The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025037	Klebsiella pneumoniae strain NU-CRE047 chromosome, complete genome	5537943	447698	480951	5537943	tail,tRNA,protease,integrase,head,terminase,portal,capsid	uncultured_Caudovirales_phage(75.0%)	34	465301:465318	481296:481313
WP_002919147.1|447698_448646_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|448660_449170_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|449298_450423_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|450394_450868_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|450893_451436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|451440_452013_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|452016_452835_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|452831_453089_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|453064_453619_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|459409_459631_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|459924_463035_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|463047_464187_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|464565_465216_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
465301:465318	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|465491_466718_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|466810_467752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|467933_468218_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|468228_469008_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_157263200.1|469510_469729_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	1.4e-34
WP_001549752.1|469721_469910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218267.1|469986_470115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|470213_470582_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|470578_470944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|470943_473079_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|473421_473757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|473805_474318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|474581_475748_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|475799_476360_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_058877085.1|476361_477603_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.3	3.9e-230
WP_004150961.1|477599_477935_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|477931_478231_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|478230_478674_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_004150957.1|478666_478819_+	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_000113647.1|478949_479306_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|479289_480951_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
481296:481313	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 2
NZ_CP025037	Klebsiella pneumoniae strain NU-CRE047 chromosome, complete genome	5537943	1237419	1283654	5537943	plate,tail,tRNA,integrase,head,terminase,lysis,portal,capsid,coat	Salmonella_phage(83.72%)	61	1235714:1235760	1272280:1272326
1235714:1235760	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004151020.1|1237419_1238445_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
WP_004151019.1|1238447_1239077_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|1239199_1239442_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|1239474_1239984_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|1239991_1240192_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|1240155_1240494_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|1240561_1240795_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|1240794_1241022_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|1241018_1241870_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151012.1|1241866_1244251_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004151011.1|1244413_1244602_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151010.1|1244613_1244847_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151009.1|1244942_1245626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|1245612_1246692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151007.1|1246691_1247693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|1248214_1248484_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|1248540_1249584_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_019405037.1|1249583_1251347_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151004.1|1251487_1252321_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|1252337_1253390_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|1253393_1254047_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|1254142_1254607_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|1254606_1254810_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|1254813_1255029_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|1255009_1255519_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|1255523_1255907_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|1255903_1256332_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_072093160.1|1256306_1256465_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.0	9.0e-15
WP_004150997.1|1256427_1256850_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|1256842_1257289_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150995.1|1257311_1258178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150994.1|1258272_1258845_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150993.1|1258841_1259204_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150992.1|1259190_1260099_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004152935.1|1260091_1260763_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150990.1|1260764_1262714_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004200602.1|1262723_1263842_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150988.1|1263893_1264967_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|1265115_1266288_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|1266297_1266813_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|1266865_1267165_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|1267179_1267299_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_072093161.1|1267525_1269922_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.5	8.1e-107
WP_004150983.1|1269918_1270404_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|1270400_1271495_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150981.1|1271561_1271780_+	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|1271807_1272185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|1272788_1273271_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1272280:1272326	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004188817.1|1273381_1273858_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|1273847_1274138_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1274204_1274546_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_004145681.1|1274527_1274668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914159.1|1274693_1276355_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1276441_1277320_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|1277444_1278035_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1278154_1279441_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1279460_1280252_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1280415_1281780_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1282039_1282288_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1282306_1282855_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1282886_1283654_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP025037	Klebsiella pneumoniae strain NU-CRE047 chromosome, complete genome	5537943	1388375	1433215	5537943	integrase,holin,terminase,tail	Salmonella_phage(38.0%)	57	1390939:1390953	1402119:1402133
WP_004151980.1|1388375_1389842_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|1389909_1391487_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
1390939:1390953	attL	TCTGCCGCTTCCGCC	NA	NA	NA	NA
WP_004152549.1|1391679_1392930_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.3	1.4e-206
WP_004152548.1|1392946_1393138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152547.1|1393134_1393317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152546.1|1393313_1393907_-	adenine methylase	NA	T1SA14	Salmonella_phage	92.4	4.3e-110
WP_004152545.1|1393903_1394062_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.9e-17
WP_004153052.1|1394054_1394348_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	8.9e-32
WP_004152543.1|1394457_1394706_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	69.5	1.1e-27
WP_004152542.1|1394757_1395780_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.3	2.4e-180
WP_004152541.1|1395789_1396689_-	endonuclease	NA	Q858E0	Salmonella_phage	93.0	1.5e-159
WP_004164029.1|1396685_1396985_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004164037.1|1396981_1397131_-	hypothetical protein	NA	G9L6A5	Escherichia_phage	84.2	7.9e-13
WP_004152539.1|1397351_1397933_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.8	1.9e-65
WP_004152538.1|1398086_1398320_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|1398466_1398676_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004207253.1|1398675_1399443_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_004152535.1|1399439_1400225_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.4	8.2e-133
WP_004152534.1|1400344_1400692_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	5.0e-50
WP_004152532.1|1400884_1401295_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	42.2	3.1e-14
WP_004152531.1|1401278_1401470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152530.1|1401466_1401892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152529.1|1401888_1402632_+	hypothetical protein	NA	A6N3G8	Burkholderia_virus	59.5	1.5e-19
1402119:1402133	attR	GGCGGAAGCGGCAGA	NA	NA	NA	NA
WP_004152528.1|1402631_1402802_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	69.6	2.5e-15
WP_004141386.1|1402802_1403015_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_004152527.1|1403011_1403680_+	DUF551 domain-containing protein	NA	Q6UAT8	Klebsiella_phage	52.5	1.5e-05
WP_004152526.1|1403672_1403912_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	48.0	4.6e-10
WP_004152525.1|1403911_1404250_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	4.7e-45
WP_004152524.1|1404324_1404582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152523.1|1404659_1405244_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	2.4e-89
WP_004154331.1|1405240_1406716_+	hypothetical protein	NA	Q858H3	Salmonella_phage	93.1	3.8e-280
WP_004152449.1|1406782_1407094_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	45.2	2.5e-16
WP_004141368.1|1407895_1408102_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_058876079.1|1408116_1409796_+|tail	phage tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.2	4.3e-264
WP_004152446.1|1409792_1410089_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
WP_004152445.1|1410091_1410772_+	peptidase	NA	G9L6C4	Escherichia_phage	83.5	4.0e-75
WP_032413483.1|1410786_1411773_+	phage protein	NA	A0A193GZ49	Enterobacter_phage	94.2	2.5e-179
WP_004152443.1|1411826_1412264_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.0	4.8e-66
WP_004152442.1|1412274_1412616_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	4.0e-36
WP_004152441.1|1412666_1412990_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
WP_004152440.1|1412989_1413595_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	78.5	2.8e-88
WP_004152439.1|1413594_1416093_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.0	0.0e+00
WP_004152438.1|1416092_1416557_+	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
WP_004152437.1|1416556_1417096_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	6.1e-71
WP_004152436.1|1417106_1419938_+	hypothetical protein	NA	Q858G0	Salmonella_phage	75.7	0.0e+00
WP_004152435.1|1419937_1421848_+	hypothetical protein	NA	Q858F9	Salmonella_phage	81.9	5.2e-290
WP_004152434.1|1421847_1424613_+	hypothetical protein	NA	Q858F8	Salmonella_phage	94.5	0.0e+00
WP_071531206.1|1424755_1425139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152433.1|1425224_1425914_-	hypothetical protein	NA	G9L6E2	Escherichia_phage	65.2	1.6e-79
WP_004152432.1|1426228_1426525_-	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	64.0	1.1e-24
WP_004207261.1|1426681_1429048_+	hypothetical protein	NA	A0A2H5BN49	Klebsiella_phage	79.5	9.1e-268
WP_004229092.1|1429056_1429209_+	hypothetical protein	NA	A0A2H5BN82	Klebsiella_phage	54.3	1.9e-06
WP_004146394.1|1429332_1429737_+	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_004146393.1|1429723_1430029_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	2.7e-39
WP_004152706.1|1430018_1430648_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.4	3.1e-90
WP_004152707.1|1430644_1431127_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	80.6	3.0e-61
WP_004152009.1|1431346_1433215_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 4
NZ_CP025037	Klebsiella pneumoniae strain NU-CRE047 chromosome, complete genome	5537943	1761937	1768844	5537943	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|1761937_1762801_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_002912638.1|1762811_1763585_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.5e-25
WP_004151134.1|1763827_1764724_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_002912635.1|1764966_1766328_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	2.5e-206
WP_002912634.1|1766646_1767369_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
WP_004151135.1|1767365_1768844_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
>prophage 5
NZ_CP025037	Klebsiella pneumoniae strain NU-CRE047 chromosome, complete genome	5537943	1805404	1813029	5537943		Enterobacteria_phage(28.57%)	7	NA	NA
WP_004152488.1|1805404_1806811_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_004152487.1|1807035_1808100_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	3.4e-105
WP_004152486.1|1808126_1808996_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	9.8e-111
WP_004152485.1|1809027_1809918_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.6	2.8e-28
WP_004152484.1|1809932_1810487_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	3.8e-52
WP_004152483.1|1810667_1811834_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_004152482.1|1812027_1813029_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.2e-30
>prophage 6
NZ_CP025037	Klebsiella pneumoniae strain NU-CRE047 chromosome, complete genome	5537943	2193699	2250186	5537943	plate,protease,transposase	Staphylococcus_phage(18.18%)	55	NA	NA
WP_002910830.1|2193699_2194446_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_002910809.1|2194884_2195871_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_004151439.1|2195863_2196664_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_002910767.1|2196650_2196824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004219597.1|2197121_2197265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910764.1|2197441_2198383_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_002910762.1|2198476_2199466_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004145486.1|2199491_2200823_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_002910759.1|2200850_2202059_+	propionate kinase	NA	NA	NA	NA	NA
WP_004152312.1|2202087_2204382_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	2.3e-159
WP_004225356.1|2204433_2204580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910729.1|2204869_2205928_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002910727.1|2206037_2206952_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002910725.1|2206961_2208239_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_002910722.1|2208235_2209111_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
WP_002910721.1|2209107_2209827_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	2.5e-11
WP_002910720.1|2209832_2210726_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910719.1|2211009_2212653_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	9.8e-136
WP_002910717.1|2212702_2213179_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002910715.1|2213277_2214204_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152313.1|2214507_2215803_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	1.3e-61
WP_004899032.1|2215814_2216624_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004152315.1|2216598_2217498_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910657.1|2217607_2218090_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004219568.1|2218187_2218979_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	3.0e-05
WP_002910652.1|2219004_2219544_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|2219658_2219988_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_004148795.1|2220158_2220320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910645.1|2220556_2221897_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004152316.1|2221893_2222547_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004152317.1|2222550_2224248_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004152319.1|2227211_2228567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910593.1|2228567_2229077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|2229073_2229580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910589.1|2229674_2229827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910586.1|2229816_2230326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644641.1|2231931_2232900_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	6.5e-180
WP_004199326.1|2233041_2233224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153085.1|2233220_2233550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910551.1|2233546_2234053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199323.1|2235562_2235874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100852747.1|2235895_2236789_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_004217423.1|2236834_2236951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152633.1|2236972_2237866_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_038435084.1|2237891_2238020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910539.1|2238041_2238935_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.8e-12
WP_004152632.1|2239110_2240001_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.8	4.1e-11
WP_000019473.1|2240337_2241318_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_072093175.1|2241543_2241678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072093174.1|2241938_2242124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|2242421_2242688_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004198077.1|2242691_2243849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152262.1|2243832_2247243_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_002910495.1|2247376_2249140_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004152910.1|2249169_2250186_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 7
NZ_CP025037	Klebsiella pneumoniae strain NU-CRE047 chromosome, complete genome	5537943	2906139	2915553	5537943		Escherichia_phage(87.5%)	9	NA	NA
WP_160463746.1|2906139_2907774_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	55.8	3.1e-182
WP_004151612.1|2907828_2909094_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2909124_2910213_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|2910299_2910560_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|2910857_2911718_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2911738_2912500_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|2912760_2913663_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|2913674_2914940_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|2914932_2915553_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 8
NZ_CP025037	Klebsiella pneumoniae strain NU-CRE047 chromosome, complete genome	5537943	3134275	3177321	5537943	integrase,terminase,transposase	Klebsiella_phage(33.33%)	63	3168434:3168448	3174443:3174457
WP_014343022.1|3134275_3137299_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	44.7	1.6e-22
WP_004152577.1|3137354_3137552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004231602.1|3137526_3137658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004231600.1|3137778_3137943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152575.1|3138417_3139191_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|3139187_3140384_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|3140383_3140737_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|3140738_3141392_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004225248.1|3141445_3141796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004173705.1|3142048_3142234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|3142286_3142628_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|3142627_3143650_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004217362.1|3143652_3143880_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
WP_004225238.1|3143955_3144369_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	55.9	8.1e-31
WP_004152566.1|3144554_3146558_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|3146547_3146700_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|3146735_3147161_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_085955245.1|3147487_3148679_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004152178.1|3148620_3148911_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	85.5	2.6e-23
WP_004152177.1|3148921_3150067_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|3150070_3150511_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|3150605_3150992_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|3150991_3151498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|3151494_3151914_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|3151882_3152164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|3152203_3153145_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|3153156_3153651_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|3153654_3154857_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|3154908_3155457_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|3155512_3156964_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|3157201_3158602_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004218030.1|3158552_3159041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152170.1|3159406_3159727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|3159961_3160351_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|3160347_3160878_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|3160880_3161129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218026.1|3161146_3161275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152168.1|3161312_3161468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|3161534_3162317_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|3162313_3162790_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|3162786_3163749_-	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|3163750_3165409_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|3165983_3166205_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|3166302_3166971_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|3167141_3167456_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|3167448_3167637_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004218017.1|3168010_3168172_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	96.2	1.5e-20
WP_004152157.1|3168164_3168419_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
3168434:3168448	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004146412.1|3168486_3168609_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	100.0	1.3e-16
WP_004152156.1|3168605_3169031_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|3169027_3169222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|3169218_3170046_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|3170150_3170669_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|3170674_3171385_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|3171374_3171599_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004218013.1|3171694_3171808_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	100.0	4.6e-13
WP_014343018.1|3172050_3172284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198245.1|3172356_3172503_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_004152148.1|3172462_3172705_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|3172685_3173867_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|3174063_3174612_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
3174443:3174457	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|3174810_3176343_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|3176559_3177321_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 9
NZ_CP025037	Klebsiella pneumoniae strain NU-CRE047 chromosome, complete genome	5537943	3522741	3547585	5537943	integrase,head,tail,protease	Pectobacterium_phage(29.17%)	36	3536180:3536193	3550312:3550325
WP_004191050.1|3522741_3523215_-	hypothetical protein	NA	K4NYY6	Pseudomonas_phage	46.3	1.8e-26
WP_004191051.1|3523253_3524249_-	hypothetical protein	NA	W6MW28	Pseudomonas_phage	60.2	2.7e-104
WP_004191053.1|3524259_3525018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029503969.1|3525004_3525328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100852757.1|3525330_3526995_-|head,tail	phage head-tail adapter protein	head,tail	A0A221SAN2	Ralstonia_phage	39.4	3.1e-105
WP_009308353.1|3526994_3528389_-	hypothetical protein	NA	A0A0E3JIA1	Rhodoferax_phage	36.9	3.1e-58
WP_020947865.1|3528473_3528926_-	hypothetical protein	NA	A3EYX3	Salmonella_phage	66.4	1.5e-49
WP_009308351.1|3528932_3529193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048256716.1|3529176_3529410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048256713.1|3529478_3529772_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	70.1	1.4e-29
WP_023316634.1|3529768_3530125_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_072071501.1|3530112_3530436_-	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	55.8	2.3e-25
WP_048256710.1|3530425_3531019_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	71.6	2.7e-80
WP_029499143.1|3531087_3531279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048256707.1|3531457_3531799_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	82.0	7.4e-46
WP_048256704.1|3531811_3532429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009308338.1|3532425_3532656_-	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	38.7	2.9e-06
WP_009308336.1|3532658_3533249_-	adenine methylase	NA	A0A2R9YJG0	Escherichia_phage	84.7	4.3e-94
WP_029499137.1|3533376_3534162_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	51.4	1.5e-62
WP_004141586.1|3534201_3534435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009308333.1|3534438_3535089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048256698.1|3535127_3536516_-	AAA family ATPase	NA	Q8HA30	Enterobacteria_phage	47.1	3.4e-105
3536180:3536193	attL	CATCAGCGCCCTGC	NA	NA	NA	NA
WP_162859350.1|3536512_3537496_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	72.9	5.1e-39
WP_016197573.1|3537498_3537657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199487.1|3537740_3538187_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	56.1	7.4e-30
WP_024623103.1|3538247_3538442_-	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	45.9	1.7e-07
WP_024623104.1|3538521_3538923_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	60.2	2.7e-39
WP_029499124.1|3539863_3540097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009308322.1|3540104_3540350_+	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	58.1	1.8e-14
WP_048256693.1|3540379_3542509_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.2	2.9e-95
WP_009308318.1|3542508_3543075_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	61.5	2.5e-51
WP_004141609.1|3543076_3543262_+	hypothetical protein	NA	H9C155	Pectobacterium_phage	44.3	8.1e-07
WP_004199480.1|3543471_3543696_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	68.1	4.5e-20
WP_073579172.1|3543699_3544728_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	54.1	2.6e-94
WP_004150834.1|3545003_3546656_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002898458.1|3546925_3547585_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
3550312:3550325	attR	CATCAGCGCCCTGC	NA	NA	NA	NA
>prophage 10
NZ_CP025037	Klebsiella pneumoniae strain NU-CRE047 chromosome, complete genome	5537943	3632374	3726142	5537943	plate,tail,tRNA,protease,integrase,head,lysis,terminase,portal,capsid,transposase	Salmonella_phage(56.67%)	99	3687901:3687919	3726217:3726235
WP_002898139.1|3632374_3633667_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3633757_3635101_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3635109_3635721_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|3635843_3640097_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_020314624.1|3640232_3640727_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004147787.1|3641010_3641142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002898019.1|3641259_3642228_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_002898017.1|3642342_3644109_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3644109_3645831_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_004141853.1|3645857_3646577_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3646930_3647149_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3647270_3649550_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3649580_3649898_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3650223_3650445_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3650521_3652462_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3652458_3653574_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3653720_3655379_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3655798_3656494_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3656609_3657509_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3657652_3659305_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3659315_3660284_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|3660495_3660930_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3661081_3662800_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3662838_3663840_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3663850_3665293_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3665380_3666394_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3666390_3667221_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3667252_3668392_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|3669269_3669785_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|3670011_3670740_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3670760_3671492_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3671498_3672215_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3672214_3672883_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3673066_3673798_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3673840_3675313_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3675309_3676026_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3676104_3677232_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3677273_3677762_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3677819_3678665_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3678661_3679615_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|3679625_3680759_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|3680922_3682035_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3682383_3682863_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3682951_3683854_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3684675_3684963_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3685165_3685429_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3685435_3685819_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|3686085_3687771_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_004226292.1|3687762_3687885_-	hypothetical protein	NA	NA	NA	NA	NA
3687901:3687919	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3687990_3688209_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3688300_3689401_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|3689397_3689883_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_014342962.1|3689879_3692273_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.0	1.1e-106
WP_002896220.1|3692499_3692619_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3692633_3692933_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3692985_3693501_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3693510_3694683_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3694821_3695898_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_004232615.1|3695927_3696089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|3696127_3696859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162859351.1|3696862_3698359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|3698340_3699321_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_094683695.1|3699361_3700630_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	5.1e-07
WP_004150856.1|3700631_3701231_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3701223_3702132_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_002896179.1|3702118_3702481_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896177.1|3702477_3703050_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004226282.1|3703164_3703329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199112.1|3703327_3703837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3703833_3704280_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3704272_3704704_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896170.1|3704666_3704813_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
WP_002896168.1|3704799_3705228_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3705224_3705608_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3705612_3706122_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3706102_3706318_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3706321_3706525_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3706524_3706989_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3707084_3707735_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|3707738_3708797_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|3708813_3709647_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3709789_3711556_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3711555_3712581_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_100852760.1|3712642_3714385_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|3714660_3715338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3715452_3715686_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3715696_3715885_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150862.1|3716038_3718453_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|3718449_3719307_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|3719303_3719531_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|3719530_3719764_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|3719831_3720173_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|3720136_3720337_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|3720344_3720854_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|3720886_3721108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|3721253_3722132_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|3722143_3723088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178082.1|3723186_3724674_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_014342959.1|3725161_3726142_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
3726217:3726235	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 11
NZ_CP025037	Klebsiella pneumoniae strain NU-CRE047 chromosome, complete genome	5537943	4171225	4216500	5537943	integrase,head,lysis,tRNA	Escherichia_phage(26.42%)	66	4164443:4164489	4213572:4213618
4164443:4164489	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004151249.1|4171225_4173703_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
WP_004151250.1|4173689_4174085_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
WP_004199076.1|4174081_4174552_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_004151252.1|4174551_4175028_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.7	3.0e-37
WP_004151253.1|4175070_4178517_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
WP_004151254.1|4178609_4179113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151255.1|4179240_4180026_-	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
WP_004151256.1|4180091_4180805_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
WP_004151257.1|4180794_4180965_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
WP_004151258.1|4181064_4181424_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
WP_004151259.1|4181440_4181911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151260.1|4182204_4182459_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_004151261.1|4182461_4183217_-	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151262.1|4183392_4184070_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
WP_004151263.1|4184122_4184875_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_004151264.1|4184943_4185336_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
WP_004151265.1|4185332_4185758_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004151266.1|4185760_4186123_-	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
WP_004151267.1|4186122_4186296_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
WP_004151268.1|4186295_4186676_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
WP_004151269.1|4186678_4186918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151270.1|4186928_4188023_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	1.7e-123
WP_004151271.1|4188034_4188463_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
WP_004151272.1|4188466_4189852_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
WP_004151273.1|4189924_4190401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151274.1|4190442_4191447_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
WP_004151275.1|4191421_4192843_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
WP_004151276.1|4192855_4194328_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
WP_004151277.1|4194327_4194930_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
WP_004151279.1|4195300_4195630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151280.1|4195735_4196200_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
WP_004151281.1|4196196_4196727_-	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
WP_004151282.1|4196729_4196978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151283.1|4197887_4198577_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
WP_004151284.1|4198573_4199104_-	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
WP_004151285.1|4199096_4199234_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004151286.1|4199230_4199866_-	protein ninG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_004151287.1|4199858_4200029_-	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
WP_004151288.1|4200028_4200484_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_004151291.1|4200984_4201632_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
WP_004151292.1|4201628_4201805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151293.1|4201804_4202647_-	translation repressor RelE	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
WP_004151294.1|4202753_4203260_-	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_004151295.1|4203256_4203550_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004230547.1|4203549_4204965_-	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	67.1	1.8e-183
WP_004230546.1|4204969_4205821_-	hypothetical protein	NA	F1C5C3	Cronobacter_phage	56.3	5.3e-85
WP_004151298.1|4205861_4206008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001548453.1|4206093_4206315_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004151299.1|4206355_4206589_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_004151300.1|4206716_4207406_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
WP_004151301.1|4207756_4207972_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
WP_004151302.1|4207968_4208079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151303.1|4208071_4208266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151304.1|4208354_4208639_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
WP_004151305.1|4208654_4209500_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
WP_004151306.1|4209496_4210177_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
WP_004151308.1|4210173_4210332_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_004151310.1|4210328_4210985_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
WP_004151312.1|4210981_4211749_+	hypothetical protein	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
WP_004151314.1|4211745_4211964_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_004151316.1|4211965_4212181_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151317.1|4212182_4212518_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004151318.1|4212394_4213558_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.3	3.3e-202
WP_004143017.1|4213988_4214855_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
4213572:4213618	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004143016.1|4214856_4215069_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|4215114_4216500_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 12
NZ_CP025037	Klebsiella pneumoniae strain NU-CRE047 chromosome, complete genome	5537943	4426055	4437709	5537943	integrase	Enterobacteria_phage(70.0%)	15	4425907:4425920	4430120:4430133
4425907:4425920	attL	TCTGACATATTTTT	NA	NA	NA	NA
WP_004144574.1|4426055_4427159_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
WP_002889940.1|4427169_4428423_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4428775_4429966_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4429953_4430904_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
4430120:4430133	attR	AAAAATATGTCAGA	NA	NA	NA	NA
WP_004152979.1|4430903_4431329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020802988.1|4431675_4431825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002889930.1|4431897_4432464_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_002889919.1|4432481_4432727_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889917.1|4432723_4433461_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_004903606.1|4433760_4433898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002889915.1|4434002_4434269_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_072028197.1|4434271_4434823_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|4434819_4435047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4435043_4435364_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4435375_4437709_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
>prophage 13
NZ_CP025037	Klebsiella pneumoniae strain NU-CRE047 chromosome, complete genome	5537943	4907146	4912971	5537943		Enterobacteria_phage(100.0%)	8	NA	NA
WP_004152207.1|4907146_4909480_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_004152206.1|4909494_4909815_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152205.1|4909811_4910039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072093163.1|4910035_4910578_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_000556592.1|4910580_4910847_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_004152204.1|4911407_4912145_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004152203.1|4912141_4912387_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|4912404_4912971_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
>prophage 1
NZ_CP025038	Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence	199686	21441	64176	199686	bacteriocin,integrase,transposase	Salmonella_phage(20.0%)	37	27426:27485	76941:77269
WP_004178051.1|21441_23763_+|bacteriocin	klebicin B-related nuclease bacteriocin	bacteriocin	NA	NA	NA	NA
WP_004152296.1|23764_24043_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_009485932.1|24383_24863_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.2	9.8e-20
WP_004199332.1|25183_25462_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_004171457.1|25678_25756_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004152292.1|25748_26606_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_072093215.1|26656_26815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032408758.1|26899_27034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029505403.1|27242_27452_-	hypothetical protein	NA	NA	NA	NA	NA
27426:27485	attL	GAACATCCCCCTAAGCGTCAGCAGCAAGCTGCCGCCGCTAAGGCCCCGGAAATCACGCCC	NA	NA	NA	NA
WP_000957857.1|33222_33411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003846917.1|35565_36819_-	lactose permease	NA	NA	NA	NA	NA
WP_004152287.1|36870_39945_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
WP_004152286.1|40066_41149_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
WP_100852771.1|41609_42584_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_087741209.1|43023_44028_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_004883563.1|44209_44482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|44609_45449_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|45442_45790_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|45953_46745_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_071523897.1|46750_46996_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|47152_47650_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|47794_48808_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|49010_49361_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|49486_50047_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|50049_53016_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_087741209.1|53094_54099_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_071527925.1|54396_54639_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004118251.1|54969_55263_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
WP_004152282.1|55361_56129_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004152281.1|56129_57086_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_004118243.1|57082_58081_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004118241.1|58077_58980_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_032448473.1|59024_61349_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_004118237.1|61434_62388_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_004118235.1|62384_62906_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_161989521.1|63867_64080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118231.1|64008_64176_+|integrase	integrase	integrase	NA	NA	NA	NA
76941:77269	attR	GAACATCCCCCTAAGCGTCAGCAGCAAGCTGCCGCCGCTAAGGCCCCGGAAATCACGCCCTTTACGTCGTAAACGCCGTAAAGCCCGCTCACCGGGGTTAAAAGGGATTACTTTGACTTCTTCATTGCTGTTAGATGGTTAAGGCTAATCAGGGCAGGGGGTAGGGTGGCAGAGTTTATAGCCAGGTAACCGGCTACGCCGGGCTTTCGGCGCCATTTGACTCCACAGACACATGTAACCTCATCTGGCGCCTCCATGCCGCTGACGCGGCATCCAGAAGTTTCCCGATGCTGTAAGTCTTAACGTCTGCTTTGTGCCAGAAGCGGACA	NA	NA	NA	NA
>prophage 2
NZ_CP025038	Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence	199686	76459	105552	199686	transposase,protease	Escherichia_phage(30.0%)	24	NA	NA
WP_020956879.1|76459_76846_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	90.7	1.1e-58
WP_004118217.1|77393_78029_-	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_000005560.1|78025_79138_-	His-Xaa-Ser system radical SAM maturase HxsC	NA	S5WIP3	Leptospira_phage	33.8	1.5e-47
WP_004118216.1|79130_80519_-	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	29.0	6.3e-51
WP_000333416.1|80518_80791_-	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
WP_000412211.1|82407_83067_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|83267_83645_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000427619.1|83955_84960_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|86294_86999_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004153729.1|87854_88682_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_004152695.1|88678_89542_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152694.1|89550_90378_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152693.1|90386_91397_+	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152692.1|91390_92260_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000019473.1|93467_94448_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004118209.1|95649_95913_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004118208.1|95927_96191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152118.1|96434_96716_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004152117.1|96750_97320_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152116.1|97434_100230_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152115.1|100229_100427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009483782.1|100664_101414_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152113.1|101400_102363_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_020314316.1|104205_105552_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP025039	Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_2, complete sequence	146689	6840	69325	146689	transposase,integrase	Escherichia_phage(24.14%)	62	NA	NA
WP_087439983.1|6840_8215_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	74.1	1.4e-79
WP_022644891.1|8385_9426_+	ATP-binding protein	NA	M4QMW8	Micromonas_pusilla_virus	35.2	9.5e-20
WP_162859354.1|9631_11914_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_015065592.1|12347_13880_-|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	3.1e-51
WP_004196353.1|13968_15309_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_032072095.1|15564_15987_-	nickel resistance OB fold protein NcrY	NA	NA	NA	NA	NA
WP_004196366.1|16148_17279_-	Ni(II)/Co(II) efflux transporter permease subunit NcrC	NA	NA	NA	NA	NA
WP_004196355.1|17291_17561_-	nickel-sensing transcriptional repressor NcrB	NA	NA	NA	NA	NA
WP_004196314.1|17666_18965_-	MFS transporter	NA	NA	NA	NA	NA
WP_004196325.1|19198_19957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196315.1|20010_20931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196359.1|20993_21365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152397.1|22276_23596_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004152396.1|23845_24727_-	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
WP_004152394.1|25045_25825_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|25821_26847_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152392.1|26953_29983_-|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004152391.1|30092_31808_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001217881.1|32922_33480_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_063840280.1|33713_34268_+	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_001206315.1|34337_35126_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000722315.1|35185_36010_+	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
WP_000027057.1|36709_37570_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001120891.1|37779_38319_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000480968.1|38290_39127_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|39126_39930_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|39990_40806_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000954592.1|41135_41312_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_000427619.1|41493_42498_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|44394_45099_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_025404032.1|45134_45440_+	IncN plasmid KikA protein	NA	NA	NA	NA	NA
WP_001452736.1|45475_45787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064577928.1|45995_46484_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_001749967.1|46488_46695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072094655.1|47106_48510_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	9.0e-106
WP_004098817.1|48543_49758_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001389365.1|50018_50783_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001144737.1|50925_51192_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_004201280.1|51412_51886_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_022644888.1|52041_52971_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.1	1.5e-45
WP_001067855.1|52861_53566_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001348075.1|53612_53849_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001044770.1|53922_54339_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261282.1|54335_54566_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_032072060.1|55110_55431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644887.1|55479_56118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644886.1|56120_56906_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	1.9e-52
WP_032408936.1|56963_57221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032072094.1|57349_57463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012539983.1|58093_58849_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	95.2	1.7e-135
WP_022644883.1|58936_60475_-|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.7	4.6e-281
WP_000612626.1|60523_60871_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_007372134.1|60867_61272_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	97.8	1.6e-68
WP_015632469.1|62053_63259_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	4.0e-163
WP_022644882.1|63258_64233_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	55.0	9.4e-86
WP_022644881.1|64314_65586_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.5	1.6e-149
WP_020805749.1|65585_66017_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	3.6e-29
WP_001568038.1|66249_67221_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_022644880.1|67223_67895_+	plasmid stability mediator StbB	NA	NA	NA	NA	NA
WP_001568040.1|67956_68187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072216848.1|68305_68422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152355.1|68623_69325_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
>prophage 1
NZ_CP025040	Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_3, complete sequence	83541	59189	82673	83541	transposase	Escherichia_phage(16.67%)	21	NA	NA
WP_001067855.1|59189_59894_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|61569_62274_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001235713.1|62969_63527_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_022644723.1|63690_66696_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.6	0.0e+00
WP_001141270.1|67708_67984_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_000842086.1|68014_69124_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.1	3.7e-30
WP_000235177.1|69165_69564_+	VOC family protein	NA	NA	NA	NA	NA
WP_009652884.1|69629_70466_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000470624.1|70493_71129_-	recombinase family protein	NA	NA	NA	NA	NA
WP_022644720.1|71296_74335_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.6	2.5e-294
WP_001567660.1|74358_75381_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_020314648.1|75840_76119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020314646.1|76436_77048_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_020314639.1|77044_77998_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	57.1	9.5e-75
WP_022644719.1|78118_78385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020314642.1|78404_79025_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.0	1.0e-08
WP_022644718.1|79622_80249_+	ParA family protein	NA	A0A2H4EW66	Aeromonas_phage	34.4	4.5e-25
WP_020314634.1|80293_80521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020314652.1|80695_81970_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.7	1.3e-148
WP_046960466.1|81981_82431_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.0	2.3e-31
WP_020314635.1|82427_82673_-	DinI-like family protein	NA	Q7Y3V9	Yersinia_phage	39.3	1.1e-08
>prophage 1
NZ_CP025042	Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_5, complete sequence	35713	0	17515	35713	integrase	Escherichia_phage(66.67%)	8	3758:3770	19142:19154
WP_058876132.1|1310_7046_-	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
3758:3770	attL	CATTTTCAAGGGA	NA	NA	NA	NA
WP_009309939.1|7232_9275_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000443938.1|9267_10719_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000957857.1|11758_11947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644731.1|13831_14707_+	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	57.1	1.9e-82
WP_004197649.1|15331_15958_+	ParA family plasmid-partitioning AAA ATPase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
WP_006788217.1|16077_16257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197635.1|16720_17515_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
19142:19154	attR	TCCCTTGAAAATG	NA	NA	NA	NA
>prophage 2
NZ_CP025042	Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_5, complete sequence	35713	26052	33570	35713	transposase	Salmonella_phage(33.33%)	7	NA	NA
WP_015065644.1|26052_29019_-|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
WP_001247892.1|29093_29384_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001293886.1|29380_29782_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000215515.1|29771_30128_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000091613.1|30382_30697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194048.1|31123_32305_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	64.2	1.9e-120
WP_000509966.1|32964_33570_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
