The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015526	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF10984 chromosome, complete genome	4679791	868229	875542	4679791	protease,integrase	Dickeya_phage(16.67%)	7	856967:856981	875760:875774
856967:856981	attL	AGCCTGCGAGGAGAC	NA	NA	NA	NA
WP_001201751.1|868229_869348_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125875.1|869344_871291_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|871420_871642_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|871965_872286_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934064.1|872316_874593_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_001117984.1|874805_875003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001539594.1|875164_875542_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
875760:875774	attR	GTCTCCTCGCAGGCT	NA	NA	NA	NA
>prophage 2
NZ_CP015526	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF10984 chromosome, complete genome	4679791	925917	987435	4679791	protease,tail,tRNA	Salmonella_phage(23.53%)	54	NA	NA
WP_001154025.1|925917_926721_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|926713_928036_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|928016_928721_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572746.1|928720_933187_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925870.1|933531_935382_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|935641_936190_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|936217_936865_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|936926_938117_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977709.1|938301_939393_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
WP_000117867.1|939986_941387_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.8	4.5e-81
WP_000762342.1|941587_942049_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544855.1|942366_943581_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893200.1|943826_945263_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191404.1|945340_946543_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001676370.1|946737_947148_-	enterohemolysin	NA	H6WRX0	Salmonella_phage	100.0	5.0e-33
WP_000274547.1|947168_947798_+	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
WP_000729406.1|947781_948408_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_000583382.1|948404_950114_+|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
WP_000143167.1|950113_950695_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_072100753.1|950698_950947_-|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
WP_001674638.1|951172_952141_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000334547.1|952788_953415_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001525490.1|953774_954461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|954731_954923_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193790.1|955349_957962_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_000291723.1|958169_959180_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001574119.1|959345_959888_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224079.1|959884_960994_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|961092_963201_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|963213_965121_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333139.1|965135_966389_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|966393_968034_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|968030_968594_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|968849_969017_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|969116_969635_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156448.1|969703_971464_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|971649_972102_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|972173_973226_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288733.1|973582_974092_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|974308_974914_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950876.1|974900_977054_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|977072_977519_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|977642_979697_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|979732_980191_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|980285_980948_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000975204.1|981118_981535_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|981579_981897_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140478.1|981954_983166_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859416.1|983380_983929_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548080.1|983954_984734_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|984782_985064_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904449.1|985060_985390_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374046.1|985476_986136_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000938186.1|986754_987435_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	2.2e-81
>prophage 3
NZ_CP015526	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF10984 chromosome, complete genome	4679791	1159827	1175942	4679791	holin,lysis,tail,integrase	Salmonella_phage(30.77%)	16	1159663:1159692	1179284:1179313
1159663:1159692	attL	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
WP_000087636.1|1159827_1160907_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
WP_001575998.1|1160881_1161160_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_001237395.1|1161573_1163553_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_000972675.1|1164184_1164490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000940753.1|1164553_1165153_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000784710.1|1165149_1165377_+	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_001097218.1|1165506_1166196_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_001574213.1|1166292_1166817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798708.1|1167190_1167640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001574215.1|1168000_1168687_-	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_001574216.1|1168962_1169292_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|1169275_1169728_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|1169745_1170225_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000877926.1|1171119_1171653_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152416.1|1171742_1172438_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_072100756.1|1175078_1175942_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.9	9.0e-48
1179284:1179313	attR	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
>prophage 4
NZ_CP015526	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF10984 chromosome, complete genome	4679791	1400367	1416311	4679791	holin,tRNA	Escherichia_phage(62.5%)	21	NA	NA
WP_000123686.1|1400367_1401741_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
WP_001156217.1|1401784_1402720_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_001676915.1|1403036_1403654_-	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_000800272.1|1403681_1403999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560208.1|1404083_1404305_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000004762.1|1404742_1405264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085981757.1|1405371_1405527_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_001227859.1|1405911_1406379_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_001676916.1|1406651_1406981_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001033796.1|1407142_1407697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000556390.1|1407693_1408626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000882662.1|1408995_1409208_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000940751.1|1409731_1410331_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000774470.1|1410330_1410621_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000640113.1|1410617_1411154_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
WP_000900605.1|1413324_1413720_+	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	88.9	4.7e-44
WP_001688615.1|1413641_1413830_+	hypothetical protein	NA	Q8W636	Enterobacteria_phage	57.4	9.4e-11
WP_000445513.1|1413819_1414101_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.4	1.3e-16
WP_000802786.1|1414097_1414643_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	83.4	2.3e-89
WP_000159240.1|1415488_1415827_+	EamA family transporter	NA	NA	NA	NA	NA
WP_001082296.1|1415876_1416311_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
>prophage 5
NZ_CP015526	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF10984 chromosome, complete genome	4679791	1948498	1995994	4679791	holin,head,protease,plate,tail,integrase,portal,transposase,terminase,capsid	Salmonella_phage(77.78%)	60	1993387:1993401	1999713:1999727
WP_001028172.1|1948498_1949521_-|transposase	IS110-like element ISSaen1 family transposase	transposase	NA	NA	NA	NA
WP_001176778.1|1949982_1950801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526483.1|1952143_1952365_-	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_000492926.1|1952577_1953585_+	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_000760554.1|1953869_1954439_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	7.3e-107
WP_000554738.1|1954438_1956001_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	99.8	9.8e-287
WP_001207832.1|1955987_1956575_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_001699732.1|1956577_1957657_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.4	5.5e-204
WP_000605050.1|1957649_1958063_-	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_001273650.1|1958067_1958601_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	99.4	2.1e-95
WP_001066630.1|1958600_1959659_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
WP_000863817.1|1959655_1960996_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.1	1.1e-249
WP_000785387.1|1961029_1962958_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.5	0.0e+00
WP_000588852.1|1963042_1963369_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|1963365_1963722_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007993.1|1963721_1965218_-|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	99.2	3.0e-277
WP_000497739.1|1965207_1965372_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_000779215.1|1965375_1965936_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	99.5	3.0e-105
WP_001135695.1|1965932_1966445_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	93.5	1.4e-85
WP_000776844.1|1966416_1966821_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	96.3	1.5e-69
WP_000927251.1|1966817_1967141_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	72.0	2.6e-40
WP_000766103.1|1967220_1968450_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	90.9	1.8e-206
WP_000003793.1|1968459_1969062_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	91.5	2.0e-99
WP_077905357.1|1969054_1970149_-|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	82.7	7.3e-180
WP_000257219.1|1970420_1972151_-|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	58.9	3.2e-198
WP_000501481.1|1972150_1972588_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	63.7	1.6e-32
WP_001135228.1|1972734_1973085_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	3.1e-63
WP_000127618.1|1973108_1973648_-	DUF2514 domain-containing protein	NA	A0A0A0P0G7	Enterobacteria_phage	37.2	5.3e-06
WP_001075993.1|1973644_1974262_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	78.9	3.2e-92
WP_000226304.1|1974261_1974543_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.3e-36
WP_001294874.1|1974529_1974919_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	71.0	1.8e-40
WP_000765639.1|1975007_1975580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000357930.1|1975592_1976666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047141.1|1976715_1977468_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.0	1.9e-134
WP_012543375.1|1977481_1978471_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	1.9e-190
WP_001061459.1|1978478_1979339_-	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	98.3	1.5e-159
WP_000779149.1|1979355_1979745_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	99.2	1.9e-69
WP_000200166.1|1979753_1980635_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	96.2	8.3e-166
WP_000054227.1|1980631_1981105_-	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	94.6	3.9e-53
WP_000096529.1|1981101_1982076_-	hypothetical protein	NA	A0A1C9IHW0	Salmonella_phage	97.8	1.2e-165
WP_000620702.1|1982072_1982297_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087406.1|1982293_1983451_-	peptidase	NA	Q8HA97	Salmonella_phage	98.4	2.8e-214
WP_000509728.1|1983447_1984002_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	98.9	3.4e-101
WP_001191666.1|1984030_1984255_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020644.1|1984352_1985048_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	2.7e-127
WP_001067433.1|1985253_1985439_+	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	73.3	1.2e-13
WP_000078504.1|1985514_1985766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000551790.1|1986335_1987253_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	59.7	1.3e-97
WP_000008351.1|1987347_1987887_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000764235.1|1987957_1988188_+	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000071068.1|1988184_1988700_+	DUF262 domain-containing protein	NA	A0A2H4FWH2	Salmonella_phage	96.5	1.3e-94
WP_000065085.1|1988696_1989056_+	Eaf protein	NA	T1SA95	Salmonella_phage	89.9	1.0e-58
WP_000267991.1|1989327_1989621_+	hypothetical protein	NA	A0A1V0E5L2	Salmonella_phage	100.0	1.5e-50
WP_000208076.1|1989617_1990481_+	DUF551 domain-containing protein	NA	S4TSR6	Salmonella_phage	49.2	5.2e-64
WP_001061370.1|1990477_1991047_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	99.5	9.3e-110
WP_000414876.1|1991071_1991314_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_000532847.1|1991315_1992305_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|1992596_1993394_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
1993387:1993401	attL	AACATTAATTCCTCA	NA	NA	NA	NA
WP_001675175.1|1993765_1994056_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	1.2e-07
WP_001680077.1|1994719_1995994_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	39.9	2.4e-73
1999713:1999727	attR	AACATTAATTCCTCA	NA	NA	NA	NA
>prophage 6
NZ_CP015526	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF10984 chromosome, complete genome	4679791	2110257	2119424	4679791		Enterobacteria_phage(42.86%)	9	NA	NA
WP_000565913.1|2110257_2111337_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000648783.1|2111341_2112115_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018223.1|2112130_2113105_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973709.1|2113110_2113662_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000857535.1|2113662_2114541_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_001023658.1|2114588_2115488_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000697846.1|2115487_2116573_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_000981469.1|2116949_2117843_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001144948.1|2118020_2119424_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
>prophage 7
NZ_CP015526	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF10984 chromosome, complete genome	4679791	2186622	2195793	4679791	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195340.1|2186622_2188656_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
WP_000703145.1|2188896_2189355_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_001197951.1|2189526_2190057_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950414.1|2190113_2190581_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_000598637.1|2190627_2191347_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2191343_2193029_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240420.1|2193251_2193983_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	86.9	2.5e-99
WP_001261696.1|2194042_2194150_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|2194130_2194862_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569168.1|2194845_2195793_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
>prophage 8
NZ_CP015526	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF10984 chromosome, complete genome	4679791	2432226	2438279	4679791		Salmonella_virus(50.0%)	6	NA	NA
WP_000377779.1|2432226_2433168_+	membrane protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
WP_001576268.1|2434410_2434800_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
WP_000703599.1|2434768_2435023_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_000400616.1|2435040_2436963_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.3	5.6e-300
WP_105789228.1|2437952_2438096_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
WP_105789229.1|2438111_2438279_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	63.5	1.3e-11
>prophage 1
NZ_CP015527	Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF10984 plasmid pSJTUF10984, complete sequence	59371	36506	43414	59371	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_001541564.1|36506_36923_+	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
WP_001527010.1|37106_37442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176303.1|37498_38104_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000728919.1|38100_39042_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.7	4.7e-74
WP_000427676.1|39456_40662_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_077681951.1|40658_41636_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.5	6.7e-84
WP_000457542.1|41717_42992_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.9e-156
WP_000925628.1|42991_43414_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.4	2.0e-29
