The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025140	Klebsiella pneumoniae strain KP1768 chromosome, complete genome	5388466	114930	139689	5388466	transposase,integrase,tRNA	Escherichia_phage(23.08%)	19	130829:130846	142338:142355
WP_032434432.1|114930_115620_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_004150214.1|115624_117745_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|117763_118039_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_002922664.1|118093_118717_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.0	1.7e-19
WP_032434430.1|118975_120652_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	24.0	1.3e-23
WP_002922654.1|120657_121275_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_032434427.1|121550_122801_+	chloride channel protein	NA	NA	NA	NA	NA
WP_032434425.1|122856_123915_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	33.5	1.4e-18
WP_000608644.1|124434_125697_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000239590.1|125952_126828_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|126874_127207_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_001067855.1|130085_130790_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
130829:130846	attL	TTTGCAACAGTGCCTCTC	NA	NA	NA	NA
WP_001288432.1|131108_132542_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_101134884.1|132783_133991_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.5	4.1e-99
WP_001389365.1|135402_136167_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001144737.1|136309_136576_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_004201280.1|136796_137270_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	A0A140HLG8	Bacillus_phage	33.8	5.3e-18
WP_000845048.1|137425_138439_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067855.1|138984_139689_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
142338:142355	attR	GAGAGGCACTGTTGCAAA	NA	NA	NA	NA
>prophage 2
NZ_CP025140	Klebsiella pneumoniae strain KP1768 chromosome, complete genome	5388466	494264	527701	5388466	tail,protease,portal,head,integrase,capsid,terminase,tRNA	uncultured_Caudovirales_phage(73.33%)	33	512051:512068	528046:528063
WP_004150007.1|494264_495212_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_004150006.1|495226_495736_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	39.5	4.4e-18
WP_032434585.1|495864_496989_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|496960_497434_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|497460_498003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|498007_498580_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|498583_499402_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|499398_499656_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|499631_500186_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|506160_506382_-	membrane protein	NA	NA	NA	NA	NA
WP_004144975.1|506674_509785_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_004144974.1|509797_510937_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016947472.1|511315_511969_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
512051:512068	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|512241_513468_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|513560_514502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|514683_514968_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|514978_515758_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_106918304.1|516209_516479_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|516471_516660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|516652_516967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|516963_517332_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|517328_517694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|517693_519829_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|520171_520507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|520555_521068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|521331_522498_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|522549_523110_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|523111_524353_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|524349_524685_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|524681_524981_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|524980_525424_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_000113647.1|525699_526056_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|526039_527701_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
528046:528063	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 3
NZ_CP025140	Klebsiella pneumoniae strain KP1768 chromosome, complete genome	5388466	1284467	1338529	5388466	tail,coat,integrase,transposase,holin,terminase	Salmonella_phage(18.52%)	64	1284357:1284371	1293670:1293684
1284357:1284371	attL	TACAGTCAACCTAAG	NA	NA	NA	NA
WP_023301229.1|1284467_1285697_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	96.3	1.3e-238
WP_023301228.1|1285674_1285950_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	72.7	9.2e-31
WP_071557557.1|1285988_1286228_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	71.8	3.2e-24
WP_101134779.1|1286235_1286544_-	hypothetical protein	NA	I6PD68	Cronobacter_phage	55.9	9.3e-24
WP_101134887.1|1286540_1287251_-	hypothetical protein	NA	Q71T76	Escherichia_phage	62.8	6.0e-74
WP_101134780.1|1287294_1288383_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	56.2	1.4e-106
WP_101134781.1|1288396_1291498_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	58.2	1.2e-296
WP_016946289.1|1291635_1291791_-	DNA breaking-rejoining protein	NA	H6WRX3	Salmonella_phage	74.5	2.6e-14
WP_004179600.1|1291799_1291991_-	YebW family protein	NA	NA	NA	NA	NA
WP_101134782.1|1292475_1292679_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	73.1	1.8e-20
WP_032438209.1|1292707_1293118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101134783.1|1293244_1293628_-	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	83.5	2.0e-52
WP_023282398.1|1293726_1293945_+	hypothetical protein	NA	K7PKS2	Enterobacteria_phage	64.8	8.9e-21
1293670:1293684	attR	CTTAGGTTGACTGTA	NA	NA	NA	NA
WP_101134784.1|1293947_1294484_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	70.9	7.2e-64
WP_071785976.1|1294571_1294760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064179420.1|1294774_1295683_+	hypothetical protein	NA	V5URT9	Shigella_phage	54.1	1.7e-89
WP_023286279.1|1295685_1296435_+	ATP-binding protein	NA	H6WRX8	Salmonella_phage	83.1	2.2e-119
WP_023286280.1|1296442_1296778_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	5.8e-11
WP_101134785.1|1296770_1297556_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	1.6e-64
WP_101134786.1|1297683_1298247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101134787.1|1298243_1298888_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	78.9	1.8e-109
WP_101134788.1|1298884_1299316_+	ead/Ea22-like family protein	NA	A0A077SLK5	Escherichia_phage	47.2	2.2e-10
WP_101134789.1|1299488_1300385_+	DUF551 domain-containing protein	NA	R9TQX3	Aeromonas_phage	91.4	2.2e-28
WP_040241897.1|1300663_1300891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184503.1|1301266_1301500_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	68.8	2.9e-25
WP_071557491.1|1301604_1301853_+	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	67.9	5.0e-28
WP_101134790.1|1301887_1302484_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	80.1	1.3e-90
WP_004892208.1|1302692_1302989_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	72.9	1.2e-36
WP_023282412.1|1302985_1303342_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	64.1	1.5e-41
WP_023287514.1|1303457_1304279_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	67.5	1.1e-98
WP_024940884.1|1304534_1304834_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_064179041.1|1304830_1305370_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	5.7e-101
WP_023313049.1|1305366_1305714_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	81.7	1.2e-40
WP_101134792.1|1305710_1305986_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	42.7	5.2e-10
WP_072071795.1|1306124_1306541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073545918.1|1306865_1307102_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	62.8	3.8e-17
WP_101134793.1|1307352_1308357_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	43.3	2.3e-34
WP_064179047.1|1308334_1309639_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	60.0	1.7e-146
WP_064179048.1|1309643_1311068_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	70.9	2.9e-192
WP_101134794.1|1311051_1312164_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	53.6	5.3e-109
WP_101134795.1|1312267_1313032_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	61.8	8.7e-79
WP_048997557.1|1313119_1314256_+|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	74.6	1.3e-155
WP_101134796.1|1314305_1314590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048271645.1|1314593_1315004_+	hypothetical protein	NA	A0A0H5AUF0	Pseudomonas_phage	38.2	6.6e-09
WP_065520084.1|1315005_1315389_+	glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	44.4	6.0e-20
WP_008807839.1|1315390_1315942_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	7.8e-29
WP_004146196.1|1315938_1316331_+	hypothetical protein	NA	M4SMU9	Cyanophage	30.9	7.3e-05
WP_101134797.1|1316354_1317527_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	26.6	2.1e-23
WP_043906941.1|1317581_1318064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157829711.1|1318201_1318399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043906942.1|1318575_1319106_+	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	68.4	6.1e-63
WP_050486020.1|1319187_1319685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029602982.1|1319730_1320093_+	membrane protein	NA	S4TR42	Salmonella_phage	72.4	2.3e-05
WP_101134798.1|1320188_1323758_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	31.4	1.1e-83
WP_023313121.1|1323757_1324231_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	68.6	8.6e-61
WP_101134799.1|1324217_1324700_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	97.5	1.3e-83
WP_017880229.1|1324709_1325090_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	100.0	4.6e-73
WP_101134800.1|1325086_1328155_+	kinase	NA	A0A286S259	Klebsiella_phage	97.6	0.0e+00
WP_101134801.1|1330891_1331872_+|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	97.9	1.4e-182
WP_101134803.1|1332040_1333135_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	88.7	3.0e-181
WP_101134804.1|1334412_1335897_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	4.5e-31
WP_101134805.1|1335974_1336214_+	DNA polymerase V	NA	I6PD82	Cronobacter_phage	55.7	3.4e-21
WP_101134806.1|1336216_1336537_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	53.3	7.2e-27
WP_048997522.1|1336729_1338529_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.4	7.2e-23
>prophage 4
NZ_CP025140	Klebsiella pneumoniae strain KP1768 chromosome, complete genome	5388466	1524417	1621912	5388466	tail,protease,portal,head,integrase,capsid,plate,holin,terminase,tRNA	Escherichia_phage(20.83%)	95	1559626:1559650	1599159:1599183
WP_101134808.1|1524417_1525767_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_025368033.1|1525763_1526453_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_032434868.1|1526452_1528129_+	OmpA family protein	NA	NA	NA	NA	NA
WP_025368035.1|1528131_1528623_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_107318634.1|1528853_1529018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032434870.1|1529043_1531401_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_071994657.1|1531410_1531953_+	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
WP_032425140.1|1532026_1532497_+	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
WP_077254137.1|1532839_1535242_+	glycoside hydrolase family 104 protein	NA	NA	NA	NA	NA
WP_032434872.1|1535238_1535682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071886200.1|1535842_1536223_+	DUF4087 domain-containing protein	NA	NA	NA	NA	NA
WP_123618670.1|1536694_1537123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025368039.1|1537339_1537639_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_032435675.1|1537701_1537965_+	PAAR domain-containing protein	NA	R9U4D0	Rhizobium_phage	50.0	1.2e-06
WP_032425487.1|1537967_1539176_+	membrane protein	NA	NA	NA	NA	NA
WP_032434874.1|1539168_1542540_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_153582916.1|1542542_1542692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032434876.1|1543032_1544640_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_025368043.1|1544673_1546443_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_032425136.1|1546406_1547489_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_032425135.1|1547524_1548049_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_101134809.1|1548053_1550375_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.0	2.7e-14
WP_050484908.1|1550371_1550875_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	40.0	1.5e-18
WP_023317120.1|1550868_1551213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086472102.1|1551245_1551983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049107563.1|1552225_1552708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032434878.1|1554591_1555476_+	glycine zipper family protein	NA	NA	NA	NA	NA
WP_050598595.1|1555465_1556023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071838925.1|1556530_1556929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123618669.1|1557717_1558167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050598596.1|1558163_1558697_+	hypothetical protein	NA	NA	NA	NA	NA
1559626:1559650	attL	TTATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
WP_032434882.1|1559844_1561014_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	86.1	1.9e-202
WP_123618668.1|1561118_1561961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077254126.1|1562062_1562263_-	hypothetical protein	NA	G3CFG7	Escherichia_phage	60.0	1.8e-12
WP_004864289.1|1563070_1563586_-	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	76.4	2.9e-70
WP_021314787.1|1563961_1565038_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	74.4	2.8e-147
WP_032434886.1|1565165_1565951_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.6	2.9e-61
WP_024623196.1|1565950_1566250_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	48.6	1.1e-13
WP_000690183.1|1566878_1567574_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	71.3	2.7e-87
WP_001191665.1|1567671_1567914_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	80.3	1.3e-25
WP_101134810.1|1567948_1568410_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	89.7	2.3e-58
WP_001208720.1|1568647_1568827_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	4.6e-15
WP_017880208.1|1568816_1569770_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	69.0	6.1e-90
WP_101134811.1|1569766_1570576_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	68.5	5.5e-108
WP_000779146.1|1570585_1570963_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
WP_032434890.1|1570975_1571956_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.5	7.6e-136
WP_004899672.1|1571969_1572548_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	7.6e-51
WP_032412064.1|1572767_1573193_+	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	83.7	1.9e-59
WP_032434891.1|1573189_1573345_+	DUF3927 domain-containing protein	NA	A0A0A0YRI9	Escherichia_phage	68.8	2.5e-09
WP_017145563.1|1573843_1574239_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
WP_019705280.1|1574225_1574507_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
WP_032434894.1|1574506_1575136_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	90.9	1.2e-105
WP_032434896.1|1575143_1575419_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	66.3	1.9e-23
WP_032434899.1|1575620_1576280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032434901.1|1576479_1576830_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	73.7	3.4e-46
WP_032434902.1|1576988_1577486_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	72.0	2.5e-63
WP_000246643.1|1577489_1579241_+|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	72.2	6.7e-252
WP_032434905.1|1579388_1580615_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.3	3.2e-208
WP_032434907.1|1580607_1581207_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	83.0	1.0e-90
WP_004104235.1|1581216_1582455_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	69.2	6.8e-158
WP_023316722.1|1582532_1582850_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	52.0	4.8e-23
WP_031592512.1|1582858_1583197_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	67.9	3.3e-38
WP_019705270.1|1583193_1583643_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
WP_023302599.1|1583639_1583987_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_032412035.1|1584043_1584748_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.5	9.5e-80
WP_032434909.1|1584778_1585183_+|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	56.2	1.9e-32
WP_016530183.1|1585185_1585491_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
WP_016530182.1|1585564_1585798_+	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
WP_032434911.1|1585859_1589246_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.5	4.0e-301
WP_004884312.1|1589267_1589741_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.7	1.1e-55
WP_023302606.1|1589727_1590204_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	64.6	5.3e-50
WP_032434913.1|1590216_1590597_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	83.3	2.0e-60
WP_032434915.1|1590593_1593671_+	kinase	NA	A0A286S259	Klebsiella_phage	62.2	0.0e+00
WP_032434917.1|1596355_1597450_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	86.5	1.4e-178
WP_032434919.1|1597484_1598573_-	acyltransferase	NA	C6ZR20	Salmonella_phage	27.2	1.8e-05
WP_004149224.1|1599271_1600201_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	81.4	6.7e-134
1599159:1599183	attR	TTATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
WP_002913362.1|1600490_1601252_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_004149222.1|1601313_1602642_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_002913359.1|1603009_1603294_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_032434923.1|1603453_1604764_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_032434925.1|1604763_1606908_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_002913355.1|1607117_1607603_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_002913348.1|1607623_1608175_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_002913346.1|1608342_1609275_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_002913342.1|1609316_1610402_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	4.5e-89
WP_004174960.1|1610404_1611229_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_002913340.1|1611228_1612038_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_002913339.1|1612037_1612586_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_002913338.1|1612617_1612899_+	YfcL family protein	NA	NA	NA	NA	NA
WP_032435686.1|1612960_1614949_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_002913291.1|1615107_1616328_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_004149211.1|1616537_1617713_+	MFS transporter	NA	NA	NA	NA	NA
WP_002913228.1|1618886_1620023_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.8	1.6e-20
WP_002913227.1|1620086_1621100_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_015958766.1|1621099_1621912_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP025140	Klebsiella pneumoniae strain KP1768 chromosome, complete genome	5388466	1820836	1827741	5388466	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004180551.1|1820836_1821700_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004899467.1|1821710_1822484_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_002912636.1|1822724_1823618_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1823863_1825225_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1825543_1826266_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_032434977.1|1826262_1827741_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 6
NZ_CP025140	Klebsiella pneumoniae strain KP1768 chromosome, complete genome	5388466	1981767	2030771	5388466	head,integrase,holin,terminase,tRNA	Enterobacteria_phage(25.49%)	67	1969961:1969975	1989832:1989846
1969961:1969975	attL	CCACCTCTTCCCCGC	NA	NA	NA	NA
WP_004151452.1|1981767_1983501_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	1.4e-87
WP_002911491.1|1983736_1984306_+	VOC family protein	NA	NA	NA	NA	NA
WP_002911488.1|1984382_1985126_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_032435025.1|1985207_1986212_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_002911486.1|1986208_1986952_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
WP_002911484.1|1986991_1987387_-	membrane protein	NA	NA	NA	NA	NA
WP_096991418.1|1987439_1988213_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.1e-60
WP_101134814.1|1988215_1989475_-|integrase	site-specific integrase	integrase	A0A286S1S8	Klebsiella_phage	90.4	3.0e-225
WP_023283988.1|1989517_1989763_-	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	92.1	1.4e-35
WP_101134815.1|1989766_1989961_-	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	53.6	2.6e-11
1989832:1989846	attR	CCACCTCTTCCCCGC	NA	NA	NA	NA
WP_101134816.1|1989957_1990464_-	HNH endonuclease	NA	A0A1W6DY33	Salmonella_phage	43.9	3.5e-36
WP_101134817.1|1990679_1991207_-	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.6	4.9e-57
WP_072044372.1|1991203_1991362_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	58.8	1.9e-09
WP_049186040.1|1991358_1992039_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	4.6e-124
WP_101134818.1|1992035_1992881_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	9.0e-69
WP_085841924.1|1992896_1993181_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	60.6	4.4e-28
WP_019725103.1|1993269_1993464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101134819.1|1994112_1994949_-	hypothetical protein	NA	A0A0R6PIN1	Moraxella_phage	29.5	2.1e-25
WP_004197930.1|1994911_1995091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101134820.1|1995212_1995911_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	83.2	2.0e-106
WP_004201115.1|1996022_1996250_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_004141720.1|1996289_1996610_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	68.9	3.8e-36
WP_101134821.1|1996938_1997799_+	replication protein	NA	K7PGT1	Enterobacteria_phage	52.2	3.9e-59
WP_101134822.1|1997795_1998644_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	3.0e-88
WP_004151295.1|1998640_1998934_+	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_101134823.1|1998930_1999476_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	40.2	5.7e-08
WP_101134824.1|1999472_2000222_+	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_101134889.1|2001317_2001533_+	hypothetical protein	NA	Q8HAA6	Salmonella_phage	64.3	5.0e-08
WP_101134825.1|2001529_2002075_+	DUF551 domain-containing protein	NA	S4TSR6	Salmonella_phage	67.7	1.0e-20
WP_016831923.1|2002064_2002289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101134826.1|2002540_2002996_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	68.9	3.4e-54
WP_023342724.1|2002995_2003166_+	hypothetical protein	NA	G8C7V4	Escherichia_phage	73.2	5.7e-15
WP_101134827.1|2003158_2003797_+	hypothetical protein	NA	H6WRY9	Salmonella_phage	70.3	3.4e-76
WP_101134828.1|2003793_2004435_+	HNH endonuclease	NA	A0A2H4JH74	uncultured_Caudovirales_phage	40.7	8.4e-35
WP_023342726.1|2004431_2004572_+	YlcG family protein	NA	NA	NA	NA	NA
WP_101134829.1|2004568_2005258_+	antiterminator	NA	I6PDF8	Cronobacter_phage	53.2	4.5e-58
WP_019704119.1|2006103_2006328_+|holin	holin	holin	M9NZI9	Enterobacteria_phage	91.9	4.0e-32
WP_019704120.1|2006305_2006800_+	lysozyme	NA	M9P0E5	Enterobacteria_phage	95.1	1.7e-88
WP_020804394.1|2006796_2007147_+	hypothetical protein	NA	A0A0K2FIW3	Enterobacter_phage	42.9	5.8e-14
WP_065242184.1|2008378_2009005_+	hypothetical protein	NA	I6S676	Salmonella_phage	84.9	1.1e-103
WP_065242183.1|2009035_2009503_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	73.8	1.5e-57
WP_065242182.1|2009486_2010785_+|terminase	PBSX family phage terminase large subunit	terminase	Q5G8Y7	Enterobacteria_phage	94.1	1.5e-240
WP_065242181.1|2010797_2012267_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	55.9	9.9e-148
WP_065242180.1|2012193_2013189_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	70.2	8.0e-117
WP_112113408.1|2013235_2013538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020803626.1|2013609_2014995_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	64.5	6.9e-167
WP_004178846.1|2014998_2015430_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.1	1.4e-41
WP_004178847.1|2015441_2016539_+	hypothetical protein	NA	F1C5E1	Cronobacter_phage	73.6	4.2e-151
WP_020803627.1|2016548_2016806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040229589.1|2016808_2017189_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	1.2e-28
WP_032752624.1|2017188_2017362_+	hypothetical protein	NA	I6R0P9	Salmonella_phage	54.4	5.4e-13
WP_032425728.1|2017361_2017724_+	hypothetical protein	NA	A0A1B1W262	Salmonella_phage	45.0	3.1e-18
WP_020804116.1|2017726_2018095_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	79.5	4.7e-46
WP_020804115.1|2018091_2018475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065242179.1|2018532_2019297_+	immunoglobulin domain-containing protein	NA	G0ZNE6	Cronobacter_phage	43.4	4.2e-41
WP_065242178.1|2019365_2020079_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	55.1	9.6e-64
WP_020804850.1|2020297_2021053_+	KilA-N domain protein	NA	K7PH30	Enterobacteria_phage	50.0	2.8e-61
WP_020804851.1|2021055_2021310_+	hypothetical protein	NA	K7PM89	Enterobacteria_phage	72.3	2.3e-20
WP_023328739.1|2021730_2022051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086556004.1|2022102_2022420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032426034.1|2022842_2023256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020804808.1|2023315_2026681_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	75.0	0.0e+00
WP_032426035.1|2026680_2026926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087588165.1|2027025_2027445_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	47.8	6.3e-31
WP_038421573.1|2027444_2027915_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	3.3e-28
WP_065242176.1|2027911_2028307_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	2.3e-35
WP_087588163.1|2028293_2030771_+	MoaD/ThiS family protein	NA	R9TR21	Aeromonas_phage	47.0	2.3e-197
>prophage 7
NZ_CP025140	Klebsiella pneumoniae strain KP1768 chromosome, complete genome	5388466	2605453	2616340	5388466		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|2605453_2606074_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004190239.1|2606066_2607332_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	3.9e-233
WP_002903955.1|2607343_2608246_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|2608506_2609268_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004179754.1|2609288_2610149_-	class A beta-lactamase SHV-28	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
WP_004176262.1|2610446_2610707_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_020805010.1|2610793_2611882_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	1.8e-210
WP_004176258.1|2611912_2613178_-	MFS transporter	NA	NA	NA	NA	NA
WP_020805006.1|2613232_2616340_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 8
NZ_CP025140	Klebsiella pneumoniae strain KP1768 chromosome, complete genome	5388466	3518802	3528276	5388466	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_004209699.1|3518802_3520524_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3520568_3521270_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3521623_3521842_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3521972_3524252_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3524282_3524600_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3524925_3525147_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_025368306.1|3525223_3527164_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.0	5.0e-38
WP_002896440.1|3527160_3528276_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 1
NZ_CP025141	Klebsiella pneumoniae strain KP1768 plasmid KP1768_p1, complete sequence	204734	5518	38513	204734	portal,head,capsid,plate,integrase,tail,lysis,holin,terminase	Escherichia_phage(63.41%)	44	35496:35511	39448:39463
WP_000268395.1|5518_6457_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	50.2	1.5e-69
WP_000435224.1|6573_7119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001256128.1|7121_7691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004673.1|7702_8266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000468308.1|8445_8664_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_032413567.1|8745_9909_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	3.1e-205
WP_032413566.1|9908_10388_-|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	1.5e-84
WP_032413565.1|10402_12850_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.1	0.0e+00
WP_000785970.1|12842_12962_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001461862.1|12994_13270_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	1.3e-40
WP_001251408.1|13326_13845_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286737.1|13857_15048_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.8e-224
WP_001322808.1|15107_15707_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	95.9	3.4e-102
WP_001322807.1|15731_16121_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	52.9	5.5e-13
WP_001106830.1|16142_16583_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	71.0	1.5e-54
WP_001030526.1|16554_17157_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	86.0	2.9e-93
WP_032413564.1|17156_18491_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	68.7	1.4e-177
WP_001285340.1|18487_19099_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	100.0	1.7e-117
WP_064987485.1|19091_20000_-|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	99.3	5.7e-162
WP_000127164.1|20004_20352_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_032413562.1|20348_20984_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	3.2e-111
WP_032413561.1|21050_21503_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	2.6e-75
WP_032413560.1|21495_21963_-|tail	phage tail protein	tail	A0A0F7LDF5	Escherichia_phage	97.4	6.9e-79
WP_000040630.1|22070_22496_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	95.7	2.3e-65
WP_021563761.1|22483_22909_-	hypothetical protein	NA	M1SV74	Escherichia_phage	97.9	1.2e-58
WP_001144101.1|22923_23421_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|23420_23702_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846409.1|23705_23909_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_032413559.1|23908_24418_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	2.5e-90
WP_032413558.1|24517_25261_-|terminase	terminase endonuclease subunit	terminase	Q94MH8	Enterobacteria_phage	99.2	6.0e-125
WP_001248583.1|25264_26338_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	100.0	6.7e-202
WP_001607695.1|26396_27251_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0F7LA11	Escherichia_phage	100.0	1.7e-139
WP_032413555.1|27424_29197_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.3	0.0e+00
WP_032413553.1|29196_30231_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.4	1.6e-200
WP_000725496.1|30625_32170_+	RNA-directed DNA polymerase	NA	A0A0F7LCK9	Escherichia_phage	99.0	4.7e-289
WP_032413551.1|32657_34934_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	99.5	0.0e+00
WP_000027673.1|34923_35199_-	hypothetical protein	NA	S4TP00	Salmonella_phage	97.8	1.9e-44
WP_001113264.1|35195_35420_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277898.1|35422_35722_-	hypothetical protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
35496:35511	attL	AGTTCATCCACTGAGG	NA	NA	NA	NA
WP_000557703.1|35721_35946_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217677.1|36009_36510_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_001081582.1|36687_36963_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000020919.1|37084_37384_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_000985261.1|37499_38513_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
39448:39463	attR	AGTTCATCCACTGAGG	NA	NA	NA	NA
>prophage 2
NZ_CP025141	Klebsiella pneumoniae strain KP1768 plasmid KP1768_p1, complete sequence	204734	50241	93280	204734	integrase,transposase	Escherichia_phage(46.15%)	42	58489:58504	87611:87626
WP_012569499.1|50241_51222_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_001167032.1|51530_52388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000972663.1|52374_52605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000210758.1|52604_53123_-	nitrite reductase	NA	NA	NA	NA	NA
WP_000919345.1|53119_53566_-	Fe3+-siderophore ABC transporter permease	NA	NA	NA	NA	NA
WP_000422768.1|53565_53925_-	hypothetical protein	NA	A0A076G835	Escherichia_phage	49.4	5.6e-20
WP_000591074.1|53981_54410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000139698.1|54443_55304_-	DsbA family protein	NA	NA	NA	NA	NA
WP_001326179.1|55319_56297_-	S49 family peptidase	NA	Q9JMP1	Wolbachia_phage	31.5	7.1e-17
WP_000539392.1|56278_57133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000902149.1|57137_57452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001326180.1|57441_57885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000805800.1|58011_58533_-	hypothetical protein	NA	NA	NA	NA	NA
58489:58504	attL	GAAAGGGGCGATGATC	NA	NA	NA	NA
WP_077264454.1|58535_58997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000849071.1|59061_59670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000946102.1|59938_61054_+	phosphoadenosine phosphosulfate reductase family protein	NA	H7BVI4	unidentified_phage	29.1	6.4e-46
WP_000883925.1|61071_61506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000350011.1|62542_63643_-	plasmid replication protein	NA	NA	NA	NA	NA
WP_000375812.1|63919_64486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000077458.1|64957_65941_+	ParM/StbA family protein	NA	A7KUY1	Bacillus_phage	24.4	2.1e-08
WP_000919078.1|65957_66251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000651490.1|66252_66672_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001020646.1|66731_67283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000891157.1|67279_67888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000790610.1|67898_68432_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_000356489.1|68431_68704_-	nucleotide excision repair protein	NA	A0A2H4J3B6	uncultured_Caudovirales_phage	41.0	1.3e-08
WP_000683483.1|69419_69782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000534551.1|69819_73434_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_001317493.1|73561_74344_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_000255956.1|74340_75363_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_101134910.1|75429_76839_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_001326396.1|76840_77881_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000811656.1|77991_79503_-	ATP-dependent helicase	NA	A0A2D1GN12	Pseudoalteromonas_phage	30.7	3.6e-44
WP_000101568.1|79789_80830_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152391.1|81046_82762_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004152392.1|82871_85901_+|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004199214.1|86007_87033_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|87029_87809_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
87611:87626	attR	GAAAGGGGCGATGATC	NA	NA	NA	NA
WP_004199234.1|87940_88822_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152397.1|89071_90391_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_032413577.1|90735_91614_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_000427619.1|92275_93280_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP025141	Klebsiella pneumoniae strain KP1768 plasmid KP1768_p1, complete sequence	204734	98063	146726	204734	integrase,transposase	Escherichia_phage(25.0%)	59	117407:117422	145187:145202
WP_000935451.1|98063_99779_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001381192.1|99781_100774_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000259031.1|101369_102209_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|102202_102550_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_015059044.1|102777_103332_-	aminoglycoside 6'-N-acetyltransferase AAC(6')-33	NA	NA	NA	NA	NA
WP_000381802.1|103432_103966_-	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
WP_000845039.1|104111_105125_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001162012.1|105430_105988_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_064987470.1|105990_108963_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
WP_000427620.1|109041_110046_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001217881.1|110487_111045_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_000027057.1|111227_112088_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|112158_112863_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000993245.1|113050_113263_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001446012.1|113225_113345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087807.1|113328_113565_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277466.1|113561_113927_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000209296.1|113944_115630_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_000522996.1|115668_116094_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|116121_116397_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294656.1|116412_116778_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|116849_117305_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000139718.1|117294_117777_-	hypothetical protein	NA	NA	NA	NA	NA
117407:117422	attL	TCATCATTGATGAAAT	NA	NA	NA	NA
WP_000997323.1|117773_118643_-	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	35.1	3.5e-23
WP_000543934.1|118647_119658_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_000949433.1|119660_120197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000243801.1|120495_120816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000278322.1|121038_121641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000791469.1|121656_122109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000243483.1|122275_122611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787563.1|122869_123142_-	MafI family immunity protein	NA	NA	NA	NA	NA
WP_032413490.1|123138_127401_-	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	53.4	5.8e-23
WP_000988732.1|127533_128259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001337692.1|128372_128774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714162.1|128993_129233_-	permease	NA	NA	NA	NA	NA
WP_000268337.1|129305_129584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122923.1|129570_131298_-	hypothetical protein	NA	A0A0P0ZFY3	Escherichia_phage	32.6	9.9e-14
WP_001077335.1|131475_131862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000595210.1|132319_133171_-	hypothetical protein	NA	A0A219UQS0	Bacillus_phage	29.4	3.6e-09
WP_000064432.1|133245_133803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000260293.1|133876_134095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000184110.1|134108_134378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000071870.1|134370_134976_-	5'-deoxynucleotidase	NA	NA	NA	NA	NA
WP_000050848.1|135047_135251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101134912.1|135452_137906_-	phosphoadenosine phosphosulfate reductase	NA	NA	NA	NA	NA
WP_000042274.1|137993_138380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093868.1|138612_139167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015058950.1|139240_139717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000201432.1|139732_141358_-	DNA cytosine methyltransferase	NA	A0A0N9SK84	Staphylococcus_phage	25.8	1.2e-05
WP_000410925.1|141435_141738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000209093.1|141815_142160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157829720.1|142457_142601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001337696.1|142612_142990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000651508.1|143034_143226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001176699.1|143563_144016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000026577.1|144005_144395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102700.1|144456_144681_-	2Fe-2S ferredoxin-like protein	NA	NA	NA	NA	NA
WP_001317493.1|144924_145707_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
145187:145202	attR	ATTTCATCAATGATGA	NA	NA	NA	NA
WP_000255956.1|145703_146726_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
>prophage 1
NZ_CP025142	Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence	152230	0	8568	152230	transposase	Bacillus_phage(50.0%)	5	NA	NA
WP_101134916.1|121_745_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.0	7.4e-28
WP_003032875.1|737_2213_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_004178091.1|2463_2895_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_101134923.1|4323_5530_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	61.2	5.6e-96
WP_004178088.1|6570_8568_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
>prophage 2
NZ_CP025142	Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence	152230	13877	31090	152230	integrase,transposase	Macacine_betaherpesvirus(30.0%)	13	3626:3642	34688:34704
3626:3642	attL	CTCCAGCGCCTTTTGCT	NA	NA	NA	NA
WP_004152067.1|13877_14801_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
WP_071527918.1|14865_15177_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152065.1|15203_16151_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_001515717.1|17294_18035_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004152063.1|18751_19762_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	55.9	8.8e-87
WP_000523813.1|20513_21680_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	1.4e-224
WP_004152062.1|21679_22651_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.6	4.1e-150
WP_101134918.1|25602_26874_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.0	1.7e-151
WP_004178083.1|26873_27299_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.6	8.3e-31
WP_101134919.1|27704_29189_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.5	2.0e-31
WP_004152753.1|29422_29653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118478.1|30173_30599_+	antirestriction protein	NA	NA	NA	NA	NA
WP_004152754.1|30835_31090_+	hypothetical protein	NA	H9C187	Pectobacterium_phage	50.0	1.2e-11
34688:34704	attR	AGCAAAAGGCGCTGGAG	NA	NA	NA	NA
>prophage 3
NZ_CP025142	Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence	152230	34227	38533	152230		Thalassomonas_phage(33.33%)	4	NA	NA
WP_004152645.1|34227_34791_+	methyltransferase	NA	A8HNV9	Thalassomonas_phage	34.1	1.3e-18
WP_004152644.1|35566_36109_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	6.0e-50
WP_001568055.1|36157_36406_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_023287107.1|36475_38533_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.2	3.4e-21
>prophage 4
NZ_CP025142	Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence	152230	42817	46418	152230		Klebsiella_phage(25.0%)	7	NA	NA
WP_004152717.1|42817_43174_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	2.6e-25
WP_004152718.1|43234_43447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152719.1|43457_43682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152720.1|43762_44083_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
WP_004152721.1|44072_44351_+	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
WP_023287139.1|44351_44765_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023287138.1|45596_46418_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	1.2e-44
>prophage 5
NZ_CP025142	Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence	152230	71624	113926	152230	protease,transposase	uncultured_Caudovirales_phage(43.75%)	38	NA	NA
WP_157829722.1|71624_72548_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.4	5.2e-171
WP_023287125.1|72670_73042_+	TraT complement resistance protein	NA	NA	NA	NA	NA
WP_017900859.1|73540_73924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023287124.1|74050_76360_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_023287123.1|76359_81618_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_009309882.1|81707_82433_+	type-F conjugative transfer system pilin acetylase TraX	NA	NA	NA	NA	NA
WP_009309883.1|82587_83184_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_009309884.1|83203_83551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009309885.1|84021_84666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009309886.1|84721_85372_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_009309887.1|85368_85680_+	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	40.0	2.1e-15
WP_001549890.1|86176_86509_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004118521.1|86505_87228_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	73.0	1.5e-96
WP_001549888.1|87285_87714_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.3e-52
WP_001549887.1|87763_89047_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.6	2.9e-175
WP_001549886.1|89142_89496_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.1	5.9e-22
WP_001549885.1|89979_91458_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.0	1.6e-198
WP_004118529.1|91476_92304_+	universal stress protein	NA	NA	NA	NA	NA
WP_001549953.1|92375_93572_-	MFS transporter	NA	NA	NA	NA	NA
WP_004118534.1|94100_94475_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	56.0	4.5e-28
WP_011977829.1|94749_95898_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	65.9	1.7e-123
WP_004118538.1|96251_96584_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_001067855.1|96846_97551_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|97856_98561_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004153729.1|99416_100244_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_004152695.1|100240_101104_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152694.1|101112_101940_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152693.1|101948_102959_+	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152692.1|102952_103822_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000019473.1|105030_106011_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004118209.1|107212_107476_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004118208.1|107490_107754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152118.1|107997_108279_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004152117.1|108313_108883_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152116.1|108997_111793_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152115.1|111792_111990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009483782.1|112227_112977_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152113.1|112963_113926_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
>prophage 6
NZ_CP025142	Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence	152230	121238	125545	152230		uncultured_Caudovirales_phage(100.0%)	5	NA	NA
WP_004152101.1|121238_121589_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152100.1|121638_122001_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152099.1|122018_123770_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152098.1|123817_125107_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152097.1|125119_125545_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
>prophage 7
NZ_CP025142	Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence	152230	129002	129713	152230		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_085903505.1|129002_129713_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
>prophage 8
NZ_CP025142	Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence	152230	134231	136309	152230		Bacillus_phage(100.0%)	2	NA	NA
WP_004152084.1|134231_135632_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_001188930.1|135628_136309_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
>prophage 9
NZ_CP025142	Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence	152230	141402	148659	152230		uncultured_Caudovirales_phage(33.33%)	5	NA	NA
WP_004118669.1|141402_142140_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_000843497.1|142173_142371_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004098955.1|142411_144859_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000758228.1|144985_145426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098958.1|145512_148659_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
