The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021387	Bifidobacterium breve strain NRBB09 chromosome, complete genome	2265557	27269	101368	2265557	coat,tRNA,protease,integrase,transposase	Corynebacterium_phage(25.0%)	45	21001:21035	28168:28202
21001:21035	attL	GTGGAGCTAGCCGGGTTCGAACCGGCGACCCTCTG	NA	NA	NA	NA
WP_106629142.1|27269_27839_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_106629143.1|27799_28051_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1W6JQG4	Corynebacterium_phage	56.6	3.7e-10
WP_106629144.1|28499_29165_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
28168:28202	attR	GTGGAGCTAGCCGGGTTCGAACCGGCGACCCTCTG	NA	NA	NA	NA
WP_106629145.1|29850_31164_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_012576486.1|31398_31878_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_016462000.1|32795_33374_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003833099.1|33696_34362_+	YesL family protein	NA	NA	NA	NA	NA
WP_106629146.1|34365_35427_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003833103.1|35696_37094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032739701.1|37298_38612_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015438192.1|39103_41677_-	DUF5110 domain-containing protein	NA	NA	NA	NA	NA
WP_015438193.1|41831_42845_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_106629147.1|43008_44115_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	31.4	2.9e-35
WP_003833108.1|46525_47362_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_003833110.1|47358_48213_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_003833111.1|51528_52629_-	DUF2961 domain-containing protein	NA	NA	NA	NA	NA
WP_003833113.1|52808_54158_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003833115.1|54421_55456_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_052787591.1|55818_57204_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003833118.1|57592_58072_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_106629148.1|58234_59608_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_052822174.1|59813_60950_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_025300911.1|60965_61649_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_014483221.1|61915_62479_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_106629149.1|62631_64545_+	FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	36.4	2.1e-49
WP_106629150.1|64850_67058_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014483224.1|67054_67969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106629151.1|69838_71272_+	DUF3492 domain-containing protein	NA	NA	NA	NA	NA
WP_106629152.1|71273_72821_+	exopolysaccharide Pel transporter PelG	NA	NA	NA	NA	NA
WP_106629153.1|72824_74639_+|coat	spore coat protein CotH	coat	NA	NA	NA	NA
WP_003827901.1|74628_75453_+	polyphosphate polymerase domain-containing protein	NA	NA	NA	NA	NA
WP_050824501.1|75530_76196_+	DUF4956 domain-containing protein	NA	NA	NA	NA	NA
WP_065464070.1|77967_79233_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_106629154.1|80941_82591_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_101673471.1|82758_85512_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_106629155.1|85809_87798_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_106629156.1|88705_89695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106629752.1|90159_91758_+	amidohydrolase	NA	NA	NA	NA	NA
WP_003827911.1|92441_93533_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_101673467.1|93666_94053_+	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_106629157.1|95436_96828_+	MFS transporter	NA	NA	NA	NA	NA
WP_025220969.1|96860_97268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106629158.1|97411_99934_+	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	39.1	1.0e-11
WP_014483248.1|100236_100461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106629159.1|100627_101368_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP021387	Bifidobacterium breve strain NRBB09 chromosome, complete genome	2265557	550019	562791	2265557	protease	Streptococcus_phage(100.0%)	16	NA	NA
WP_106629287.1|550019_552206_-	hypothetical protein	NA	A0A1S5SF30	Streptococcus_phage	52.1	8.9e-185
WP_106629288.1|552205_554656_-	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	76.0	0.0e+00
WP_106629289.1|554633_555032_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	72.2	7.0e-48
WP_002323345.1|555150_555654_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	60.8	7.5e-55
WP_055154243.1|555671_556175_-	antirestriction protein	NA	NA	NA	NA	NA
WP_082419343.1|556093_556390_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_002347256.1|556477_556948_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002347257.1|556944_557187_-	DUF3781 domain-containing protein	NA	NA	NA	NA	NA
WP_008393975.1|557403_558045_-	hydrolase	NA	NA	NA	NA	NA
WP_002317729.1|558079_558301_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	86.3	1.2e-28
WP_106629290.1|558301_558445_-	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_106629291.1|558457_559654_-	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	63.0	1.9e-149
WP_106629292.1|559837_561232_-	ATP-binding protein	NA	A0A1S5SFB5	Streptococcus_phage	65.5	2.6e-174
WP_040014032.1|561323_561962_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_106629293.1|562065_562449_-	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	55.9	2.3e-32
WP_002606075.1|562464_562791_-	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.4e-25
>prophage 3
NZ_CP021387	Bifidobacterium breve strain NRBB09 chromosome, complete genome	2265557	1145112	1159444	2265557	terminase,capsid,tail,portal	Bifidobacterium_phage(100.0%)	15	NA	NA
WP_106629466.1|1145112_1148451_-|tail	phage tail tape measure protein	tail	I3NL90	Bifidobacterium_phage	47.1	6.7e-184
WP_106629467.1|1148467_1148764_-	hypothetical protein	NA	I3NL91	Bifidobacterium_phage	65.3	3.9e-35
WP_106629468.1|1148826_1149330_-	DNA primase	NA	I3NL92	Bifidobacterium_phage	67.9	1.4e-56
WP_106629469.1|1149506_1150040_-	hypothetical protein	NA	I3NL93	Bifidobacterium_phage	87.2	2.2e-81
WP_065452597.1|1150112_1150529_-	transcriptional regulator	NA	I3NL94	Bifidobacterium_phage	60.1	1.9e-40
WP_065452612.1|1150942_1151314_-	hypothetical protein	NA	I3NL96	Bifidobacterium_phage	87.5	3.3e-39
WP_065452595.1|1151373_1151883_-	hypothetical protein	NA	I3NL97	Bifidobacterium_phage	63.1	5.1e-51
WP_106629470.1|1151894_1152299_-	hypothetical protein	NA	I3NL98	Bifidobacterium_phage	36.9	2.3e-06
WP_065452594.1|1152298_1153243_-|capsid	phage major capsid protein	capsid	I3NL99	Bifidobacterium_phage	79.3	1.9e-144
WP_065452593.1|1153253_1153805_-	hypothetical protein	NA	I3NLA0	Bifidobacterium_phage	62.6	8.8e-57
WP_065452592.1|1153949_1155233_-	hypothetical protein	NA	I3NLA2	Bifidobacterium_phage	59.4	1.4e-116
WP_065452591.1|1155213_1156614_-|portal	phage portal protein	portal	I3NLA3	Bifidobacterium_phage	73.1	4.2e-204
WP_065452610.1|1156607_1158404_-|terminase	terminase	terminase	I3NLA4	Bifidobacterium_phage	84.3	0.0e+00
WP_065452590.1|1158403_1158802_-	hypothetical protein	NA	I3NLA5	Bifidobacterium_phage	71.0	7.3e-45
WP_065452589.1|1158823_1159444_-	hypothetical protein	NA	I3NLA6	Bifidobacterium_phage	61.0	2.4e-63
