The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018259	Acinetobacter bereziniae strain XH901 chromosome, complete genome	4509124	1293623	1316462	4509124	terminase,capsid	Acinetobacter_phage(50.0%)	31	NA	NA
WP_035301583.1|1293623_1293857_-	hypothetical protein	NA	A0A2H4J515	uncultured_Caudovirales_phage	61.0	1.5e-18
WP_100884732.1|1293853_1294942_-	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	35.7	1.8e-45
WP_100884733.1|1294941_1295154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100884734.1|1295164_1295935_-	hypothetical protein	NA	M4QPI3	Sulfitobacter_phage	41.9	3.3e-25
WP_100884735.1|1295937_1296240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100884736.1|1296239_1296707_-	hypothetical protein	NA	A0A0N7IRE9	Acinetobacter_phage	46.8	3.1e-26
WP_100884737.1|1296932_1297238_-	hypothetical protein	NA	A0A0D4DCL0	Acinetobacter_phage	84.7	2.3e-38
WP_100884738.1|1297253_1298027_-	LexA family transcriptional regulator	NA	J7I4M9	Acinetobacter_phage	65.9	2.9e-74
WP_004824772.1|1298447_1298945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004824771.1|1298993_1299269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004824770.1|1299265_1299574_+	hypothetical protein	NA	A0A0P0I444	Acinetobacter_phage	39.6	7.7e-10
WP_100884740.1|1299570_1300701_+	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	59.1	1.6e-28
WP_100884741.1|1300697_1302293_+	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	50.8	1.5e-128
WP_100884742.1|1302289_1302664_+	HNH endonuclease	NA	Q3HQV7	Burkholderia_phage	46.1	6.4e-27
WP_171266124.1|1302823_1303222_+	hypothetical protein	NA	A0A0P0I8E8	Acinetobacter_phage	61.4	1.7e-38
WP_100884744.1|1303226_1303739_+	hypothetical protein	NA	A0A0P0IY98	Acinetobacter_phage	68.4	1.9e-61
WP_042085246.1|1304131_1304368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042085248.1|1304418_1304649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167387386.1|1304736_1305381_+	hypothetical protein	NA	A0A0P0IKQ5	Acinetobacter_phage	63.2	7.9e-57
WP_157811001.1|1305653_1305839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100884745.1|1305869_1306049_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_100886267.1|1306068_1307526_+	DNA cytosine methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	40.1	9.1e-93
WP_100884747.1|1308274_1308916_+	hypothetical protein	NA	A0A2H4JE07	uncultured_Caudovirales_phage	82.5	1.3e-104
WP_100884748.1|1308974_1309439_+	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	49.4	3.2e-28
WP_100884749.1|1309439_1310978_+|terminase	phage terminase large subunit	terminase	H9C0C7	Vibrio_phage	37.8	6.0e-87
WP_100884750.1|1310979_1312473_+	DUF935 family protein	NA	A0A2H4JHL1	uncultured_Caudovirales_phage	44.7	4.3e-106
WP_100884751.1|1312483_1313686_+|capsid	minor capsid protein	capsid	A0A2K9VGX3	Faecalibacterium_phage	33.3	7.4e-24
WP_100884752.1|1313686_1313977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100884753.1|1314032_1314992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009584029.1|1314995_1315373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042085275.1|1315385_1316462_+|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	22.5	9.2e-18
>prophage 2
NZ_CP018259	Acinetobacter bereziniae strain XH901 chromosome, complete genome	4509124	1399685	1472690	4509124	integrase,capsid,tRNA,terminase,tail,portal,plate	Pseudomonas_phage(36.36%)	79	1399635:1399651	1436014:1436030
1399635:1399651	attL	TACAGGTTGCGTTACAA	NA	NA	NA	NA
WP_100886268.1|1399685_1400918_+|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	38.4	1.9e-75
WP_100884797.1|1400914_1401115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100884798.1|1401184_1401493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100884799.1|1401492_1401960_-	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	49.7	4.6e-30
WP_100884800.1|1402086_1403805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100884801.1|1403846_1404980_-	DUF4297 domain-containing protein	NA	NA	NA	NA	NA
WP_100884802.1|1404988_1405684_-	helix-turn-helix domain-containing protein	NA	A0A0P0J076	Acinetobacter_phage	43.3	3.6e-31
WP_100884803.1|1405775_1405985_+	hypothetical protein	NA	A0A0N7IRE1	Acinetobacter_phage	73.9	7.0e-23
WP_100884804.1|1406092_1406356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100884805.1|1406401_1406662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100884806.1|1406658_1406967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100884807.1|1406963_1407887_+	helix-turn-helix domain-containing protein	NA	A0A0P0HSN8	Acinetobacter_phage	58.2	6.3e-23
WP_100884808.1|1407883_1408360_+	hypothetical protein	NA	G3EN88	Psychrobacter_phage	40.1	2.7e-22
WP_157811003.1|1408619_1409024_+	hypothetical protein	NA	A0A088FQJ8	Escherichia_phage	32.5	1.6e-10
WP_100884811.1|1409239_1409851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100884812.1|1409970_1410339_+	MFS transporter	NA	V5YTL8	Pseudomonas_phage	39.5	3.5e-09
WP_100884813.1|1410338_1410788_+	glycoside hydrolase family protein	NA	A0A1I9L2K1	Xanthomonas_phage	58.7	3.6e-40
WP_042086497.1|1411017_1411521_+|terminase	terminase small subunit	terminase	V5YUM0	Pseudomonas_phage	47.3	2.2e-30
WP_100884814.1|1411504_1413475_+|terminase	phage terminase large subunit family protein	terminase	V5YTA4	Pseudomonas_phage	67.5	6.4e-251
WP_100884815.1|1413579_1414113_+	hypothetical protein	NA	A0A1W6JT65	Escherichia_phage	52.0	8.6e-41
WP_157811004.1|1414119_1415694_+|portal	phage portal protein	portal	V5YTM3	Pseudomonas_phage	58.6	7.6e-170
WP_100884817.1|1415693_1417724_+|capsid	phage major capsid protein	capsid	V5YSS9	Pseudomonas_phage	50.8	5.7e-178
WP_100884818.1|1417783_1418062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100884819.1|1418064_1418403_+	hypothetical protein	NA	V5YTH3	Pseudomonas_phage	47.3	3.0e-23
WP_100884820.1|1418389_1418917_+|tail	phage tail protein	tail	A0A088FVG9	Escherichia_phage	39.4	3.3e-21
WP_100884821.1|1418892_1419456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100884822.1|1419452_1420052_+|plate	phage baseplate assembly protein V	plate	V5YUM9	Pseudomonas_phage	41.4	1.0e-21
WP_100884823.1|1420051_1420387_+	GPW/gp25 family protein	NA	V5YTB2	Pseudomonas_phage	60.6	1.5e-30
WP_100884824.1|1420394_1421309_+|plate	baseplate J/gp47 family protein	plate	A0A0M4REB7	Salmonella_phage	44.2	1.2e-66
WP_100884825.1|1421305_1421836_+|tail	phage tail protein I	tail	A0A077KER5	Ralstonia_phage	35.7	3.2e-24
WP_100884826.1|1421843_1424819_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	41.0	1.8e-26
WP_100884827.1|1424821_1425451_+	hypothetical protein	NA	E5G6P1	Salmonella_phage	32.2	1.1e-15
WP_100884828.1|1425567_1426746_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	V5YTI0	Pseudomonas_phage	56.5	8.8e-147
WP_100884829.1|1426755_1427268_+|tail	phage major tail tube protein	tail	V5YTN5	Pseudomonas_phage	56.0	1.0e-46
WP_100884830.1|1427270_1427567_+|tail	phage tail assembly protein	tail	A0A193GYZ8	Enterobacter_phage	53.8	8.1e-17
WP_100884831.1|1427792_1430237_+|tail	phage tail tape measure protein	tail	A0A1W6JT50	Escherichia_phage	42.0	1.9e-143
WP_042086528.1|1430236_1430692_+|tail	phage tail protein	tail	A0A1W6JT48	Escherichia_phage	47.3	9.9e-30
WP_100884832.1|1430694_1430910_+|tail	tail protein X	tail	D5LGY2	Escherichia_phage	52.1	6.3e-11
WP_100884833.1|1430900_1431893_+|tail	phage tail protein	tail	V5YTN9	Pseudomonas_phage	47.3	3.9e-79
WP_100884834.1|1432029_1432509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100884835.1|1432781_1433315_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_100884836.1|1433698_1433962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100884837.1|1434285_1435740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035301414.1|1436623_1436815_+	hypothetical protein	NA	NA	NA	NA	NA
1436014:1436030	attR	TACAGGTTGCGTTACAA	NA	NA	NA	NA
WP_005030158.1|1436977_1437166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100886269.1|1437514_1438093_+	DUF4189 domain-containing protein	NA	NA	NA	NA	NA
WP_005030154.1|1438650_1439202_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_005030151.1|1439366_1439648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100884838.1|1439879_1440203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167387351.1|1440811_1440967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100884839.1|1441789_1442170_+	MliC family protein	NA	NA	NA	NA	NA
WP_058970623.1|1442470_1442848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005030142.1|1442844_1443057_+	helix-turn-helix transcriptional regulator	NA	S5M643	Brevibacillus_phage	39.4	1.3e-05
WP_100884840.1|1443830_1444244_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_004831574.1|1444250_1444607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004831572.1|1444865_1445045_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_004831570.1|1446156_1446384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004831569.1|1446514_1446805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100884841.1|1447268_1447964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004831566.1|1448050_1448752_-	DNA polymerase III subunit epsilon	NA	A0A059VJT9	Pseudomonas_phage	41.0	6.4e-36
WP_100884842.1|1449298_1450606_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_100884843.1|1451677_1452904_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_004831563.1|1453064_1454318_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.9	2.6e-96
WP_004831562.1|1454547_1454952_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_100884844.1|1455029_1456562_-	DUF4139 domain-containing protein	NA	NA	NA	NA	NA
WP_042086648.1|1456839_1457337_+	chorismate lyase	NA	NA	NA	NA	NA
WP_009586209.1|1457354_1458233_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_042085112.1|1458416_1459643_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_100886270.1|1459711_1461070_-	purine permease	NA	NA	NA	NA	NA
WP_100884845.1|1461231_1462410_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_042085122.1|1462573_1463158_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_042085124.1|1463353_1464745_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_046761277.1|1464807_1465608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171064906.1|1465796_1466129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009586238.1|1466331_1467162_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_100884846.1|1467640_1470415_+	insulinase family protein	NA	A0A2K9LA15	Tupanvirus	30.6	2.4e-17
WP_046761281.1|1470528_1471020_+	YfbM family protein	NA	NA	NA	NA	NA
WP_004831549.1|1471079_1471859_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_100884847.1|1471958_1472690_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP018259	Acinetobacter bereziniae strain XH901 chromosome, complete genome	4509124	2133077	2179430	4509124	transposase,holin,integrase,capsid,terminase	Acinetobacter_phage(35.71%)	64	2134598:2134613	2186842:2186857
WP_004830870.1|2133077_2133389_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	43.6	3.5e-18
WP_042087057.1|2133466_2133751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100885134.1|2133771_2134122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100885135.1|2134165_2134534_-	sulfurtransferase complex subunit TusD	NA	NA	NA	NA	NA
2134598:2134613	attL	TATACAATGATTTTAG	NA	NA	NA	NA
WP_005029089.1|2134812_2135832_+|integrase	site-specific integrase	integrase	A0A0R6PHH4	Moraxella_phage	44.8	2.1e-72
WP_046760018.1|2135828_2136116_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_100885136.1|2136194_2136797_-	HNH endonuclease	NA	A0A1S5SAI9	Streptococcus_phage	37.0	1.0e-18
WP_100885137.1|2136800_2137040_-	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	48.7	1.9e-08
WP_100885138.1|2137039_2138359_-	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	30.0	1.7e-37
WP_100885139.1|2138371_2139154_-	hypothetical protein	NA	M4QPI3	Sulfitobacter_phage	40.9	4.3e-25
WP_100885140.1|2139156_2139459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100885141.1|2139458_2139926_-	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	52.4	1.5e-33
WP_100885142.1|2140137_2140464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005029066.1|2140545_2141481_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.0	2.6e-16
WP_100885143.1|2141527_2141830_-	hypothetical protein	NA	A0A0D4DCL0	Acinetobacter_phage	78.6	5.2e-35
WP_100885144.1|2141862_2142585_-	LexA family transcriptional regulator	NA	E7C9R0	Salmonella_phage	31.1	1.4e-09
WP_100885145.1|2142687_2142882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100885146.1|2142943_2143435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100885147.1|2143501_2143747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100885148.1|2143743_2144040_+	hypothetical protein	NA	A0A0P0I444	Acinetobacter_phage	60.4	1.0e-27
WP_100885149.1|2144036_2144957_+	helix-turn-helix domain-containing protein	NA	A0A0P0HSN8	Acinetobacter_phage	59.3	1.4e-22
WP_100885150.1|2144957_2145371_+	hypothetical protein	NA	A0A0P0IKL1	Acinetobacter_phage	62.7	2.3e-41
WP_100885151.1|2145373_2145871_+	hypothetical protein	NA	A0A0P0IY98	Acinetobacter_phage	36.5	2.3e-19
WP_009586282.1|2146211_2146406_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_100885153.1|2146398_2147661_-	exodeoxyribonuclease VII large subunit	NA	NA	NA	NA	NA
WP_100885154.1|2148044_2148257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009586283.1|2148287_2148497_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	61.9	3.4e-17
WP_100885155.1|2148928_2149180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100885157.1|2149730_2150036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100886288.1|2150518_2150740_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_100885158.1|2150878_2151088_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	60.3	1.3e-16
WP_100885159.1|2151256_2151712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100885160.1|2152014_2152305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167387354.1|2152410_2152584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100885161.1|2153069_2153480_+	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	61.6	4.3e-40
WP_100885162.1|2153466_2154108_+	hypothetical protein	NA	A0A2H4JE07	uncultured_Caudovirales_phage	83.0	3.5e-105
WP_042085261.1|2154166_2154631_+	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	52.9	3.3e-33
WP_049044611.1|2154620_2156024_+|terminase	phage terminase large subunit	terminase	J7I460	Acinetobacter_phage	73.9	1.7e-197
WP_100886289.1|2156034_2157486_+	DUF935 family protein	NA	A0A2H4JHL1	uncultured_Caudovirales_phage	46.0	1.7e-107
WP_100885163.1|2157553_2158135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100885164.1|2158177_2159380_+|capsid	minor capsid protein	capsid	A0A2K9VGX3	Faecalibacterium_phage	32.8	1.6e-23
WP_100885165.1|2159425_2160046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100885166.1|2160098_2161046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100885167.1|2161060_2161447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100885168.1|2161449_2162523_+|capsid	major capsid protein	capsid	A0A291AUL7	Sinorhizobium_phage	23.9	3.6e-14
WP_100885169.1|2162533_2162902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100885170.1|2162910_2163351_+	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	37.0	1.1e-09
WP_100885171.1|2163351_2163849_+	phage virion morphogenesis protein	NA	NA	NA	NA	NA
WP_049044626.1|2163823_2164246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004824730.1|2164254_2164425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100885172.1|2164417_2165152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100885173.1|2165216_2165771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042085294.1|2165831_2166116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157811010.1|2166154_2166805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100885175.1|2166885_2170833_+	tape measure protein	NA	J7HXG0	Pseudomonas_phage	37.3	3.6e-43
WP_004824722.1|2170836_2171250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100885176.1|2171242_2173198_+	hypothetical protein	NA	A0A0M4U447	Ralstonia_phage	34.5	3.2e-93
WP_100885177.1|2173197_2174814_+	hypothetical protein	NA	A0A0M4U447	Ralstonia_phage	39.5	2.6e-104
WP_100885178.1|2174867_2176085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100885179.1|2176088_2176409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100885180.1|2176408_2176801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100885181.1|2176812_2178864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004831754.1|2178856_2179087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005028957.1|2179148_2179430_+|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	54.0	1.8e-18
2186842:2186857	attR	TATACAATGATTTTAG	NA	NA	NA	NA
>prophage 4
NZ_CP018259	Acinetobacter bereziniae strain XH901 chromosome, complete genome	4509124	2742221	2841412	4509124	integrase,tRNA,capsid,terminase,tail,head,portal,protease	uncultured_Caudovirales_phage(26.47%)	99	2767350:2767379	2803806:2803835
WP_004824440.1|2742221_2742956_-|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_100885443.1|2743026_2743806_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_100885444.1|2743802_2744411_-	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_100885445.1|2744447_2746049_-	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_004824446.1|2746352_2747348_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_100885446.1|2747850_2748795_-	ADP-ribosylglycohydrolase family protein	NA	G3M9X5	Bacillus_virus	27.4	1.4e-25
WP_004824451.1|2748921_2750802_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_100885447.1|2751057_2751483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009584495.1|2751978_2752857_+	bile acid:sodium symporter family protein	NA	NA	NA	NA	NA
WP_004824454.1|2752982_2753885_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_046761099.1|2753906_2754764_+	DUF3426 domain-containing protein	NA	NA	NA	NA	NA
WP_001086304.1|2755138_2755408_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_100885448.1|2755502_2757077_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.6	7.1e-67
WP_005032218.1|2757212_2758496_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_004824462.1|2758631_2759144_+	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	40.0	9.1e-16
WP_100885450.1|2760082_2760703_-	serine hydrolase family protein	NA	NA	NA	NA	NA
WP_004824470.1|2761415_2762288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100885451.1|2762363_2763389_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.4	8.2e-32
WP_004824474.1|2763385_2764081_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_100885452.1|2764240_2764870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100885453.1|2765061_2765796_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_004719296.1|2766882_2767086_+	hypothetical protein	NA	NA	NA	NA	NA
2767350:2767379	attL	TTGGCAGAGGATCAAGGATTCGAACCTTGA	NA	NA	NA	NA
WP_100885454.1|2767628_2767817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167387357.1|2767942_2768596_+	DUF4145 domain-containing protein	NA	M1PSB6	Streptococcus_phage	36.2	5.4e-29
WP_100885455.1|2769086_2769950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100885457.1|2770121_2770490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100886303.1|2770489_2770996_-	lysozyme	NA	A0A0B5L5F7	Acinetobacter_phage	91.7	1.7e-83
WP_100885458.1|2770979_2771213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100885459.1|2771257_2771449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100885460.1|2771448_2775435_-	host specificity protein J	NA	A0A0R6PGJ9	Moraxella_phage	63.0	0.0e+00
WP_100885461.1|2775487_2776150_-|tail	tail assembly protein	tail	G3ENB6	Psychrobacter_phage	44.5	6.9e-40
WP_100885462.1|2776133_2776889_-|tail	phage tail protein	tail	A0A0R6PIS5	Moraxella_phage	55.6	1.3e-79
WP_100885463.1|2776892_2777696_-|tail	phage minor tail protein L	tail	A0A0R6PIJ5	Moraxella_phage	56.2	1.3e-80
WP_100885464.1|2777682_2778663_-	hypothetical protein	NA	A0A0D4DCQ4	Acinetobacter_phage	46.9	5.1e-47
WP_100885465.1|2778713_2779055_-|tail	phage tail protein	tail	A0A0R6PHH7	Moraxella_phage	39.6	2.6e-11
WP_100885466.1|2779100_2779370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100885467.1|2779370_2783162_-	replication protein	NA	A0A0U4JEA4	Pseudomonas_phage	39.6	1.8e-44
WP_100885468.1|2783221_2783551_-	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	42.3	2.7e-13
WP_100885469.1|2783553_2784183_-	hypothetical protein	NA	A0A2H4J3H7	uncultured_Caudovirales_phage	50.5	1.8e-45
WP_100885470.1|2784264_2784912_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	55.6	1.4e-32
WP_100885471.1|2785263_2785476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100885472.1|2785487_2786021_-|tail	phage tail assembly chaperone family protein, TAC	tail	NA	NA	NA	NA
WP_100885473.1|2786063_2786537_-	structural protein 3 family protein	NA	A0A2H4JBZ0	uncultured_Caudovirales_phage	51.6	1.2e-38
WP_100885474.1|2786609_2786951_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_100885475.1|2786947_2787451_-	HK97 gp10 family phage protein	NA	A0A2H4J6A2	uncultured_Caudovirales_phage	48.5	5.2e-32
WP_100885476.1|2787454_2787805_-|head	phage head closure protein	head	K7PH08	Enterobacteria_phage	43.9	5.8e-14
WP_100885477.1|2787808_2787988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100885478.1|2788126_2788408_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JAM4	uncultured_Caudovirales_phage	44.2	1.2e-14
WP_100885479.1|2788394_2789666_-|portal	phage portal protein	portal	A0A2H4JB65	uncultured_Caudovirales_phage	51.7	3.5e-117
WP_100885480.1|2789666_2789939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100885481.1|2789997_2791326_-|capsid	phage major capsid protein	capsid	A0A0R6PCM7	Moraxella_phage	52.5	1.6e-120
WP_100885482.1|2791322_2791937_-|head,protease	HK97 family phage prohead protease	head,protease	A0A0R6PHN0	Moraxella_phage	42.4	2.7e-38
WP_100885484.1|2792129_2793821_-|terminase	terminase large subunit	terminase	A0A2H4J6B3	uncultured_Caudovirales_phage	67.3	1.8e-217
WP_100885485.1|2793821_2794271_-	hypothetical protein	NA	A0A2H4J8R0	uncultured_Caudovirales_phage	46.1	7.5e-22
WP_100885486.1|2794555_2794771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157811012.1|2794786_2794933_-	hypothetical protein	NA	A0A2H4JE05	uncultured_Caudovirales_phage	64.3	1.8e-09
WP_100885487.1|2794929_2795244_-	HNH endonuclease	NA	A0A0R6PH58	Moraxella_phage	55.2	2.2e-20
WP_100885488.1|2795243_2795603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100885489.1|2795804_2796278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100885491.1|2796654_2798469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100885492.1|2798465_2799374_-	toprim domain-containing protein	NA	A0A0R6PHP8	Moraxella_phage	34.5	1.0e-49
WP_100885493.1|2799376_2799886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100885494.1|2800228_2800870_+	helix-turn-helix domain-containing protein	NA	A0A2H4JAJ5	uncultured_Caudovirales_phage	43.0	2.3e-24
WP_100885495.1|2801021_2801342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167387358.1|2801377_2801800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100885497.1|2801796_2801991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100885498.1|2802181_2803354_+|integrase	site-specific integrase	integrase	G3EN73	Psychrobacter_phage	60.1	5.3e-136
WP_100885499.1|2803364_2803742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100885500.1|2804114_2804927_-	protein kinase	NA	NA	NA	NA	NA
2803806:2803835	attR	TTGGCAGAGGATCAAGGATTCGAACCTTGA	NA	NA	NA	NA
WP_004824479.1|2804923_2806435_-	DUF3336 domain-containing protein	NA	NA	NA	NA	NA
WP_004824480.1|2806634_2807507_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_046761096.1|2807797_2811370_+	DNA polymerase III subunit alpha	NA	A0A291AWR1	Streptomyces_phage	35.1	5.9e-178
WP_171066794.1|2811433_2812243_+	TrmJ/YjtD family RNA methyltransferase	NA	NA	NA	NA	NA
WP_100885501.1|2812242_2813067_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_167387395.1|2813389_2814229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046761094.1|2814332_2816345_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004824489.1|2816435_2816852_-	GFA family protein	NA	NA	NA	NA	NA
WP_005032253.1|2817031_2817277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005032254.1|2817376_2817814_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_100885502.1|2817848_2818505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004824493.1|2818626_2819271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004824494.1|2819328_2819907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004824497.1|2819938_2820718_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_004824499.1|2820843_2821476_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_100885503.1|2821517_2823128_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_004824502.1|2823726_2824683_+	ribonuclease Z	NA	NA	NA	NA	NA
WP_100885504.1|2825436_2827068_+	TROVE domain-containing protein	NA	R4TL80	Halovirus	23.7	5.9e-24
WP_100885505.1|2828013_2828295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100886304.1|2828719_2829979_+	RtcB family protein	NA	W6AR47	Erwinia_phage	61.0	6.1e-138
WP_005032272.1|2830124_2830586_+	DIP1984 family protein	NA	NA	NA	NA	NA
WP_004824515.1|2831322_2832354_+	RNA 3'-terminal phosphate cyclase	NA	NA	NA	NA	NA
WP_100885506.1|2832550_2832994_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_100885507.1|2833724_2834105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100885508.1|2834239_2836486_-	bifunctional prephenate dehydrogenase/3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_004824524.1|2836518_2837625_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_005032287.1|2837877_2838396_+|protease	DJ-1/PfpI/YhbO family deglycase/protease	protease	NA	NA	NA	NA
WP_005032289.1|2838484_2838790_-	DUF1905 domain-containing protein	NA	NA	NA	NA	NA
WP_005032291.1|2839078_2840221_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_005032293.1|2840449_2841412_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	29.1	1.0e-23
>prophage 5
NZ_CP018259	Acinetobacter bereziniae strain XH901 chromosome, complete genome	4509124	3355615	3412759	4509124	transposase,protease,tRNA	Bacillus_phage(40.0%)	59	NA	NA
WP_005033035.1|3355615_3356425_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_100885717.1|3356722_3359311_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_100885718.1|3359311_3360061_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.9	1.4e-33
WP_042066420.1|3360111_3360723_+	arylesterase	NA	NA	NA	NA	NA
WP_171266161.1|3360933_3362142_+	MFS transporter	NA	NA	NA	NA	NA
WP_100885720.1|3362315_3362648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005033046.1|3363033_3363354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100885721.1|3363558_3364095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100885722.1|3364106_3365219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100885723.1|3365713_3366484_-	DUF4882 family protein	NA	NA	NA	NA	NA
WP_167387365.1|3366793_3367081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004829504.1|3367943_3368561_-	bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH	NA	NA	NA	NA	NA
WP_100885724.1|3368813_3369533_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_100885725.1|3369903_3370638_+	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
WP_100885726.1|3370811_3372272_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_004829508.1|3372370_3372544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004829509.1|3372674_3374129_-	ribonuclease G	NA	NA	NA	NA	NA
WP_058968990.1|3374180_3374747_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_004829511.1|3374734_3375232_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004829512.1|3375218_3376076_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_171064911.1|3376107_3377145_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_004829513.1|3377282_3377597_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_005033053.1|3377649_3379128_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_005033054.1|3379127_3380603_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_100885727.1|3380676_3381429_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	35.9	1.9e-30
WP_005029849.1|3381479_3381857_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_082179805.1|3381853_3382402_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_100885728.1|3383550_3384387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100885729.1|3384441_3384936_-	DinB family protein	NA	NA	NA	NA	NA
WP_167387398.1|3385187_3385646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100885730.1|3386377_3387394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100885731.1|3387658_3389731_-	M13 family metallopeptidase	NA	A0A1V0SHG2	Klosneuvirus	29.6	5.2e-94
WP_100885732.1|3389946_3390831_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042090004.1|3391008_3391590_+	chromate transporter	NA	NA	NA	NA	NA
WP_042090002.1|3391596_3392115_+	chromate transporter	NA	NA	NA	NA	NA
WP_100885733.1|3392254_3392728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162987651.1|3392999_3393560_+|protease	DJ-1/PfpI/YhbO family deglycase/protease	protease	NA	NA	NA	NA
WP_004829530.1|3393739_3393928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009586366.1|3394068_3394983_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100885735.1|3395104_3396214_+	muconate cycloisomerase	NA	NA	NA	NA	NA
WP_005033095.1|3396228_3396519_+	muconolactone Delta-isomerase	NA	NA	NA	NA	NA
WP_100885736.1|3396669_3397590_+	catechol 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_100885737.1|3397723_3398407_+	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_100885738.1|3398403_3399060_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_100885739.1|3399195_3400401_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_100885740.1|3400486_3401266_+	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
WP_100885741.1|3401530_3403213_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_100885742.1|3403628_3403919_+	phenol hydroxylase	NA	NA	NA	NA	NA
WP_100885743.1|3403937_3404939_+	aromatic/alkene monooxygenase hydroxylase subunit beta	NA	NA	NA	NA	NA
WP_005033116.1|3404951_3405221_+	MmoB/DmpM family protein	NA	NA	NA	NA	NA
WP_004829543.1|3405290_3406817_+	YHS domain-containing protein	NA	NA	NA	NA	NA
WP_005033119.1|3406912_3407275_+	phenol hydroxylase	NA	NA	NA	NA	NA
WP_100885744.1|3407286_3408348_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_100885745.1|3408451_3409372_+	catechol 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_100885746.1|3409468_3410350_+	transporter	NA	NA	NA	NA	NA
WP_009586765.1|3410549_3410963_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100885747.1|3411052_3411859_+	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_157811018.1|3411927_3412323_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	53.2	1.1e-32
WP_157811019.1|3412333_3412759_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.7	6.8e-25
>prophage 6
NZ_CP018259	Acinetobacter bereziniae strain XH901 chromosome, complete genome	4509124	3662148	3669342	4509124		Burkholderia_virus(50.0%)	7	NA	NA
WP_100885878.1|3662148_3663249_-	DUF3396 domain-containing protein	NA	A4JWV3	Burkholderia_virus	33.2	3.3e-39
WP_100885879.1|3663266_3664367_-	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	38.2	4.3e-55
WP_100885880.1|3664384_3665482_-	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	37.7	1.0e-56
WP_100885881.1|3665499_3666600_-	DUF3396 domain-containing protein	NA	A4JWV3	Burkholderia_virus	34.0	2.6e-39
WP_100885882.1|3666613_3667327_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	46.8	3.8e-36
WP_100885883.1|3667319_3667853_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_100885884.1|3668232_3669342_-	acyltransferase	NA	T1SAQ6	Salmonella_phage	28.0	7.3e-10
