.1|2112478_2113402_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.1	1.6e-172
WP_004199326.1|2113543_2113726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153085.1|2113722_2114052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910551.1|2114048_2114555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910549.1|2114600_2114831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004155011.1|2114936_2116046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910547.1|2116069_2116375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910544.1|2116396_2117290_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	6.7e-14
WP_004152633.1|2117473_2118367_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_002910539.1|2118542_2119436_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.8e-12
WP_004152632.1|2119611_2120502_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.8	4.1e-11
WP_000019473.1|2120838_2121819_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_029779706.1|2121942_2122179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004227463.1|2122367_2122625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|2122922_2123189_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004198077.1|2123192_2124350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152262.1|2124333_2127744_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_002910495.1|2127877_2129641_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002910494.1|2129640_2130687_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 5
NZ_CP025008	Klebsiella pneumoniae strain AUSMDU00008119 chromosome, complete genome	5449340	2795539	2806413	5449340		Escherichia_phage(85.71%)	8	NA	NA
WP_004151613.1|2795539_2798647_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|2798701_2799967_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2799997_2801086_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|2801172_2801433_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|2801730_2802591_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2802611_2803373_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|2803633_2804536_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_002210516.1|2805792_2806413_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 6
NZ_CP025008	Klebsiella pneumoniae strain AUSMDU00008119 chromosome, complete genome	5449340	3033909	3073681	5449340	transposase,terminase,integrase	uncultured_Caudovirales_phage(35.42%)	57	3064794:3064808	3070803:3070817
WP_004152576.1|3033909_3034776_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152575.1|3034775_3035549_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|3035545_3036742_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|3036741_3037095_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|3037096_3037750_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152571.1|3037803_3038370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199301.1|3038412_3038595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|3038644_3038986_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|3038985_3040008_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152568.1|3040010_3040313_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152567.1|3040313_3040913_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152566.1|3040912_3042916_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|3042905_3043058_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|3043093_3043519_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_085955245.1|3043845_3045037_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004152178.1|3044978_3045269_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	85.5	2.6e-23
WP_004152177.1|3045279_3046425_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|3046428_3046869_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|3046963_3047350_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|3047349_3047856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|3047852_3048272_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|3048240_3048522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|3048561_3049503_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|3049514_3050009_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|3050012_3051215_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|3051266_3051815_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|3051870_3053322_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|3053559_3054960_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152171.1|3054910_3055663_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152170.1|3055764_3056085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|3056319_3056709_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|3056705_3057236_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|3057238_3057487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|3057892_3058675_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|3058671_3059148_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|3059144_3060107_-	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|3060108_3061767_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|3062343_3062565_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|3062662_3063331_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|3063501_3063816_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|3063808_3063997_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|3064166_3064532_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|3064524_3064779_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004177208.1|3064750_3064969_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
3064794:3064808	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004152156.1|3064965_3065391_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|3065387_3065582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|3065578_3066406_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|3066510_3067029_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|3067034_3067745_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|3067734_3067959_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004152150.1|3067955_3068168_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152149.1|3068164_3068644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152148.1|3068822_3069065_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|3069045_3070227_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|3070423_3070972_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
3070803:3070817	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|3071170_3072703_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|3072919_3073681_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 7
NZ_CP025008	Klebsiella pneumoniae strain AUSMDU00008119 chromosome, complete genome	5449340	3106614	3166731	5449340	transposase,tail,integrase,terminase,holin	Enterobacteria_phage(20.0%)	69	3106396:3106411	3164037:3164052
3106396:3106411	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_002901815.1|3106614_3107286_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
WP_071531199.1|3107472_3108300_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901813.1|3108375_3109641_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_002901812.1|3109642_3110062_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_004152765.1|3110141_3111626_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152776.1|3112523_3112946_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_001067855.1|3113538_3114243_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152703.1|3114491_3116435_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	69.8	1.1e-37
WP_004152702.1|3116676_3117276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152700.1|3117500_3118232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644627.1|3118235_3121190_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	68.3	4.2e-44
WP_004152652.1|3121266_3124335_-	hypothetical protein	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
WP_004152651.1|3124331_3124712_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_004152650.1|3124721_3125204_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	94.4	1.7e-80
WP_004152649.1|3125384_3125849_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	6.7e-58
WP_004152648.1|3126163_3126499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|3126689_3127670_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004217331.1|3127782_3130680_-|tail	tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.7	1.6e-104
WP_099119318.1|3130941_3131133_-	hypothetical protein	NA	S4TR42	Salmonella_phage	78.3	7.8e-05
WP_004217333.1|3131357_3131714_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_016831940.1|3131790_3131997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004226994.1|3132134_3132617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004217341.1|3132670_3133843_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
WP_004190640.1|3133866_3134259_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_004217343.1|3134255_3134807_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	1.3e-28
WP_004217344.1|3134808_3135192_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_004190646.1|3135178_3135412_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
WP_004217346.1|3135421_3135676_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	1.0e-20
WP_004217348.1|3135677_3136073_-	hypothetical protein	NA	A0A1B1P9F2	Acinetobacter_phage	38.5	4.3e-13
WP_004190653.1|3136394_3137348_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_004217351.1|3137358_3138144_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
WP_019405022.1|3138674_3139787_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.1	5.6e-111
WP_004218551.1|3139770_3141171_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	1.1e-127
WP_004190663.1|3141170_3142478_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
WP_004218556.1|3142455_3143460_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
WP_004218558.1|3144322_3144568_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_004190672.1|3145526_3145802_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_004190674.1|3145798_3146143_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004218565.1|3146139_3146679_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_024940884.1|3146675_3146975_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_022644626.1|3147453_3148500_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
WP_004232548.1|3148725_3149415_-	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_004218534.1|3149414_3149555_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004218533.1|3149551_3150190_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218532.1|3150182_3150851_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004243010.1|3150847_3151015_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218531.1|3150995_3151463_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
WP_004218530.1|3151983_3153012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196831.1|3153219_3153465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218528.1|3153520_3153823_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004201118.1|3153819_3154668_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004201117.1|3154664_3155525_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_001548453.1|3155610_3155832_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201115.1|3155872_3156100_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_004201113.1|3156211_3156910_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_019405077.1|3156932_3157052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201109.1|3157197_3158274_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_004201108.1|3158355_3158559_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004135674.1|3158987_3159182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201105.1|3159270_3159555_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004201103.1|3159570_3160416_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_088224434.1|3160412_3160700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201102.1|3160701_3161382_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_004151898.1|3161378_3161807_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004151899.1|3161803_3162466_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004153574.1|3162673_3163861_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
WP_004151901.1|3164037_3164928_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
3164037:3164052	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_004140266.1|3164927_3165920_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|3165921_3166731_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 8
NZ_CP025008	Klebsiella pneumoniae strain AUSMDU00008119 chromosome, complete genome	5449340	3543025	3635976	5449340	tail,plate,portal,integrase,protease,lysis,terminase,capsid,tRNA,head	Salmonella_phage(56.9%)	93	3598551:3598569	3636051:3636069
WP_002898139.1|3543025_3544318_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3544408_3545752_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3545760_3546372_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|3546494_3550748_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|3550883_3551378_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004141839.1|3551883_3552879_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
WP_002898017.1|3552993_3554760_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3554760_3556482_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3556526_3557228_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3557581_3557800_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3557920_3560200_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3560230_3560548_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3560873_3561095_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3561171_3563112_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3563108_3564224_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3564370_3566029_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3566448_3567144_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3567259_3568159_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3568302_3569955_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3569965_3570934_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|3571145_3571580_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3571731_3573450_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3573488_3574490_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3574500_3575943_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3576030_3577044_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3577040_3577871_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3577902_3579042_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|3579919_3580435_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|3580661_3581390_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3581410_3582142_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3582148_3582865_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3582864_3583533_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3583716_3584448_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3584490_3585963_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3585959_3586676_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3586754_3587882_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3587923_3588412_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3588469_3589315_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3589311_3590265_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|3590275_3591409_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|3591572_3592685_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3593033_3593513_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3593601_3594504_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3595325_3595613_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3595815_3596079_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3596085_3596469_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|3596735_3598421_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3598551:3598569	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3598640_3598859_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3598950_3600051_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|3600047_3600533_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896222.1|3600529_3603157_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896220.1|3603149_3603269_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3603283_3603583_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3603635_3604151_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3604160_3605333_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3605471_3606548_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|3606577_3606781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|3606777_3607509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|3607512_3610464_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|3610465_3611065_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3611057_3611966_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_002896179.1|3611952_3612315_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896177.1|3612311_3612884_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004150857.1|3612978_3613671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3613667_3614114_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3614106_3614538_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896168.1|3614633_3615062_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3615058_3615442_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3615446_3615956_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3615936_3616152_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3616155_3616359_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3616358_3616823_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3616918_3617569_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|3617572_3618631_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|3618647_3619481_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3619623_3621390_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3621389_3622415_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|3622476_3624219_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|3624494_3625172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3625286_3625520_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3625530_3625719_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150862.1|3625872_3628287_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|3628283_3629141_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|3629137_3629365_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|3629364_3629598_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|3629665_3630007_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|3629970_3630171_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|3630178_3630688_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|3630720_3630942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|3631087_3631966_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|3631977_3632922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|3633020_3634505_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151720.1|3634923_3635976_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
3636051:3636069	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 9
NZ_CP025008	Klebsiella pneumoniae strain AUSMDU00008119 chromosome, complete genome	5449340	4081085	4126360	5449340	lysis,tRNA,integrase,head	Escherichia_phage(26.42%)	63	4074298:4074344	4123432:4123478
4074298:4074344	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004151249.1|4081085_4083563_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
WP_004151250.1|4083549_4083945_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
WP_004199076.1|4083941_4084412_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_004165520.1|4084411_4084831_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.5	1.8e-30
WP_004151253.1|4084930_4088377_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
WP_004151254.1|4088469_4088973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151255.1|4089100_4089886_-	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
WP_004151256.1|4089951_4090665_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
WP_004151257.1|4090654_4090825_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
WP_004151258.1|4090924_4091284_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
WP_004151259.1|4091300_4091771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151260.1|4092064_4092319_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_004151261.1|4092321_4093077_-	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151262.1|4093252_4093930_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
WP_004151263.1|4093982_4094735_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_004151264.1|4094803_4095196_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
WP_004151265.1|4095192_4095618_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004151266.1|4095620_4095983_-	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
WP_004151267.1|4095982_4096156_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
WP_004151268.1|4096155_4096536_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
WP_004151269.1|4096538_4096778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151270.1|4096788_4097883_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	1.7e-123
WP_004151271.1|4097894_4098323_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
WP_004151272.1|4098326_4099712_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
WP_004151273.1|4099784_4100261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151274.1|4100302_4101307_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
WP_004151275.1|4101281_4102703_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
WP_004151276.1|4102715_4104188_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
WP_004151277.1|4104187_4104790_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
WP_004151279.1|4105160_4105490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151280.1|4105595_4106060_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
WP_004151281.1|4106056_4106587_-	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
WP_004151282.1|4106589_4106838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151283.1|4107747_4108437_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
WP_004151284.1|4108433_4108964_-	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
WP_004151285.1|4108956_4109094_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004151286.1|4109090_4109726_-	protein ninG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_004151287.1|4109718_4109889_-	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
WP_004151288.1|4109888_4110344_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_004151291.1|4110844_4111492_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
WP_004151293.1|4111664_4112507_-	translation repressor RelE	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
WP_004151294.1|4112613_4113120_-	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_004151295.1|4113116_4113410_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004151296.1|4113409_4114840_-	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	66.7	2.6e-185
WP_004151297.1|4114829_4115729_-	hypothetical protein	NA	F1C5C3	Cronobacter_phage	54.9	5.4e-88
WP_001548453.1|4115953_4116175_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004151299.1|4116215_4116449_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_004151300.1|4116576_4117266_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
WP_004151301.1|4117616_4117832_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
WP_004151303.1|4117931_4118126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151304.1|4118214_4118499_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
WP_004151305.1|4118514_4119360_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
WP_004151306.1|4119356_4120037_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
WP_004151308.1|4120033_4120192_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_004151310.1|4120188_4120845_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
WP_004151312.1|4120841_4121609_+	hypothetical protein	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
WP_004151314.1|4121605_4121824_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_004151316.1|4121825_4122041_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151317.1|4122042_4122378_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004151318.1|4122254_4123418_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.3	3.3e-202
WP_004143017.1|4123848_4124715_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
4123432:4123478	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004143016.1|4124716_4124929_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|4124974_4126360_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 10
NZ_CP025008	Klebsiella pneumoniae strain AUSMDU00008119 chromosome, complete genome	5449340	4335897	4347551	5449340	integrase	Enterobacteria_phage(70.0%)	13	4336347:4336361	4359404:4359418
WP_004144574.1|4335897_4337001_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4336347:4336361	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|4337011_4338265_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4338617_4339808_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4339795_4340746_+	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|4340745_4341171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889930.1|4341739_4342306_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_002889919.1|4342323_4342569_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889917.1|4342565_4343303_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889915.1|4343844_4344111_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|4344107_4344665_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|4344661_4344889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4344885_4345206_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4345217_4347551_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4359404:4359418	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 11
NZ_CP025008	Klebsiella pneumoniae strain AUSMDU00008119 chromosome, complete genome	5449340	4815796	4823887	5449340	transposase	Enterobacteria_phage(83.33%)	8	NA	NA
WP_004152207.1|4815796_4818130_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_004152206.1|4818144_4818465_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152205.1|4818461_4818689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153681.1|4818685_4819234_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_004152204.1|4820057_4820795_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004152203.1|4820791_4821037_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|4821054_4821621_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_085956494.1|4822682_4823887_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.2	4.8e-100
>prophage 1
NZ_CP025009	Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-1, complete sequence	176049	1777	103174	176049	protease,lysis,transposase,integrase	Escherichia_phage(25.0%)	90	1038:1051	103833:103847
1038:1051	attL	TCAGCGATGAAGCC	NA	NA	NA	NA
WP_001515717.1|1777_2518_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
1038:1051	attL	TCAGCGATGAAGCC	NA	NA	NA	NA
WP_004152065.1|3661_4609_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_071527918.1|4635_4947_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152067.1|5011_5935_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
WP_004197688.1|6607_6865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020444838.1|7466_8921_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152070.1|9903_11181_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_004178088.1|11243_13241_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_085955172.1|14280_15488_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178091.1|16916_17348_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|17598_19074_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|19066_19747_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|19936_21322_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|21350_21704_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004152079.1|21817_23110_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|23120_26267_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_000758228.1|26353_26794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098955.1|26920_29368_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|29408_29606_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|29639_30377_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|30665_31115_-	copper resistance protein	NA	NA	NA	NA	NA
WP_004152083.1|31348_33166_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|33165_34062_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|34101_34482_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|34486_35416_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|35470_36151_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|36147_37548_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_004152085.1|37764_38199_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152086.1|38430_38610_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_031944101.1|40352_40862_+	major intrinsic protein MIP	NA	NA	NA	NA	NA
WP_004152091.1|40911_41409_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152092.1|41740_42067_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085903505.1|42066_42777_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004182005.1|42785_43331_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152095.1|43406_43769_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
43465:43478	attR	TCAGCGATGAAGCC	NA	NA	NA	NA
WP_004152096.1|45665_46202_+	N-acetyltransferase	NA	NA	NA	NA	NA
43465:43478	attR	TCAGCGATGAAGCC	NA	NA	NA	NA
WP_004152097.1|46234_46660_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152098.1|46672_47962_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152099.1|48009_49761_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152100.1|49778_50141_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152101.1|50190_50541_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152102.1|50898_51168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152103.1|51155_51731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|51761_52256_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152105.1|52299_52668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|52701_52905_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152107.1|52953_53211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152108.1|53286_53541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|53716_53983_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|53970_54453_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020314316.1|54664_56011_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004152113.1|57853_58816_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_009483782.1|58802_59552_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152115.1|59789_59987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152116.1|59986_62782_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152117.1|62896_63466_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152118.1|63500_63782_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004118208.1|64025_64289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118209.1|64303_64567_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000019473.1|65768_66749_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152692.1|67957_68827_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152693.1|68820_69831_-	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152694.1|69839_70667_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152695.1|70675_71539_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004153729.1|71535_72363_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_004217321.1|73218_73923_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_044117068.1|75226_75895_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.9e-130
WP_000018329.1|76084_76900_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|77050_77755_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004199321.1|78095_78917_+	cytotoxic family protein	NA	NA	NA	NA	NA
WP_004152553.1|78926_79184_+	cloacin	NA	NA	NA	NA	NA
WP_004152552.1|79268_79418_+|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_004178196.1|80898_82863_+	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_004152551.1|82862_83594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153058.1|83600_84131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000165971.1|84158_84338_-	Rop family plasmid primer RNA-binding protein	NA	NA	NA	NA	NA
WP_000312627.1|84406_84784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001146176.1|84845_85145_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000072676.1|85134_85398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001143775.1|86028_89034_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.3	0.0e+00
WP_001217881.1|89195_89753_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_063840280.1|89986_90541_+	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_001067855.1|90891_91596_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152398.1|92212_93397_+|transposase	ISAs1-like element ISKpn31 family transposase	transposase	NA	NA	NA	NA
WP_004152397.1|93673_94993_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004199234.1|95242_96124_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152394.1|96411_97191_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|97187_98213_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152392.1|98319_101349_-|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004152391.1|101458_103174_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
103833:103847	attR	TGCCTGATGAGCGCC	NA	NA	NA	NA
>prophage 1
NZ_CP025010	Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-2, complete sequence	118202	11308	49757	118202	transposase,integrase	Escherichia_phage(28.57%)	34	47618:47631	50080:50093
WP_004152342.1|11308_12577_+|transposase	ISL3-like element ISKpn25 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
WP_004152341.1|12696_13170_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_011977773.1|13261_13492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152340.1|14383_15166_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	4.6e-51
WP_004152339.1|15165_15498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152338.1|15504_15861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152337.1|15928_16258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152336.1|16285_16594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153649.1|16639_16846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261282.1|17498_17729_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044770.1|17725_18142_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_004152334.1|18215_18926_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_072093211.1|19657_19783_+	mercury transporter	NA	NA	NA	NA	NA
WP_001340589.1|19818_20241_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|20292_21987_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|22004_22367_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|22363_22600_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000204520.1|22596_23304_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000935452.1|23342_24647_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000027057.1|25214_26075_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|27818_28523_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152403.1|28595_31493_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.7	2.7e-181
WP_004152402.1|31581_32202_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.5	2.0e-09
WP_001143775.1|32611_35617_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.3	0.0e+00
WP_001217881.1|35778_36336_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_063840280.1|36569_37124_+	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_001067855.1|37474_38179_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152398.1|38795_39980_+|transposase	ISAs1-like element ISKpn31 family transposase	transposase	NA	NA	NA	NA
WP_004152397.1|40256_41576_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004199234.1|41825_42707_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152394.1|42994_43774_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|43770_44796_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152392.1|44902_47932_-|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
47618:47631	attL	GTAGCGTTCATGCT	NA	NA	NA	NA
WP_004152391.1|48041_49757_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004152391.1|48041_49757_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
50080:50093	attR	AGCATGAACGCTAC	NA	NA	NA	NA
