The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021913	Sagittula sp. P11 chromosome, complete genome	4624102	185708	194731	4624102		uncultured_Mediterranean_phage(66.67%)	10	NA	NA
WP_100927014.1|185708_186494_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	28.7	1.4e-20
WP_100927015.1|186490_187132_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	43.5	2.1e-25
WP_100927016.1|187218_188406_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_100927017.1|188590_189430_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_100927018.1|189422_190373_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.0	6.7e-28
WP_100927019.1|190369_190837_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_100927020.1|190843_191095_-	Sec-independent protein translocase TatA	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	49.1	7.9e-05
WP_100927021.1|191337_191997_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_100927022.1|192244_193135_-	fructose bisphosphate aldolase	NA	A0A0K0KVJ8	Prochlorococcus_phage	28.0	1.1e-05
WP_100927023.1|193369_194731_-	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	26.5	9.2e-23
>prophage 2
NZ_CP021913	Sagittula sp. P11 chromosome, complete genome	4624102	202327	227847	4624102	head,tail,protease,capsid,tRNA	Paracoccus_phage(40.0%)	29	NA	NA
WP_100927027.1|202327_203581_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1S6UA79	Serratia_phage	35.1	1.6e-58
WP_100927029.1|204353_205184_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_100927030.1|205193_206168_-	DUF3179 domain-containing protein	NA	NA	NA	NA	NA
WP_100927031.1|206298_206862_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	57.2	4.3e-43
WP_100930789.1|206851_207361_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	56.2	3.7e-41
WP_100927032.1|207496_208711_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_100927033.1|208716_209754_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_100927034.1|209933_210236_+	septum formation initiator precursor	NA	NA	NA	NA	NA
WP_100927035.1|210247_210640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100927036.1|210873_211896_+	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_100927037.1|211892_212483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100927038.1|212490_213867_+	pyruvate dehydrogenase complex E1 component subunit beta	NA	NA	NA	NA	NA
WP_100927039.1|213877_214120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100927040.1|214123_215425_+	pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase	NA	NA	NA	NA	NA
WP_100927041.1|215503_216322_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_100930790.1|216388_216745_+	molecular chaperone DnaK	NA	NA	NA	NA	NA
WP_100927042.1|217025_220991_-	host specificity protein	NA	A0A0B5A7K5	Paracoccus_phage	39.5	1.6e-224
WP_100927043.1|220994_221438_-	peptidase	NA	F4YXU4	Roseobacter_phage	49.6	6.7e-31
WP_100927044.1|221434_222319_-	DUF2163 domain-containing protein	NA	A0A0B5A5B8	Paracoccus_phage	41.6	2.7e-55
WP_100927045.1|222318_222951_-	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	50.2	1.4e-58
WP_100927046.1|222963_223626_-|tail	phage tail tape measure protein	tail	D6PFD6	uncultured_phage	29.7	3.2e-13
WP_100927047.1|223622_223817_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_100927048.1|223803_224136_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_100927049.1|224135_224558_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_100927050.1|224583_224991_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_100927051.1|224987_225353_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_100927052.1|225349_225943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100927053.1|226092_227205_-|capsid	phage major capsid protein	capsid	A0A2D1GNH4	Pseudomonas_phage	39.7	8.2e-62
WP_100927054.1|227301_227847_-|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	52.3	1.5e-32
>prophage 3
NZ_CP021913	Sagittula sp. P11 chromosome, complete genome	4624102	2597453	2613775	4624102	terminase,portal	Emiliania_huxleyi_virus(25.0%)	21	NA	NA
WP_100929080.1|2597453_2598395_-	hypothetical protein	NA	G8DH51	Emiliania_huxleyi_virus	56.4	1.6e-98
WP_100929081.1|2598419_2598839_-	acyl-CoA transferase	NA	G8DH50	Emiliania_huxleyi_virus	56.4	2.2e-36
WP_157814983.1|2598967_2599291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100929083.1|2599295_2599868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100929084.1|2599938_2600568_-	hypothetical protein	NA	G8DH49	Emiliania_huxleyi_virus	54.1	6.7e-53
WP_100929085.1|2600564_2600876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100929086.1|2600875_2601211_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_100929087.1|2601294_2603349_-	peptidase U37	NA	A0A2I7S8L6	Vibrio_phage	33.7	4.7e-87
WP_100929088.1|2603354_2604899_-|portal	phage portal protein	portal	Q75QM9	Wolbachia_phage	39.1	3.1e-83
WP_100929089.1|2604898_2605108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100929090.1|2605107_2607111_-|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	60.6	2.8e-217
WP_100929091.1|2607058_2607655_-	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	42.5	3.9e-26
WP_066813809.1|2607766_2608039_+	hypothetical protein	NA	A0A0K0PVN5	Roseobacter_phage	53.5	6.5e-13
WP_100929092.1|2608134_2608707_+	DUF3489 domain-containing protein	NA	NA	NA	NA	NA
WP_100929093.1|2608973_2609462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100929094.1|2609515_2609731_-	hypothetical protein	NA	K4I1E3	Acidithiobacillus_phage	69.0	1.1e-18
WP_100929095.1|2609740_2610922_-	DNA cytosine methyltransferase	NA	A0A0F7L3T9	uncultured_marine_virus	48.1	8.3e-36
WP_100929096.1|2610923_2612300_-	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	38.6	1.4e-74
WP_100929097.1|2612716_2613097_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
WP_100929098.1|2613089_2613290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100930949.1|2613286_2613775_-	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	61.8	1.9e-50
>prophage 4
NZ_CP021913	Sagittula sp. P11 chromosome, complete genome	4624102	2927248	2957602	4624102	integrase,transposase	Thiobacimonas_phage(62.07%)	42	2946655:2946671	2961808:2961824
WP_100929360.1|2927248_2930527_-	hypothetical protein	NA	A0A1B0T6D1	Thiobacimonas_phage	35.6	9.6e-151
WP_157814994.1|2930523_2930925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157814995.1|2930921_2931461_-	hypothetical protein	NA	G8GWF8	Rhodobacter_phage	43.2	3.1e-30
WP_100929361.1|2931457_2931883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100929362.1|2931879_2934444_-	hypothetical protein	NA	A0A1B0T6D4	Thiobacimonas_phage	26.6	6.4e-25
WP_157814996.1|2934449_2934710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100929364.1|2934799_2935108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100929365.1|2935130_2936066_-	hypothetical protein	NA	A0A1B0T6E1	Thiobacimonas_phage	51.8	4.5e-85
WP_100929366.1|2936206_2936638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100929367.1|2936637_2937066_-	DUF1320 domain-containing protein	NA	A0A1B0T6F3	Thiobacimonas_phage	54.2	1.5e-35
WP_100929368.1|2937176_2937665_-	hypothetical protein	NA	A0A1B0T6E5	Thiobacimonas_phage	27.7	4.8e-06
WP_100929369.1|2937661_2938555_-	hypothetical protein	NA	M4SRT6	Rhodobacter_phage	71.0	1.8e-123
WP_100929370.1|2938568_2939000_-	hypothetical protein	NA	A0A1B0T6E4	Thiobacimonas_phage	71.3	4.9e-47
WP_100929371.1|2939003_2940014_-	hypothetical protein	NA	A0A1B0T6E7	Thiobacimonas_phage	34.8	2.6e-46
WP_100929372.1|2940069_2940582_-	phage virion morphogenesis protein	NA	A0A1B0T6E8	Thiobacimonas_phage	60.1	2.9e-54
WP_100929373.1|2940587_2941376_-	hypothetical protein	NA	A0A1B0T6H8	Thiobacimonas_phage	60.3	6.0e-91
WP_100929374.1|2941473_2943090_-	DUF935 domain-containing protein	NA	A0A1B0T6F2	Thiobacimonas_phage	61.3	5.4e-179
WP_100929375.1|2943100_2943913_-	DNA adenine methylase	NA	A0A291AUP9	Sinorhizobium_phage	55.4	1.4e-74
WP_100929376.1|2945681_2945951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157814997.1|2946123_2946276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100929377.1|2946275_2946590_-	hypothetical protein	NA	A0A1B1P715	Rhodovulum_phage	52.9	7.3e-24
WP_100929378.1|2946586_2946793_-	hypothetical protein	NA	A0A1B0T6L2	Pelagibaca_phage	53.8	8.4e-13
2946655:2946671	attL	CGAGGACGTCGCCGAGC	NA	NA	NA	NA
WP_100929379.1|2946789_2947356_-	DUF3486 family protein	NA	A0A1B0T6G0	Thiobacimonas_phage	65.9	1.4e-49
WP_100929380.1|2947357_2947657_-	hypothetical protein	NA	A0A1B0T6F4	Thiobacimonas_phage	75.3	5.1e-35
WP_100929381.1|2947661_2948069_-	DUF2730 family protein	NA	A0A1B1P705	Rhodovulum_phage	34.1	2.6e-13
WP_157814998.1|2948079_2948604_-	carboxylesterase	NA	NA	NA	NA	NA
WP_100929383.1|2948600_2949215_-	N-acetylmuramidase	NA	G8DH66	Emiliania_huxleyi_virus	51.2	5.2e-50
WP_100929384.1|2949285_2949690_-	hypothetical protein	NA	A0A1B0T6G2	Thiobacimonas_phage	48.0	2.2e-20
WP_100929385.1|2949686_2949926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100929386.1|2949922_2950372_-	regulatory protein GemA	NA	A0A1B1P720	Rhodovulum_phage	58.1	2.6e-35
WP_100929387.1|2950443_2950737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100929388.1|2950739_2951417_-	DUF3164 family protein	NA	M4STB6	Rhodobacter_phage	57.8	2.7e-63
WP_100929389.1|2951413_2951647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100929390.1|2951643_2952015_-	hypothetical protein	NA	A0A1B0T6G8	Thiobacimonas_phage	55.0	1.7e-32
WP_100929391.1|2952011_2952593_-	hypothetical protein	NA	A0A1B0T6J7	Thiobacimonas_phage	44.9	1.1e-28
WP_100929392.1|2952589_2953366_-	ATP-binding protein	NA	A0A1B0T6H3	Thiobacimonas_phage	56.5	5.4e-76
WP_100929393.1|2953376_2955506_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1B0T6H2	Thiobacimonas_phage	58.2	1.0e-230
WP_100929394.1|2955502_2956369_-	ParB N-terminal domain-containing protein	NA	A0A1B0T6H9	Thiobacimonas_phage	49.7	8.7e-67
WP_100929395.1|2956361_2956598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100929396.1|2956594_2956876_-	hypothetical protein	NA	A0A1B1P701	Rhodovulum_phage	42.4	1.8e-05
WP_100929397.1|2956868_2957102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100929398.1|2957098_2957602_-	hypothetical protein	NA	A0A1B0T6N4	Pelagibaca_phage	38.2	2.7e-12
2961808:2961824	attR	CGAGGACGTCGCCGAGC	NA	NA	NA	NA
>prophage 1
NZ_CP021915	Sagittula sp. P11 plasmid unnamed2, complete sequence	273585	0	54732	273585	transposase,integrase	Stx2-converting_phage(25.0%)	49	42112:42144	45912:45944
WP_100927449.1|337_754_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_149792016.1|742_1528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100931375.1|1544_3110_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	35.9	6.8e-86
WP_100931376.1|3178_3532_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_100931377.1|3528_3966_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027264261.1|4153_5551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100931378.1|6701_7856_+	Fic family protein	NA	NA	NA	NA	NA
WP_100931379.1|8165_9830_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_027264257.1|9826_11251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157815106.1|11276_12536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027264264.1|12733_13327_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	29.9	1.2e-14
WP_100927451.1|13323_14949_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	43.2	1.5e-96
WP_100927450.1|15009_15360_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	53.3	2.7e-27
WP_100927449.1|15356_15773_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157815107.1|15855_17226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100931383.1|17551_18654_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.4	1.8e-45
WP_100931384.1|18924_19746_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_100931385.1|19742_20060_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_100931386.1|20444_21596_+	HPP family protein	NA	NA	NA	NA	NA
WP_100931387.1|21611_22499_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_100931388.1|22495_23323_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0P0BXC9	Ostreococcus_lucimarinus_virus	38.5	1.1e-39
WP_100931389.1|23447_24296_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_100931390.1|24292_25864_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_100931391.1|25868_26921_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_100931392.1|27580_27898_-	Dabb family protein	NA	NA	NA	NA	NA
WP_100931393.1|29229_30579_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_100931394.1|30575_32363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100931395.1|32359_34576_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_100931396.1|34627_35530_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	37.5	2.2e-44
WP_100931397.1|35526_35802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100931398.1|35875_36265_+	DUF3768 domain-containing protein	NA	NA	NA	NA	NA
WP_100931399.1|36412_38389_+	ParB/RepB/Spo0J family partition protein	NA	A0A0F7L836	uncultured_marine_virus	33.3	1.1e-05
WP_100931400.1|38459_39053_+	regulator	NA	NA	NA	NA	NA
WP_100931401.1|39152_39809_+	hypothetical protein	NA	NA	NA	NA	NA
42112:42144	attL	GTCCGTAATCGCGAGGACGCGATAATGCGAAGG	NA	NA	NA	NA
WP_088626524.1|42216_43221_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_100931402.1|43220_44573_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_088626526.1|44569_45799_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	22.0	1.6e-10
WP_071974368.1|48162_48549_+	hypothetical protein	NA	NA	NA	NA	NA
45912:45944	attR	CCTTCGCATTATCGCGTCCTCGCGATTACGGAC	NA	NA	NA	NA
WP_071974367.1|48550_48988_+	hypothetical protein	NA	A0A1B1IUL8	uncultured_Mediterranean_phage	57.0	1.5e-27
WP_071974366.1|48990_49269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071974438.1|49350_49629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071974365.1|49745_50474_+	DUF736 family protein	NA	NA	NA	NA	NA
WP_027264463.1|50691_50922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027264462.1|50945_51329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036051621.1|51312_52065_+	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	28.3	4.2e-09
WP_071974364.1|52061_52568_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_027264460.1|52564_52900_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_027264459.1|52899_53175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027264458.1|53802_54732_+	DUF2493 domain-containing protein	NA	A0A291L9X7	Bordetella_phage	33.9	4.8e-07
>prophage 2
NZ_CP021915	Sagittula sp. P11 plasmid unnamed2, complete sequence	273585	69683	70838	273585		Bacillus_phage(100.0%)	1	NA	NA
WP_027264444.1|69683_70838_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	56.8	5.2e-27
>prophage 3
NZ_CP021915	Sagittula sp. P11 plasmid unnamed2, complete sequence	273585	73934	74555	273585		Bacillus_phage(100.0%)	1	NA	NA
WP_088652953.1|73934_74555_-	lytic transglycosylase domain-containing protein	NA	A0A0S2SXL7	Bacillus_phage	55.3	1.3e-19
>prophage 4
NZ_CP021915	Sagittula sp. P11 plasmid unnamed2, complete sequence	273585	82888	89969	273585		Pike_perch_iridovirus(66.67%)	6	NA	NA
WP_088652138.1|82888_84487_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	43.1	6.2e-10
WP_028093929.1|84491_85121_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088652139.1|85301_86132_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.0	3.3e-15
WP_100931403.1|86156_87341_-	lipid-transfer protein	NA	NA	NA	NA	NA
WP_088652141.1|87635_88247_+	transferase hexapeptide repeat family protein	NA	NA	NA	NA	NA
WP_088652142.1|88361_89969_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	58.7	3.5e-13
>prophage 5
NZ_CP021915	Sagittula sp. P11 plasmid unnamed2, complete sequence	273585	97133	97988	273585		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_088652148.1|97133_97988_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	24.9	3.4e-07
>prophage 6
NZ_CP021915	Sagittula sp. P11 plasmid unnamed2, complete sequence	273585	101150	103962	273585		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_088652151.1|101150_101912_+	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.1	8.5e-18
WP_100931406.1|102024_103962_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	30.3	1.6e-49
>prophage 7
NZ_CP021915	Sagittula sp. P11 plasmid unnamed2, complete sequence	273585	109017	110538	273585		Staphylococcus_phage(100.0%)	1	NA	NA
WP_088652157.1|109017_110538_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	26.1	3.5e-31
>prophage 8
NZ_CP021915	Sagittula sp. P11 plasmid unnamed2, complete sequence	273585	117235	121824	273585		Pike_perch_iridovirus(50.0%)	3	NA	NA
WP_088652161.1|117235_118843_+	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	48.6	3.5e-13
WP_100931408.1|118853_120860_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_027264398.1|120864_121824_+	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	31.1	1.1e-22
>prophage 9
NZ_CP021915	Sagittula sp. P11 plasmid unnamed2, complete sequence	273585	125775	128557	273585		Bacillus_virus(50.0%)	2	NA	NA
WP_028288584.1|125775_126555_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	21.6	2.1e-11
WP_027264392.1|126580_128557_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	18.5	4.9e-25
>prophage 10
NZ_CP021915	Sagittula sp. P11 plasmid unnamed2, complete sequence	273585	131847	132639	273585		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_027264388.1|131847_132639_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.1	3.1e-10
>prophage 11
NZ_CP021915	Sagittula sp. P11 plasmid unnamed2, complete sequence	273585	154189	157629	273585		Tupanvirus(50.0%)	3	NA	NA
WP_027264370.1|154189_155704_-	AMP-binding protein	NA	A0A2K9L3I8	Tupanvirus	25.5	8.2e-12
WP_048534161.1|155714_156887_-	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_027264368.1|156879_157629_-	glucose 1-dehydrogenase	NA	W8CYX9	Bacillus_phage	42.1	9.3e-09
>prophage 12
NZ_CP021915	Sagittula sp. P11 plasmid unnamed2, complete sequence	273585	161278	163243	273585	transposase	Leptospira_phage(50.0%)	2	NA	NA
WP_027264363.1|161278_161632_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	35.3	1.0e-10
WP_027264362.1|161686_163243_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	40.3	1.3e-97
>prophage 13
NZ_CP021915	Sagittula sp. P11 plasmid unnamed2, complete sequence	273585	223639	233727	273585	transposase	Anomala_cuprea_entomopoxvirus(16.67%)	8	NA	NA
WP_100931425.1|223639_224449_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.7	2.0e-12
WP_100931415.1|224459_225533_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_100931416.1|225536_226424_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_100931417.1|226424_228344_-	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	21.5	2.4e-37
WP_027264301.1|228336_229143_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.9	7.2e-15
WP_100931418.1|229180_230035_-	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	26.9	1.3e-19
WP_027264277.1|230983_232249_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	49.7	5.4e-102
WP_100165069.1|232567_233727_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.1	2.3e-46
>prophage 14
NZ_CP021915	Sagittula sp. P11 plasmid unnamed2, complete sequence	273585	244404	244863	273585		Acinetobacter_phage(100.0%)	1	NA	NA
WP_027264289.1|244404_244863_+	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	31.3	2.0e-09
>prophage 15
NZ_CP021915	Sagittula sp. P11 plasmid unnamed2, complete sequence	273585	254924	264967	273585	transposase	Ochrobactrum_phage(50.0%)	8	NA	NA
WP_027264280.1|254924_257657_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	3.5e-21
WP_027264279.1|257653_258721_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_081710581.1|258874_259330_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_154665592.1|259519_259672_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_027264277.1|259779_261045_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	49.7	5.4e-102
WP_027264276.1|261217_261463_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_027264275.1|262799_263999_+	plasmid partitioning protein RepA	NA	A0A240F4U1	Ochrobactrum_phage	48.4	1.3e-89
WP_027264274.1|263983_264967_+	plasmid partitioning protein RepB	NA	A0A240F4U0	Ochrobactrum_phage	30.0	1.9e-25
>prophage 1
NZ_CP021916	Sagittula sp. P11 plasmid unnamed3, complete sequence	133288	68801	97797	133288	transposase,integrase	Caulobacter_phage(14.29%)	25	82516:82545	86313:86342
WP_100931393.1|68801_70151_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_100931394.1|70147_71935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100931395.1|71931_74148_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_100931396.1|74199_75102_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	37.5	2.2e-44
WP_100931452.1|75098_75374_+	hypothetical protein	NA	K4JTS1	Caulobacter_virus	49.1	6.6e-05
WP_088726107.1|75397_75607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088726108.1|75694_76084_+	DUF3768 domain-containing protein	NA	NA	NA	NA	NA
WP_100931453.1|76240_78223_+	ParB N-terminal domain-containing protein	NA	A0A0F7L836	uncultured_marine_virus	32.9	6.7e-06
WP_100931454.1|78297_78891_+	regulator	NA	NA	NA	NA	NA
WP_100931455.1|78890_79547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100931456.1|79651_79951_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_093994038.1|79937_80213_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
82516:82545	attL	CGTAATCGCGAGGACGCGATAATGCGAAGG	NA	NA	NA	NA
WP_088626526.1|82657_83887_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	22.0	1.6e-10
WP_100931402.1|83883_85236_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_088626524.1|85235_86240_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_100931480.1|86286_88437_+	hypothetical protein	NA	NA	NA	NA	NA
86313:86342	attR	CCTTCGCATTATCGCGTCCTCGCGATTACG	NA	NA	NA	NA
WP_100931457.1|88558_88945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100931458.1|88946_89408_+	hypothetical protein	NA	A0A1B1IUL8	uncultured_Mediterranean_phage	59.6	3.0e-34
WP_100931459.1|89508_89829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100931460.1|89936_90665_+	DUF736 family protein	NA	NA	NA	NA	NA
WP_100931461.1|90831_93297_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_100931462.1|93202_94285_-	AAA family ATPase	NA	A0A2K9R7H3	Dishui_lake_phycodnavirus	28.8	1.1e-18
WP_100931463.1|94972_95902_+	DUF2493 domain-containing protein	NA	A0A291L9X7	Bordetella_phage	33.9	8.3e-07
WP_007120662.1|96436_96643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100931464.1|97203_97797_+|transposase	transposase	transposase	NA	NA	NA	NA
