The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025048	Escherichia coli strain SC516 chromosome, complete genome	4792402	338733	355107	4792402	terminase,transposase,lysis	Enterobacteria_phage(57.14%)	23	NA	NA
WP_072128192.1|338733_339660_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.7	3.2e-184
WP_000421825.1|339734_340274_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_000548593.1|340824_341031_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_001019207.1|341326_341500_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001443523.1|341672_341828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526745.1|341975_342164_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|342174_342387_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071776.1|342750_343248_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_001092971.1|343244_343778_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189918.1|343774_344086_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	62.6	5.0e-25
WP_000839587.1|344090_344306_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	2.9e-32
WP_001146314.1|344496_345210_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000592549.1|345616_346576_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780584.1|346768_347293_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
WP_001204787.1|347448_347826_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
WP_001265274.1|347843_348893_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	58.2	3.0e-114
WP_072643521.1|348894_349173_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_000980999.1|349239_349491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000887491.1|349707_349920_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_085947771.1|350367_351530_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_072667158.1|351825_352227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072667204.1|353105_353522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077890997.1|353514_355107_-	ATP-binding protein	NA	K7PHD1	Enterobacteria_phage	32.9	5.8e-69
>prophage 2
NZ_CP025048	Escherichia coli strain SC516 chromosome, complete genome	4792402	1562149	1570090	4792402		Escherichia_phage(33.33%)	8	NA	NA
WP_000590403.1|1562149_1563412_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_001278994.1|1563408_1564047_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136934.1|1564051_1564828_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_072643368.1|1564916_1566281_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|1566374_1567367_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272590.1|1567429_1568569_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|1568708_1569335_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|1569328_1570090_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 3
NZ_CP025048	Escherichia coli strain SC516 chromosome, complete genome	4792402	1750829	1883491	4792402	protease,integrase,tRNA,plate,transposase	Staphylococcus_phage(23.08%)	118	1803343:1803358	1825549:1825564
WP_001319878.1|1750829_1751588_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105566.1|1751793_1752714_-	agmatinase	NA	NA	NA	NA	NA
WP_001300904.1|1752851_1754828_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|1754836_1754968_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001300469.1|1755315_1755483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|1755622_1756777_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|1757200_1758595_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_001300769.1|1758671_1759169_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|1759263_1759971_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001300912.1|1760050_1760782_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|1760794_1761745_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|1761853_1762417_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017106.1|1762416_1762833_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001326494.1|1763016_1763997_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|1764014_1764719_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|1764736_1765303_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_000994920.1|1765299_1765590_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174777.1|1765597_1766191_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_000239943.1|1766183_1767320_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000745244.1|1767474_1768482_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394131.1|1768598_1769645_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|1769820_1770540_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|1770723_1771050_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|1771049_1771769_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_072643465.1|1771929_1772982_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|1773009_1773285_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|1773349_1774429_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001299430.1|1774630_1775887_+	nucleoside permease	NA	NA	NA	NA	NA
WP_000839760.1|1775936_1778072_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234517.1|1778469_1779177_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218830.1|1779555_1780818_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	9.3e-78
WP_001389181.1|1780914_1782588_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_001238009.1|1782640_1782838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000766273.1|1782977_1783244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001100175.1|1783240_1784812_-	ATP--cob(I)alamin adenosyltransferase	NA	NA	NA	NA	NA
WP_001207400.1|1784858_1785938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000785681.1|1785986_1786883_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_001389182.1|1787302_1788040_-	porin family protein	NA	NA	NA	NA	NA
WP_000335225.1|1788358_1788832_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001232703.1|1789383_1790391_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_023181052.1|1790416_1791826_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	22.9	1.1e-15
WP_000344909.1|1791825_1793196_-	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000277208.1|1793256_1794774_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_000107666.1|1794941_1795862_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000836532.1|1796794_1797457_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000765976.1|1797642_1798602_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_001389183.1|1798623_1799001_+	RidA family protein	NA	NA	NA	NA	NA
WP_000624710.1|1802045_1802396_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	3.6e-40
WP_000422706.1|1802392_1802812_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	90.7	1.3e-44
WP_094338647.1|1803068_1804342_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.0	6.1e-170
1803343:1803358	attL	AACTGCCGTGTTTCAT	NA	NA	NA	NA
WP_000523766.1|1805554_1805812_+	Major pilu subunit operon regulatory protein papB	NA	NA	NA	NA	NA
WP_000920486.1|1805856_1806363_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000946201.1|1806448_1807036_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000739801.1|1807156_1809667_+	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_001171049.1|1809735_1810467_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001077947.1|1810503_1811067_+	nuclease PIN	NA	NA	NA	NA	NA
WP_001223371.1|1811150_1811669_+	fimbrial protein	NA	NA	NA	NA	NA
WP_072713936.1|1811691_1812684_+	nuclease PIN	NA	NA	NA	NA	NA
WP_012478345.1|1815175_1816150_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_072713934.1|1816206_1816377_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_000745631.1|1816471_1816570_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001237092.1|1816591_1816846_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	60.3	3.5e-16
WP_001294844.1|1818397_1819945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000877066.1|1819944_1824903_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000042910.1|1826104_1826434_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
1825549:1825564	attR	AACTGCCGTGTTTCAT	NA	NA	NA	NA
WP_000950652.1|1826420_1826813_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000439135.1|1827653_1828499_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_046644637.1|1828462_1830154_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001389193.1|1830119_1830305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001167446.1|1830393_1830894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389194.1|1831161_1831392_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000991581.1|1831460_1832021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001126803.1|1832268_1832835_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_001389195.1|1834412_1835117_+	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_001075483.1|1835540_1836272_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000175256.1|1837963_1838755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029396404.1|1838751_1839738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000010399.1|1839844_1840729_+	GTPase	NA	NA	NA	NA	NA
WP_001097362.1|1840847_1841525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278288.1|1841530_1841764_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_100881928.1|1841853_1842672_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.7	2.1e-46
WP_032216512.1|1842763_1843249_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.3e-11
WP_001186724.1|1843264_1843741_+	RadC family protein	NA	NA	NA	NA	NA
WP_001601167.1|1843809_1844031_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	47.2	2.2e-11
WP_032216526.1|1844712_1845081_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000854821.1|1845170_1845548_+	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_023563519.1|1845769_1845967_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001280501.1|1846051_1846894_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_063091691.1|1847175_1847712_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_000094962.1|1847713_1848892_-	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_072643195.1|1848888_1849866_-	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_072643194.1|1849868_1850468_-	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000820113.1|1850464_1850836_-	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_001115154.1|1850832_1851396_-	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_001087289.1|1851399_1851855_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_001173458.1|1851871_1853095_-	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_000249348.1|1853094_1854588_-	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_000498824.1|1854587_1856648_-	type II secretion system secretin GspD	NA	NA	NA	NA	NA
WP_001549326.1|1856677_1857637_-	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001389459.1|1857654_1858065_-	GspS/AspS pilotin family protein	NA	NA	NA	NA	NA
WP_001469316.1|1858130_1858940_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_001469318.1|1859137_1863697_-|protease	lipoprotein metalloprotease SslE	protease	NA	NA	NA	NA
WP_000259302.1|1864181_1865864_-	glycolate permease GlcA	NA	NA	NA	NA	NA
WP_000084131.1|1866218_1868390_-	malate synthase G	NA	NA	NA	NA	NA
WP_000853256.1|1868411_1868816_-	protein GlcG	NA	NA	NA	NA	NA
WP_001194661.1|1868820_1870044_-	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_000943059.1|1870054_1871107_-	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_000026117.1|1871106_1872606_-	glycolate oxidase subunit GlcD	NA	NA	NA	NA	NA
WP_072643192.1|1872856_1873621_+	transcriptional regulator GlcC	NA	NA	NA	NA	NA
WP_001300526.1|1873627_1874770_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000262881.1|1875137_1876868_+	fatty acyl-AMP ligase	NA	NA	NA	NA	NA
WP_001077167.1|1876864_1877779_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000248097.1|1877810_1878059_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_000524970.1|1878058_1879231_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	5.5e-40
WP_001318997.1|1879265_1880345_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000779636.1|1880341_1881412_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001298770.1|1881442_1882003_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_012478345.1|1882516_1883491_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
>prophage 4
NZ_CP025048	Escherichia coli strain SC516 chromosome, complete genome	4792402	3412554	3490198	4792402	terminase,integrase,protease,lysis,tRNA,tail,portal	Enterobacteria_phage(46.55%)	82	3405064:3405079	3431071:3431086
3405064:3405079	attL	CAGCAGAACGCTGGCG	NA	NA	NA	NA
WP_001218286.1|3412554_3413778_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	99.0	9.5e-237
WP_052993680.1|3413962_3415204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024193627.1|3415680_3415977_-	hypothetical protein	NA	U5P0J0	Shigella_phage	72.2	1.1e-24
WP_000335009.1|3416024_3416903_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	93.1	8.2e-166
WP_001371719.1|3416893_3417430_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.3	2.0e-98
WP_100881962.1|3417557_3418382_-	DUF2303 family protein	NA	K7PJQ6	Enterobacteria_phage	98.9	3.0e-149
WP_000135680.1|3418447_3418810_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000859463.1|3419496_3420171_-	LexA family transcriptional repressor	NA	A5LH66	Enterobacteria_phage	100.0	9.2e-133
WP_000649477.1|3420261_3420462_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515860.1|3420505_3421057_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
WP_063501533.1|3421053_3421890_+	ash family protein	NA	A0A291AWU3	Escherichia_phage	98.6	5.5e-151
WP_100882007.1|3421894_3422119_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	95.9	3.5e-36
WP_063501535.1|3422115_3422934_+	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	99.6	4.0e-122
WP_074152360.1|3422930_3423425_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	4.0e-85
WP_001522094.1|3423424_3424078_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	5.6e-127
WP_054192002.1|3424074_3424401_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	97.2	2.9e-52
WP_000767113.1|3424397_3424787_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061438.1|3424806_3425616_+	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	100.0	8.2e-152
WP_021559678.1|3425623_3426613_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	4.3e-195
WP_001547994.1|3426626_3427379_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	100.0	2.8e-138
WP_000217632.1|3427659_3428085_+	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	100.0	3.6e-74
WP_000917724.1|3428308_3428512_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000799656.1|3428662_3429715_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000839596.1|3429782_3429998_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_016063397.1|3430002_3430317_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	100.0	1.7e-52
WP_001274714.1|3430372_3430906_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	99.4	5.1e-102
WP_100881963.1|3430902_3431370_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	2.1e-75
3431071:3431086	attR	CGCCAGCGTTCTGCTG	NA	NA	NA	NA
WP_001139680.1|3431357_3431510_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_000349509.1|3432185_3432677_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_072712546.1|3432676_3434779_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	98.3	0.0e+00
WP_001072975.1|3434775_3434988_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_077625506.1|3434915_3436496_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	2.1e-289
WP_001360054.1|3436440_3438468_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.7	0.0e+00
WP_001097046.1|3438554_3438878_+	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	100.0	8.5e-52
WP_001283153.1|3438870_3439146_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677106.1|3439157_3439736_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001079398.1|3439732_3440134_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211110.1|3440145_3440889_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	99.6	1.7e-132
WP_001298500.1|3440949_3441336_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
WP_001161009.1|3441344_3441674_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_100881964.1|3441645_3444711_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447253.1|3444710_3445040_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_072712553.1|3445049_3445748_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	8.6e-134
WP_072712556.1|3445753_3446497_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	9.2e-150
WP_063118471.1|3446394_3447042_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.8	1.6e-110
WP_153274582.1|3447114_3447453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100881965.1|3447519_3450915_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.1	0.0e+00
WP_069354224.1|3450983_3451583_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	96.0	1.0e-106
WP_100881966.1|3451647_3454920_+|tail	phage tail protein	tail	K7PGT9	Enterobacteria_phage	75.4	0.0e+00
WP_072712050.1|3454974_3455103_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	85.7	4.0e-13
WP_072712037.1|3455547_3457152_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_072665227.1|3457509_3457770_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	95.1	6.9e-36
WP_000202564.1|3457989_3459576_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295410.1|3459968_3460574_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|3460700_3460862_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001299187.1|3460983_3462057_+	patatin family protein	NA	NA	NA	NA	NA
WP_000563070.1|3462053_3462836_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001088381.1|3463250_3464114_-	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_000107765.1|3464085_3465636_-	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001295412.1|3465894_3466674_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_000477828.1|3466840_3468163_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	8.8e-79
WP_000816471.1|3468214_3469438_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_000224877.1|3469494_3470214_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_021514513.1|3470392_3471724_+	type II toxin-antitoxin system HipA family toxin YjjJ	NA	NA	NA	NA	NA
WP_000105843.1|3471724_3472741_-	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000124615.1|3472768_3473413_-	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_001132955.1|3473518_3474487_+	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_001029692.1|3474535_3475918_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_000093812.1|3475938_3477171_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_000046749.1|3477478_3479146_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409472.1|3479356_3481294_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	5.2e-11
WP_000068679.1|3481383_3481710_+	trp operon repressor	NA	NA	NA	NA	NA
WP_001341279.1|3481794_3482316_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000942344.1|3482367_3483015_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_100881967.1|3483011_3483881_-	MDR efflux pump AcrAB transcriptional activator RobA	NA	D0R0F8	Streptococcus_phage	35.9	7.0e-08
WP_000875487.1|3484091_3484565_+	protein CreA	NA	NA	NA	NA	NA
WP_001188679.1|3484577_3485267_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_001219588.1|3485266_3486691_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.7	1.2e-09
WP_000920345.1|3486748_3488101_+	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001194358.1|3488159_3488876_-	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_001303782.1|3488971_3489112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001223188.1|3489511_3490198_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP025048	Escherichia coli strain SC516 chromosome, complete genome	4792402	4273664	4380320	4792402	terminase,integrase,protease,capsid,lysis,tRNA,tail,plate,transposase,head,portal	Salmonella_phage(60.0%)	105	4267081:4267096	4342908:4342923
4267081:4267096	attL	CAGCGCCACCGCCAGT	NA	NA	NA	NA
WP_012478345.1|4273664_4274639_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_000168797.1|4276189_4277455_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114272.1|4277606_4278422_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209342.1|4278567_4281000_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	44.9	1.6e-09
WP_001295295.1|4281005_4281905_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001336208.1|4282035_4282698_+	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.5	2.8e-25
WP_063091809.1|4282773_4283523_-	molybdopterin-synthase adenylyltransferase MoeB	NA	A0A1V0SCZ9	Indivirus	30.6	2.4e-12
WP_000397340.1|4283522_4284758_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_000513775.1|4284961_4285927_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_001301279.1|4285913_4287785_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	5.2e-16
WP_000090140.1|4287804_4289343_+	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
WP_000936043.1|4289360_4290281_+	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
WP_001236051.1|4290283_4291195_+	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
WP_063502035.1|4293728_4295057_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000049367.1|4295103_4296429_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_000497137.1|4296641_4297025_+	biofilm formation regulator BssR	NA	NA	NA	NA	NA
WP_000555031.1|4297135_4298251_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_001295292.1|4298247_4298874_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_001300708.1|4299120_4300323_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	1.1e-99
WP_000450121.1|4300369_4301128_-	DNA-binding transcriptional repressor DeoR	NA	NA	NA	NA	NA
WP_001295291.1|4301185_4301782_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_001180089.1|4302066_4303299_+	multidrug efflux MFS transporter MdfA	NA	NA	NA	NA	NA
WP_000605480.1|4303339_4303624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000023565.1|4303709_4304525_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase	NA	NA	NA	NA	NA
WP_000217859.1|4304524_4305733_-	MFS transporter	NA	NA	NA	NA	NA
WP_001295289.1|4305816_4306353_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000290937.1|4306457_4307510_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_100881977.1|4307593_4309270_-	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	66.8	2.2e-82
WP_000107902.1|4309290_4309887_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	42.4	1.1e-39
WP_000188448.1|4309982_4310204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|4310236_4310746_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956181.1|4310753_4310954_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000963473.1|4310917_4311259_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_001244224.1|4311326_4311560_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
WP_000752619.1|4311559_4311787_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_000104182.1|4311783_4312641_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.8	1.7e-160
WP_100881978.1|4312637_4315052_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.4	0.0e+00
WP_001154434.1|4315205_4315394_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|4315404_4315638_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_021566184.1|4316013_4316745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000549632.1|4316744_4317362_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_021566186.1|4317402_4318434_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.3	2.2e-170
WP_100881979.1|4318433_4320200_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_032427924.1|4320342_4321176_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.7	1.5e-121
WP_032427925.1|4321192_4322248_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.7e-181
WP_021563628.1|4322251_4322902_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	1.5e-111
WP_000673523.1|4322997_4323462_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_000868175.1|4323461_4323665_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_100881980.1|4323668_4323884_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	78.9	1.2e-25
WP_059288047.1|4323864_4324380_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.4	1.3e-89
WP_032180468.1|4324376_4324805_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	87.2	6.8e-57
WP_059288049.1|4324900_4325332_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	2.4e-70
WP_032180470.1|4325324_4325768_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	78.8	2.3e-55
WP_157807952.1|4325793_4327608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072664299.1|4327653_4328232_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	1.2e-93
WP_000177580.1|4328228_4328588_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
WP_095374421.1|4328574_4329483_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	2.7e-143
WP_001086842.1|4329475_4330081_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	7.5e-110
WP_100881981.1|4330077_4332165_+|tail	phage tail protein	tail	A0A0F7LDR4	Escherichia_phage	42.7	2.7e-74
WP_001741479.1|4332164_4332578_+|tail	caudovirales tail fiber assembly family protein	tail	U5P0S4	Shigella_phage	73.0	4.5e-21
WP_000046128.1|4332684_4333857_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	1.0e-203
WP_001207660.1|4333866_4334382_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281009.1|4334436_4334739_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|4334753_4334873_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_100881982.1|4334865_4337943_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	69.2	0.0e+00
WP_089560395.1|4337939_4338425_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	1.4e-66
WP_100881983.1|4338421_4339522_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	1.4e-175
WP_000972391.1|4339612_4339831_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_100881984.1|4340066_4341752_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000681108.1|4342021_4342399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001195240.1|4342428_4342686_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_001201560.1|4342845_4343133_+	DUF1418 family protein	NA	NA	NA	NA	NA
4342908:4342923	attR	ACTGGCGGTGGCGCTG	NA	NA	NA	NA
WP_000684321.1|4344675_4345578_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|4345665_4346142_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126073.1|4346492_4347605_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996005.1|4347699_4348833_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_001093854.1|4348842_4349796_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_063501849.1|4349792_4350638_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|4350697_4351186_+	YbjO family protein	NA	NA	NA	NA	NA
WP_072643426.1|4351226_4352354_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	4.6e-28
WP_001295339.1|4352552_4353284_-	ABC transporter arginine-binding protein 1	NA	NA	NA	NA	NA
WP_000464491.1|4353574_4354243_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_021534997.1|4354242_4354959_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756569.1|4354965_4355697_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|4355714_4356443_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_072643427.1|4356660_4357176_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|4357301_4357625_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255167.1|4357621_4358452_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_100882008.1|4358448_4359462_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136554.1|4359560_4360991_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566372.1|4361001_4362003_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815362.1|4362039_4363758_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
WP_053904901.1|4363890_4364859_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458809.1|4364870_4366523_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491142.1|4366666_4367566_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_047601336.1|4368060_4368756_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599806.1|4369181_4370840_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001355621.1|4370836_4371793_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746460.1|4371943_4373059_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188180.1|4373055_4375002_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_001351689.1|4375074_4375299_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|4375621_4375942_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934034.1|4375972_4378249_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.1e-166
WP_001040187.1|4379112_4379331_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241677.1|4379615_4380320_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP025048	Escherichia coli strain SC516 chromosome, complete genome	4792402	4640368	4717254	4792402	terminase,integrase,holin,protease,capsid,lysis,tRNA,tail,transposase,head,portal	Escherichia_phage(35.71%)	92	4638246:4638305	4718071:4718839
4638246:4638305	attL	AGGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGT	NA	NA	NA	NA
WP_100881991.1|4640368_4641487_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.7	1.6e-84
WP_000003742.1|4641455_4641725_-	excisionase	NA	NA	NA	NA	NA
WP_039022660.1|4641786_4644228_-	exonuclease	NA	V5UQJ3	Shigella_phage	47.0	4.5e-113
WP_001090200.1|4644321_4644513_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|4644509_4644698_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001296188.1|4645097_4645262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171942.1|4645265_4645484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092153.1|4645576_4645777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001003379.1|4646105_4646513_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000476986.1|4646590_4646818_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705377.1|4646801_4647353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039022662.1|4647324_4648365_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	1.8e-90
WP_039022683.1|4648396_4648819_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	2.0e-77
WP_100882009.1|4648882_4649623_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	73.6	5.6e-91
WP_039022664.1|4649619_4650060_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.2	2.3e-60
WP_039022684.1|4650117_4650474_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	3.0e-58
WP_001224672.1|4650567_4650750_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	2.0e-26
WP_001013644.1|4651104_4651317_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	60.0	4.3e-12
WP_000687436.1|4651537_4651798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039022666.1|4651864_4652143_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	4.3e-12
WP_100881992.1|4652144_4653194_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	4.7e-107
WP_100881993.1|4653206_4653566_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.4	2.2e-40
WP_016240600.1|4653562_4654252_+	antitermination protein Q	NA	I6PDF8	Cronobacter_phage	50.2	2.6e-58
WP_000839572.1|4655062_4655278_+|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000193280.1|4655282_4655633_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.9e-37
WP_000992100.1|4655696_4656230_+	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
WP_032145233.1|4656446_4656629_+	membrane protein	NA	A0A0P0ZE50	Stx2-converting_phage	75.4	1.4e-16
WP_001140099.1|4656733_4657084_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	1.2e-64
WP_001317918.1|4657232_4657715_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	5.7e-84
WP_001140902.1|4657714_4659472_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.5	0.0e+00
WP_000478567.1|4659483_4659666_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	96.7	1.1e-24
WP_000466247.1|4659665_4660907_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.9e-242
WP_001193631.1|4660884_4661535_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_021562582.1|4661549_4662755_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.3	2.7e-223
WP_000601355.1|4662806_4662995_+	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	100.0	7.2e-27
WP_000983037.1|4663006_4663312_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	100.0	9.2e-40
WP_001147820.1|4663320_4663659_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	99.1	1.6e-56
WP_100881994.1|4663655_4664105_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.5	3.0e-63
WP_001209399.1|4664101_4664446_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	100.0	4.2e-57
WP_000097533.1|4664505_4665210_+	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	96.2	1.5e-117
WP_001312914.1|4665209_4665596_+|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.8e-64
WP_000978929.1|4665619_4665898_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	89.1	4.2e-39
WP_000394908.1|4665955_4666297_+	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	67.3	2.6e-35
WP_100881995.1|4666345_4669585_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	96.2	0.0e+00
WP_001330090.1|4669562_4669919_+|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_021568068.1|4669918_4670617_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.4	4.0e-131
WP_100881996.1|4670622_4671366_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.1	4.7e-146
WP_146703768.1|4671302_4671935_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.1	2.5e-95
WP_100881998.1|4671995_4675391_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.3	0.0e+00
WP_100881999.1|4675458_4676058_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	94.5	3.0e-103
WP_100882010.1|4676120_4677320_+	hypothetical protein	NA	A0A0P0ZCC1	Stx2-converting_phage	69.6	1.6e-39
WP_000799406.1|4677751_4678615_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|4678598_4679735_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359434.1|4679984_4681211_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|4681259_4682381_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000735412.1|4682456_4683917_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265471.1|4683916_4684588_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_072643408.1|4684756_4686127_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|4686130_4686772_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|4686807_4687914_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|4687967_4688429_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|4688438_4689092_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|4689263_4690514_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741339.1|4690627_4691770_-|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	99.7	8.1e-206
WP_000088653.1|4691759_4691996_-	excisionase	NA	NA	NA	NA	NA
WP_000488406.1|4692135_4692375_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000763387.1|4692422_4692641_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	1.7e-35
WP_077890999.1|4692739_4693021_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	3.6e-46
WP_000548531.1|4693031_4693223_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000149532.1|4693195_4693378_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	96.7	2.8e-28
WP_072643406.1|4693374_4694055_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	99.1	3.0e-131
WP_000100847.1|4694051_4694837_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995467.1|4694842_4695139_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_000372937.1|4695213_4695357_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|4695325_4695490_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000544528.1|4697223_4697529_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_032217964.1|4697515_4697992_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.8	1.7e-85
WP_001228696.1|4698208_4698394_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|4698590_4700048_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001291105.1|4700185_4700977_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_001204028.1|4700969_4701902_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.4e-83
WP_000126788.1|4701879_4702089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016242650.1|4702092_4703187_+	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	80.5	2.2e-112
WP_000625348.1|4703167_4704469_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_100882000.1|4708033_4709195_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	1.4e-51
WP_072643358.1|4709716_4711672_+	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	28.6	7.5e-26
WP_000207931.1|4711668_4712790_+	5-methylcytosine-specific restriction endonuclease system specificity protein McrC	NA	NA	NA	NA	NA
WP_000539894.1|4713501_4713654_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.0	1.4e-20
WP_001295666.1|4713756_4714080_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_032082692.1|4714617_4714728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000332303.1|4715405_4716137_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_012478345.1|4716279_4717254_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
4718071:4718839	attR	ACAAAGTCATCGGGCATTATCTGAACATAAAACACTATCAATAAGTTGGAGTCATTACCTAAACCTGTTACATACATCGACCTGGTCAAAATTATCCTTTCTAAACCGAAGGTGAAGGTTGTGGTTGAGTGAAAATTGATCAGTAAGGCCATAGTGCGGTGTAATTATAGACAGCTAATTAGCTCGTTGCCTCTTGTTACTATTGTTCATTATTTTGTTTGCTATAATTGTTTGAAAGTTTTGACAGGATTGCCATTAGTAGCATGAACAATAGTAATAATCTGGATTATTTCACTCTCTATATCATATTTTCCATTGCATTTATGCTGATCACCCTCCTGGTCATCCTTATTGCAAAACCCAGTACCGGGCTGGGAGAAGTGCTTGTGACGATAAATTTGCTTAATGCCCTTGTTTGGCTGGCGATCAATCTGGTTAATCGATTAAGAGAAAGACTCGTCAACCACAGGGATCAGCAATAATCTTTCAGTTTCTCACTGTCAGTATGCGGCTGAATGGGTTGCTGGCAGTGAACGCCTGGATCATTGAAGGAAAGGCATTATTGCGCAAATAGTTGTCAACCCTGGTGTTATCACGGTTGTTTTTATATATCACCGAAATAATCCTCATCGCAACTATTAACAATTTTGATGTCGAAGAGTTATTTGTTAAACAAAATCGTCACCTCAAAGTGATCAATGTCATGAAAATAAGGTGAAAAATGATAATGCCGACTTATTTATCATTTATATATTGTCGCTGTTTATCT	NA	NA	NA	NA
