The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021394	Bifidobacterium breve strain NRBB56 chromosome, complete genome	2425122	361342	453720	2425122	transposase,integrase,protease,holin,tRNA,portal,capsid	Lactococcus_phage(11.76%)	81	381066:381083	437051:437068
WP_011068473.1|361342_361642_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_106630219.1|361645_363187_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_050824589.1|363212_364712_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_095256852.1|364879_365899_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003828150.1|365905_366220_+	DUF2469 domain-containing protein	NA	NA	NA	NA	NA
WP_014483403.1|366390_368004_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_106630220.1|368363_370334_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_080988924.1|370433_371552_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_015438348.1|371714_373160_-	sugar:sodium symporter	NA	NA	NA	NA	NA
WP_106630221.1|373233_375054_-	glycoside hydrolase family 2	NA	NA	NA	NA	NA
WP_014484532.1|375419_375905_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_106630736.1|375928_377287_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	26.2	5.2e-26
WP_106630222.1|377421_378885_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_015438349.1|379251_379641_+	chorismate mutase	NA	NA	NA	NA	NA
WP_106630223.1|379787_381773_+	hypothetical protein	NA	NA	NA	NA	NA
381066:381083	attL	GATTTGACTGAGGCGCAG	NA	NA	NA	NA
WP_106630224.1|381805_384541_-|tRNA	valine--tRNA ligase	tRNA	A0A2K9KZB8	Tupanvirus	37.0	5.2e-158
WP_106630737.1|384592_386122_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_106630225.1|386156_386825_-	endonuclease III	NA	NA	NA	NA	NA
WP_095256841.1|386849_387638_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.0	6.5e-13
WP_065454276.1|387792_388497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014483415.1|388556_389135_-	manganese efflux pump	NA	NA	NA	NA	NA
WP_003828172.1|389308_389803_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	48.1	2.2e-30
WP_106630226.1|389888_392123_-	alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase	NA	NA	NA	NA	NA
WP_106630227.1|392369_394304_+	cell surface protein	NA	NA	NA	NA	NA
WP_106630228.1|395111_395387_+|holin	holin	holin	NA	NA	NA	NA
WP_041473379.1|395450_395762_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_041473380.1|395781_396030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106630738.1|397053_397617_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	35.6	3.9e-20
WP_106630229.1|397820_399281_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_015438362.1|400586_401570_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_015438363.1|401584_402517_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_106630230.1|402608_404234_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015438365.1|404366_405698_+	glycosyl hydrolase family 30	NA	NA	NA	NA	NA
WP_157825743.1|405703_406393_+	YesL family protein	NA	NA	NA	NA	NA
WP_157825744.1|405939_407064_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106630233.1|407060_409454_+	beta-glucosidase	NA	NA	NA	NA	NA
WP_106630234.1|409565_411326_+	beta-galactosidase	NA	NA	NA	NA	NA
WP_147280822.1|411291_411579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106630235.1|412122_412740_-|transposase	transposase	transposase	I4AZM3	Saccharomonospora_phage	48.5	1.1e-31
WP_106630236.1|412484_413327_-	helix-turn-helix domain-containing protein	NA	Q9G0F2	Phage_Gifsy-1	40.1	4.2e-26
WP_106630237.1|413504_414785_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	37.4	5.4e-25
WP_041473384.1|414821_415034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106630238.1|415030_415666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106630239.1|416019_417393_+|portal	phage portal protein	portal	A0A2P1CHJ4	Mycobacterium_phage	28.8	1.1e-34
WP_157825745.1|417337_417787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015439062.1|417829_418609_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	37.1	1.7e-37
WP_015439061.1|418605_420105_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.6	1.8e-11
WP_106630241.1|420199_421249_+	hypothetical protein	NA	A0A1D8ETG0	Propionibacterium_phage	40.8	3.8e-16
WP_106630242.1|421452_421944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106630243.1|421953_422844_+|capsid	phage major capsid protein	capsid	I3WWP3	Mycobacterium_virus	35.6	4.9e-33
WP_015438375.1|423149_423383_+	hypothetical protein	NA	A0A059NT58	Lactococcus_phage	43.1	5.1e-06
WP_044051858.1|423469_423835_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_015438377.1|423843_424038_-	hypothetical protein	NA	A0A0R6PD93	Moraxella_phage	45.7	2.7e-05
WP_106630244.1|424101_424926_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	42.6	4.1e-50
WP_106630245.1|425334_426369_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_106630246.1|426713_427523_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_025332040.1|427626_427857_+	ATP synthase F0 subunit C	NA	NA	NA	NA	NA
WP_106630247.1|427922_428441_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_025300999.1|428475_429312_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_003828181.1|429380_431012_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_106630248.1|431015_431939_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_003828183.1|431947_433420_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_021649479.1|433419_433713_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_106630249.1|433796_434501_+	endonuclease NucS	NA	NA	NA	NA	NA
WP_003828186.1|434631_435585_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_025299527.1|435686_436925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106630250.1|436924_437929_+	hypothetical protein	NA	NA	NA	NA	NA
437051:437068	attR	GATTTGACTGAGGCGCAG	NA	NA	NA	NA
WP_003828189.1|438151_439123_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003831436.1|439261_439888_-	adenylate cyclase	NA	NA	NA	NA	NA
WP_003828192.1|440568_440958_+	endoribonuclease L-PSP	NA	NA	NA	NA	NA
WP_106630251.1|441083_442037_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_014483426.1|442229_443231_+	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_106630252.1|443276_444464_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_065465635.1|444730_445897_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003828197.1|445908_446847_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_044051860.1|446882_447755_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_106630253.1|447751_449071_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.3	7.6e-30
WP_106630254.1|449488_450526_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_025262739.1|450657_451449_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_106630255.1|451629_453063_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_157825746.1|453210_453720_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP021394	Bifidobacterium breve strain NRBB56 chromosome, complete genome	2425122	572073	599873	2425122	transposase,integrase	Escherichia_phage(42.86%)	21	571938:571997	575321:575412
571938:571997	attL	GATTAAGCCGGGTTTGTTGTTAAGCCGGGGAACGGTTCGGGGTCTTGGTGGCTGGCCGTG	NA	NA	NA	NA
WP_014484092.1|572073_573276_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_106630745.1|574235_575288_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_106630280.1|577042_577405_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
575321:575412	attR	CACGGCCAGCCACCAAGACCCCGAACCGTTCCCCGGCTTAACAACAAACCCGGCTTAATCACTGTGGATGATCGGCTTCTCTCCGTCCTTGA	NA	NA	NA	NA
WP_106630281.1|577551_578142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015439062.1|578322_579102_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	37.1	1.7e-37
WP_015439061.1|579098_580598_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.6	1.8e-11
WP_106630283.1|582024_583104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106630284.1|585402_586878_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_106630285.1|586880_587660_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	36.0	1.5e-38
WP_106630286.1|587759_588224_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_106630287.1|588614_589355_+	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_106630288.1|589362_590358_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	30.9	9.8e-14
WP_157825747.1|590395_591694_+	oligosaccharide repeat unit polymerase	NA	NA	NA	NA	NA
WP_106630746.1|591723_593160_+	flippase	NA	NA	NA	NA	NA
WP_106630290.1|593156_594212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106630291.1|594214_595249_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_106630292.1|595251_596298_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_106630293.1|596318_597533_+	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_106630294.1|597701_597953_-	hypothetical protein	NA	Q9MBM9	Staphylococcus_prophage	41.4	2.0e-08
WP_106630295.1|598149_598497_-	hypothetical protein	NA	A0A1B1P773	Bacillus_phage	40.5	2.8e-08
WP_106630296.1|598688_599873_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	31.8	8.8e-38
>prophage 3
NZ_CP021394	Bifidobacterium breve strain NRBB56 chromosome, complete genome	2425122	2242811	2293800	2425122	transposase,tRNA	Escherichia_phage(33.33%)	40	NA	NA
WP_015439061.1|2242811_2244311_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.6	1.8e-11
WP_015439062.1|2244307_2245087_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	37.1	1.7e-37
WP_025341803.1|2245602_2246163_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_106630777.1|2246114_2246969_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.0	2.0e-44
WP_021650016.1|2247120_2248524_-	cell envelope-like function transcriptional attenuator common domain protein	NA	NA	NA	NA	NA
WP_106630687.1|2248934_2250395_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_100218452.1|2250835_2251576_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_106630689.1|2251936_2252701_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_025341947.1|2252818_2253679_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_106630690.1|2253949_2256373_-	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	36.3	2.1e-62
WP_106630691.1|2256571_2257531_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_003832351.1|2257727_2259533_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.2	1.3e-45
WP_106622118.1|2259732_2261595_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.7	7.4e-47
WP_025263324.1|2262063_2262234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025263325.1|2262350_2263667_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_153246528.1|2263807_2263948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106630778.1|2264019_2264268_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_016462700.1|2266046_2266340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025263331.1|2266849_2268715_-|tRNA	methionine--tRNA ligase	tRNA	A0A2K9KZR3	Tupanvirus	29.6	9.3e-66
WP_003832377.1|2268952_2269624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032734693.1|2269614_2269962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106621145.1|2270081_2271131_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	35.6	8.9e-42
WP_106630692.1|2271759_2273178_-	sodium:solute symporter	NA	NA	NA	NA	NA
WP_106630693.1|2273282_2274224_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_106630694.1|2274232_2276062_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	4.1e-50
WP_106630695.1|2278245_2278767_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021650037.1|2279372_2279957_-	LPXTG-motif protein cell wall anchor domain protein	NA	NA	NA	NA	NA
WP_021650038.1|2279997_2280435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115790810.1|2280547_2280985_+|transposase	DDE transposase	transposase	NA	NA	NA	NA
WP_106630696.1|2280981_2281359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141672144.1|2281383_2281680_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015439315.1|2282625_2283699_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_015439316.1|2283821_2284601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032743212.1|2284667_2286764_-	beta-galactosidase	NA	NA	NA	NA	NA
WP_015439318.1|2286825_2287767_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_032743213.1|2287771_2289331_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.3	1.2e-18
WP_015439320.1|2289355_2290534_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_106630697.1|2290859_2291441_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015439062.1|2291524_2292304_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	37.1	1.7e-37
WP_015439061.1|2292300_2293800_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.6	1.8e-11
