The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015524	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF10978 chromosome, complete genome	4679990	868349	875662	4679990	integrase,protease	Dickeya_phage(16.67%)	7	857087:857101	875880:875894
857087:857101	attL	AGCCTGCGAGGAGAC	NA	NA	NA	NA
WP_001201751.1|868349_869468_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125875.1|869464_871411_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|871540_871762_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|872085_872406_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934064.1|872436_874713_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_001117984.1|874925_875123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001539594.1|875284_875662_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
875880:875894	attR	GTCTCCTCGCAGGCT	NA	NA	NA	NA
>prophage 2
NZ_CP015524	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF10978 chromosome, complete genome	4679990	926121	987639	4679990	tail,protease,tRNA	Salmonella_phage(23.53%)	54	NA	NA
WP_001154025.1|926121_926925_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|926917_928240_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|928220_928925_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572746.1|928924_933391_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925870.1|933735_935586_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|935845_936394_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|936421_937069_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|937130_938321_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977709.1|938505_939597_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
WP_000117867.1|940190_941591_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.8	4.5e-81
WP_000762342.1|941791_942253_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544855.1|942570_943785_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893200.1|944030_945467_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191404.1|945544_946747_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001676370.1|946941_947352_-	enterohemolysin	NA	H6WRX0	Salmonella_phage	100.0	5.0e-33
WP_000274547.1|947372_948002_+	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
WP_000729406.1|947985_948612_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_000583382.1|948608_950318_+|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
WP_000143167.1|950317_950899_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_072100753.1|950902_951151_-|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
WP_001674638.1|951376_952345_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000334547.1|952992_953619_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001525490.1|953978_954665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|954935_955127_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193790.1|955553_958166_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_000291723.1|958373_959384_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001574119.1|959549_960092_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224079.1|960088_961198_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|961296_963405_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|963417_965325_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333139.1|965339_966593_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|966597_968238_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|968234_968798_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|969053_969221_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|969320_969839_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156448.1|969907_971668_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|971853_972306_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|972377_973430_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288733.1|973786_974296_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_066038538.1|974512_975118_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950876.1|975104_977258_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|977276_977723_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|977846_979901_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|979936_980395_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|980489_981152_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000975204.1|981322_981739_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|981783_982101_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140478.1|982158_983370_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859416.1|983584_984133_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548080.1|984158_984938_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|984986_985268_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904449.1|985264_985594_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374046.1|985680_986340_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000938186.1|986958_987639_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	2.2e-81
>prophage 3
NZ_CP015524	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF10978 chromosome, complete genome	4679990	1160031	1176146	4679990	tail,integrase,holin,lysis	Salmonella_phage(30.77%)	16	1159867:1159896	1179488:1179517
1159867:1159896	attL	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
WP_000087636.1|1160031_1161111_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
WP_001575998.1|1161085_1161364_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_001237395.1|1161777_1163757_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_000972675.1|1164388_1164694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000940753.1|1164757_1165357_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000784710.1|1165353_1165581_+	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_001097218.1|1165710_1166400_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_001574213.1|1166496_1167021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798708.1|1167394_1167844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001574215.1|1168204_1168891_-	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_001574216.1|1169166_1169496_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|1169479_1169932_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|1169949_1170429_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000877926.1|1171323_1171857_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152416.1|1171946_1172642_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_072100756.1|1175282_1176146_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.9	9.0e-48
1179488:1179517	attR	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
>prophage 4
NZ_CP015524	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF10978 chromosome, complete genome	4679990	1400571	1416515	4679990	holin,tRNA	Escherichia_phage(62.5%)	21	NA	NA
WP_000123686.1|1400571_1401945_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
WP_001156217.1|1401988_1402924_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_001676915.1|1403240_1403858_-	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_000800272.1|1403885_1404203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560208.1|1404287_1404509_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000004762.1|1404946_1405468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085981757.1|1405575_1405731_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_001227859.1|1406115_1406583_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_001676916.1|1406855_1407185_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001033796.1|1407346_1407901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000556390.1|1407897_1408830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000882662.1|1409199_1409412_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000940751.1|1409935_1410535_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000774470.1|1410534_1410825_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000640113.1|1410821_1411358_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
WP_000900605.1|1413528_1413924_+	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	88.9	4.7e-44
WP_001688615.1|1413845_1414034_+	hypothetical protein	NA	Q8W636	Enterobacteria_phage	57.4	9.4e-11
WP_000445513.1|1414023_1414305_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.4	1.3e-16
WP_000802786.1|1414301_1414847_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	83.4	2.3e-89
WP_000159240.1|1415692_1416031_+	EamA family transporter	NA	NA	NA	NA	NA
WP_001082296.1|1416080_1416515_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
>prophage 5
NZ_CP015524	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF10978 chromosome, complete genome	4679990	1948702	1996198	4679990	protease,holin,portal,head,capsid,terminase,integrase,tail,transposase,plate	Salmonella_phage(77.78%)	60	1993591:1993605	1999917:1999931
WP_001028172.1|1948702_1949725_-|transposase	IS110-like element ISSaen1 family transposase	transposase	NA	NA	NA	NA
WP_001176778.1|1950186_1951005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526483.1|1952347_1952569_-	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_000492926.1|1952781_1953789_+	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_000760554.1|1954073_1954643_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	7.3e-107
WP_000554738.1|1954642_1956205_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	99.8	9.8e-287
WP_001207832.1|1956191_1956779_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_001699732.1|1956781_1957861_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.4	5.5e-204
WP_000605050.1|1957853_1958267_-	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_001273650.1|1958271_1958805_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	99.4	2.1e-95
WP_001066630.1|1958804_1959863_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
WP_000863817.1|1959859_1961200_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.1	1.1e-249
WP_000785387.1|1961233_1963162_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.5	0.0e+00
WP_000588852.1|1963246_1963573_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|1963569_1963926_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007993.1|1963925_1965422_-|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	99.2	3.0e-277
WP_000497739.1|1965411_1965576_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_000779215.1|1965579_1966140_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	99.5	3.0e-105
WP_001135695.1|1966136_1966649_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	93.5	1.4e-85
WP_000776844.1|1966620_1967025_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	96.3	1.5e-69
WP_000927251.1|1967021_1967345_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	72.0	2.6e-40
WP_000766103.1|1967424_1968654_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	90.9	1.8e-206
WP_000003793.1|1968663_1969266_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	91.5	2.0e-99
WP_077905357.1|1969258_1970353_-|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	82.7	7.3e-180
WP_000257219.1|1970624_1972355_-|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	58.9	3.2e-198
WP_000501481.1|1972354_1972792_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	63.7	1.6e-32
WP_001135228.1|1972938_1973289_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	3.1e-63
WP_000127618.1|1973312_1973852_-	DUF2514 domain-containing protein	NA	A0A0A0P0G7	Enterobacteria_phage	37.2	5.3e-06
WP_001075993.1|1973848_1974466_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	78.9	3.2e-92
WP_000226304.1|1974465_1974747_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.3e-36
WP_001294874.1|1974733_1975123_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	71.0	1.8e-40
WP_000765639.1|1975211_1975784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000357930.1|1975796_1976870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047141.1|1976919_1977672_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.0	1.9e-134
WP_012543375.1|1977685_1978675_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	1.9e-190
WP_001061459.1|1978682_1979543_-	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	98.3	1.5e-159
WP_000779149.1|1979559_1979949_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	99.2	1.9e-69
WP_000200166.1|1979957_1980839_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	96.2	8.3e-166
WP_000054227.1|1980835_1981309_-	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	94.6	3.9e-53
WP_000096529.1|1981305_1982280_-	hypothetical protein	NA	A0A1C9IHW0	Salmonella_phage	97.8	1.2e-165
WP_000620702.1|1982276_1982501_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087406.1|1982497_1983655_-	peptidase	NA	Q8HA97	Salmonella_phage	98.4	2.8e-214
WP_000509728.1|1983651_1984206_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	98.9	3.4e-101
WP_001191666.1|1984234_1984459_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020644.1|1984556_1985252_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	2.7e-127
WP_001067433.1|1985457_1985643_+	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	73.3	1.2e-13
WP_000078504.1|1985718_1985970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000551790.1|1986539_1987457_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	59.7	1.3e-97
WP_000008351.1|1987551_1988091_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000764235.1|1988161_1988392_+	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000071068.1|1988388_1988904_+	DUF262 domain-containing protein	NA	A0A2H4FWH2	Salmonella_phage	96.5	1.3e-94
WP_000065085.1|1988900_1989260_+	Eaf protein	NA	T1SA95	Salmonella_phage	89.9	1.0e-58
WP_000267991.1|1989531_1989825_+	hypothetical protein	NA	A0A1V0E5L2	Salmonella_phage	100.0	1.5e-50
WP_000208076.1|1989821_1990685_+	DUF551 domain-containing protein	NA	S4TSR6	Salmonella_phage	49.2	5.2e-64
WP_001061370.1|1990681_1991251_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	99.5	9.3e-110
WP_000414876.1|1991275_1991518_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_000532847.1|1991519_1992509_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|1992800_1993598_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
1993591:1993605	attL	AACATTAATTCCTCA	NA	NA	NA	NA
WP_001675175.1|1993969_1994260_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	1.2e-07
WP_001680077.1|1994923_1996198_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	39.9	2.4e-73
1999917:1999931	attR	AACATTAATTCCTCA	NA	NA	NA	NA
>prophage 6
NZ_CP015524	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF10978 chromosome, complete genome	4679990	2110461	2119628	4679990		Enterobacteria_phage(42.86%)	9	NA	NA
WP_000565913.1|2110461_2111541_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000648783.1|2111545_2112319_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018223.1|2112334_2113309_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973709.1|2113314_2113866_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000857535.1|2113866_2114745_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_001023658.1|2114792_2115692_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000697846.1|2115691_2116777_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_000981469.1|2117153_2118047_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001144948.1|2118224_2119628_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
>prophage 7
NZ_CP015524	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF10978 chromosome, complete genome	4679990	2186826	2195997	4679990	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195340.1|2186826_2188860_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
WP_000703145.1|2189100_2189559_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_001197951.1|2189730_2190261_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950414.1|2190317_2190785_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_000598637.1|2190831_2191551_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2191547_2193233_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240420.1|2193455_2194187_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	86.9	2.5e-99
WP_001261696.1|2194246_2194354_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|2194334_2195066_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569168.1|2195049_2195997_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
>prophage 8
NZ_CP015524	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF10978 chromosome, complete genome	4679990	2432431	2438491	4679990		Salmonella_virus(50.0%)	6	NA	NA
WP_000377779.1|2432431_2433373_+	membrane protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
WP_001576268.1|2434615_2435005_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
WP_000703599.1|2434973_2435228_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_000400616.1|2435245_2437168_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.3	5.6e-300
WP_105789228.1|2438157_2438301_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
WP_108630384.1|2438239_2438491_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	68.6	7.6e-08
>prophage 1
NZ_CP015525	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF10978 plasmid pSJTUF10978, complete sequence	59372	36506	43414	59372	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_001541564.1|36506_36923_+	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
WP_001527010.1|37106_37442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176303.1|37498_38104_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000728919.1|38100_39042_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.7	4.7e-74
WP_000427676.1|39456_40662_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_077681951.1|40658_41636_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.5	6.7e-84
WP_000457542.1|41717_42992_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.9e-156
WP_000925628.1|42991_43414_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.4	2.0e-29
