The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP031123	Providencia sp. WCHPHu000369 strain WCHPr000369 chromosome, complete genome	4573616	282422	345781	4573616	transposase,integrase,holin	Bacillus_virus(16.67%)	43	326382:326402	356964:356984
WP_102139488.1|282422_284429_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.2	6.3e-20
WP_102139487.1|284847_285114_-	DksA/TraR family C4-type zinc finger protein	NA	K4F9U1	Cronobacter_phage	56.8	2.1e-19
WP_102139486.1|285185_285626_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_102139485.1|285769_286093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102139484.1|286431_287118_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_102139483.1|287167_288877_-	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_102139482.1|289238_290417_+	potassium channel protein	NA	NA	NA	NA	NA
WP_102139481.1|290450_291083_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	30.3	4.7e-14
WP_004905254.1|291067_291733_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_102139480.1|292161_293871_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_102139479.1|305299_305656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102139478.1|305642_305864_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_102139477.1|306645_307032_+	thioredoxin family protein	NA	A0A191VYI2	Roseobacter_phage	32.5	4.5e-07
WP_102139476.1|307074_307869_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_102139475.1|308092_309100_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_004905244.1|309258_310230_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_102139474.1|310240_311725_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.9	2.9e-22
WP_102139473.1|311881_312796_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_102139472.1|312893_313967_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_094963063.1|314698_316000_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_102139471.1|316070_316799_-	amino acid racemase	NA	NA	NA	NA	NA
WP_102139470.1|317259_318168_+	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_102139469.1|318258_318972_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	36.4	3.0e-17
WP_102139468.1|319131_320382_-	MFS transporter	NA	NA	NA	NA	NA
WP_102139467.1|320396_321218_-	carbon-phosphorus lyase	NA	NA	NA	NA	NA
WP_102139466.1|321564_323772_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_102139464.1|324363_324633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102139463.1|324653_325442_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
326382:326402	attL	GTGGTGCCCGGACTCGGAATC	NA	NA	NA	NA
WP_102139460.1|326479_327652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102139459.1|327919_328522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102139458.1|328722_328977_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_102139457.1|329018_330257_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	35.3	2.3e-60
WP_102139456.1|330361_330946_+	antirestriction protein ArdA	NA	A0A0A8WIV6	Clostridium_phage	43.9	7.7e-27
WP_102139455.1|331009_331210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114365408.1|331383_332307_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	68.4	5.2e-118
WP_102139453.1|332362_333514_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_114365407.1|333433_333781_-|transposase	transposase	transposase	Q716C1	Shigella_phage	63.5	1.5e-22
WP_102139452.1|335628_336351_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_168222825.1|336705_338187_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_102139532.1|338596_340246_-	cellulose biosynthesis protein BcsG	NA	NA	NA	NA	NA
WP_102139450.1|340450_341974_-	cellulose biosynthesis protein BcsE	NA	NA	NA	NA	NA
WP_102139448.1|342404_343139_+	cellulose synthase operon protein YhjQ	NA	NA	NA	NA	NA
WP_102140845.1|345084_345781_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	46.8	2.6e-61
356964:356984	attR	GTGGTGCCCGGACTCGGAATC	NA	NA	NA	NA
>prophage 2
NZ_CP031123	Providencia sp. WCHPHu000369 strain WCHPr000369 chromosome, complete genome	4573616	453457	464055	4573616		Mycobacterium_phage(25.0%)	11	NA	NA
WP_004257111.1|453457_454657_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.5	2.6e-29
WP_102138284.1|455398_456370_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	72.5	5.4e-134
WP_102138285.1|456383_458516_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.7	5.6e-208
WP_102138286.1|458527_458941_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	34.7	2.3e-09
WP_102138287.1|458949_459177_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	56.2	3.6e-17
WP_102138288.1|459465_459924_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A2K9L300	Tupanvirus	46.7	4.2e-20
WP_004257099.1|460140_460350_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	3.5e-22
WP_102138289.1|460483_461449_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_102138290.1|461571_462201_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_004257083.1|462429_462693_-	YbeD family protein	NA	NA	NA	NA	NA
WP_102138291.1|462843_464055_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.3	5.9e-106
>prophage 3
NZ_CP031123	Providencia sp. WCHPHu000369 strain WCHPr000369 chromosome, complete genome	4573616	1044172	1126038	4573616	portal,protease,head,transposase,tail,plate,holin,integrase,terminase,capsid,tRNA	Salmonella_phage(29.79%)	84	1070069:1070088	1102391:1102410
WP_102139222.1|1044172_1046011_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2L0V0F4	Agrobacterium_phage	34.2	7.8e-41
WP_102139324.1|1046015_1046645_+	radical SAM protein	NA	NA	NA	NA	NA
WP_102139221.1|1046661_1052961_+	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_102139220.1|1052957_1054310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096863947.1|1054413_1055280_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_102139219.1|1055272_1056163_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_102139218.1|1056159_1057050_-	manganese/iron ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.6	1.3e-09
WP_102139217.1|1057051_1057963_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_102139216.1|1058246_1058900_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_102139215.1|1058893_1059598_-	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_102139214.1|1060065_1060479_+	fosfomycin resistance glutathione transferase	NA	NA	NA	NA	NA
WP_102139213.1|1060581_1060980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102139212.1|1061083_1061533_+	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_102139211.1|1061893_1063822_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	2.0e-127
WP_102139210.1|1063825_1064365_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.5	5.3e-14
WP_071524539.1|1064786_1065326_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	35.2	1.8e-14
WP_004263702.1|1065421_1065619_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004263714.1|1065664_1066021_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_136134757.1|1066115_1066160_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_102139209.1|1066362_1067346_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	37.6	6.4e-34
WP_102139208.1|1067360_1069748_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_004263721.1|1069752_1070049_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	3.2e-13
1070069:1070088	attL	AAAAGACCGCCTAGGCGGTC	NA	NA	NA	NA
WP_102139207.1|1070152_1071166_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	49.4	1.3e-93
WP_102139206.1|1071259_1071472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036962131.1|1071468_1071759_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	48.8	3.1e-13
WP_036962129.1|1071853_1072204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102139204.1|1072402_1072564_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_102139203.1|1072569_1073001_+	DUF5347 family protein	NA	NA	NA	NA	NA
WP_102139202.1|1073018_1073330_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_071548753.1|1073322_1073544_+	TraR/DksA family transcriptional regulator	NA	F1BUS2	Erwinia_phage	47.9	1.1e-10
WP_102139201.1|1073540_1073843_+	DUF3850 domain-containing protein	NA	A0A2P0W9X8	Enterobacter_phage	39.4	1.3e-06
WP_102139200.1|1073835_1074660_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	47.3	4.0e-61
WP_102139199.1|1074659_1074983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102139198.1|1074975_1077390_+	replication endonuclease	NA	M1SV59	Escherichia_phage	47.0	8.9e-162
WP_102139323.1|1077460_1079017_-	DNA repair protein	NA	NA	NA	NA	NA
WP_102139197.1|1079775_1080726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071548745.1|1080829_1081867_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	70.7	6.8e-143
WP_116068763.1|1081866_1083624_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	75.7	9.1e-273
WP_116068760.1|1083782_1084610_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	47.4	1.4e-53
WP_116068757.1|1084622_1085717_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	61.2	2.2e-120
WP_110591551.1|1085744_1086377_+	hypothetical protein	NA	A0A077K804	Ralstonia_phage	41.9	1.7e-35
WP_116068755.1|1086465_1086942_+|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	45.1	5.0e-24
WP_110591553.1|1086938_1087142_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	58.2	2.3e-15
WP_116068753.1|1087145_1087451_+|holin	holin	holin	E7C9S8	Salmonella_phage	55.2	7.8e-23
WP_036962066.1|1087443_1087887_+	structural protein	NA	A0A0D4DAE2	Escherichia_phage	44.2	7.6e-27
WP_116068840.1|1087929_1088481_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_102140829.1|1088464_1088893_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	44.1	2.4e-25
WP_102140828.1|1088889_1089507_+	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	38.8	4.2e-31
WP_116068751.1|1089595_1089979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102140745.1|1089982_1090606_+|plate	phage baseplate assembly protein V	plate	O80314	Escherichia_phage	55.9	1.9e-52
WP_036962053.1|1090602_1090944_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	61.3	8.7e-31
WP_102140744.1|1090946_1091858_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	67.4	6.2e-108
WP_102140743.1|1091850_1092462_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	64.8	1.3e-72
WP_102140742.1|1092458_1094150_+	hypothetical protein	NA	M1TAS6	Escherichia_phage	35.5	1.0e-71
WP_116068749.1|1094149_1094770_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	41.7	5.7e-36
WP_116068747.1|1094893_1096066_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	72.7	1.5e-167
WP_036962042.1|1096068_1096584_+|tail	phage major tail tube protein	tail	Q37845	Escherichia_phage	58.7	1.5e-50
WP_036962040.1|1096593_1096902_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	56.5	2.9e-17
WP_036962273.1|1096916_1097036_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	66.7	7.2e-09
WP_116068745.1|1097028_1099728_+|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	38.3	4.8e-124
WP_102140782.1|1099730_1100177_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	63.4	1.1e-41
WP_102140783.1|1100173_1101271_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	60.6	1.7e-115
WP_102140784.1|1101342_1101561_+	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	70.3	2.8e-22
WP_102140785.1|1101593_1102229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114365413.1|1102563_1103022_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	33.1	1.5e-14
1102391:1102410	attR	AAAAGACCGCCTAGGCGGTC	NA	NA	NA	NA
WP_168222831.1|1103134_1104247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102140649.1|1104359_1105361_+	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.3	1.3e-13
WP_102140634.1|1105363_1106140_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_102140635.1|1106259_1107405_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	26.8	1.7e-33
WP_102140636.1|1107404_1108397_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	33.4	3.3e-38
WP_102140637.1|1108396_1110382_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	26.9	5.7e-21
WP_102140638.1|1110381_1111275_+	4-deoxy-4-formamido-L-arabinose- phosphoundecaprenol deformylase	NA	NA	NA	NA	NA
WP_102140639.1|1111282_1112941_+	lipid IV(A) 4-amino-4-deoxy-L-arabinosyltransferase	NA	NA	NA	NA	NA
WP_102140640.1|1112937_1113285_+	EamA family transporter	NA	NA	NA	NA	NA
WP_102140641.1|1113281_1113689_+	4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnF	NA	NA	NA	NA	NA
WP_102140642.1|1113771_1114260_+	endopeptidase	NA	NA	NA	NA	NA
WP_102140643.1|1114323_1115340_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_004910390.1|1115576_1115948_-	helix-turn-helix domain-containing protein	NA	D0R0F8	Streptococcus_phage	36.4	1.0e-08
WP_102140644.1|1116830_1117880_-	hemin-degrading factor	NA	NA	NA	NA	NA
WP_102140645.1|1118002_1120159_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_102140646.1|1120531_1121581_-	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	47.1	1.4e-82
WP_102140647.1|1121704_1122568_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_102140648.1|1122830_1125209_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.2	1.0e-173
WP_102140845.1|1125341_1126038_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	46.8	2.6e-61
>prophage 4
NZ_CP031123	Providencia sp. WCHPHu000369 strain WCHPr000369 chromosome, complete genome	4573616	1243711	1356376	4573616	portal,protease,transposase,tail,holin,terminase,tRNA	Enterobacteria_phage(22.22%)	116	NA	NA
WP_102140450.1|1243711_1244974_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_004264135.1|1245005_1246088_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	40.0	3.3e-07
WP_102140451.1|1246087_1246921_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_102140468.1|1246943_1247753_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_102140452.1|1247799_1248654_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.4	3.4e-47
WP_102140453.1|1248666_1249569_+	TIGR01212 family radical SAM protein	NA	NA	NA	NA	NA
WP_102140454.1|1249589_1250324_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_102140455.1|1250373_1252107_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.8	5.3e-31
WP_102140456.1|1252389_1252791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102140457.1|1252771_1254130_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_102140458.1|1254396_1256163_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_102140459.1|1256172_1256796_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_102140460.1|1257039_1257843_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_102140461.1|1257996_1258947_+	4-hydroxyproline epimerase	NA	NA	NA	NA	NA
WP_102140462.1|1258956_1260204_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_102140463.1|1260221_1261088_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_102140464.1|1261096_1262581_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_102140465.1|1262668_1264189_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_102140466.1|1264622_1265564_+	glyoxylate/hydroxypyruvate reductase GhrA	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	27.1	3.4e-08
WP_102140680.1|1268266_1268995_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	60.3	4.3e-75
WP_102140681.1|1268958_1269171_-	excisionase	NA	I6PBM8	Cronobacter_phage	63.9	1.1e-18
WP_102140682.1|1269819_1270503_-	hypothetical protein	NA	H2BDG4	Pseudomonas_virus	48.1	1.7e-46
WP_102140683.1|1270515_1271292_-	hypothetical protein	NA	A0A248SL66	Klebsiella_phage	39.5	8.9e-39
WP_102140684.1|1271375_1272278_-	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	52.5	1.4e-80
WP_102140685.1|1272428_1272620_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	51.0	7.6e-08
WP_102140686.1|1272721_1272973_+	bssS family protein	NA	NA	NA	NA	NA
WP_168222819.1|1272896_1273193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102140687.1|1273221_1273431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102140688.1|1273586_1274258_-	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	56.2	3.8e-62
WP_102140689.1|1274330_1274525_+	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	64.9	3.8e-15
WP_102140690.1|1274562_1275021_+	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	64.0	4.7e-48
WP_168222832.1|1275104_1275281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102140692.1|1275246_1275450_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_102140693.1|1275458_1276508_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	63.6	7.3e-60
WP_102140705.1|1276507_1276753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102140706.1|1276800_1277457_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	64.8	5.2e-80
WP_102140694.1|1277458_1277911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102140695.1|1277907_1278090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102140696.1|1278082_1278466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102140697.1|1278450_1278837_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	52.5	2.8e-25
WP_102140698.1|1278833_1279373_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	52.9	1.1e-46
WP_102140699.1|1279404_1279956_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	43.8	9.8e-32
WP_102140700.1|1280064_1280982_-	hypothetical protein	NA	A0A1B5FPB0	Escherichia_phage	54.0	3.3e-32
WP_102140701.1|1281081_1281501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004911666.1|1281719_1281944_+|holin	holin protein	holin	H9C183	Pectobacterium_phage	68.7	3.3e-18
WP_102140702.1|1281924_1282491_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	62.7	3.3e-51
WP_102140703.1|1282549_1283044_+	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	47.9	2.8e-30
WP_102140851.1|1284452_1284956_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	55.6	2.8e-41
WP_116068743.1|1284952_1287070_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	70.2	1.5e-285
WP_102140841.1|1287066_1287282_+	hypothetical protein	NA	K7PMB5	Enterobacterial_phage	58.6	3.2e-15
WP_116068741.1|1287278_1288784_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	67.0	3.2e-194
WP_148241612.1|1288821_1290792_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	62.9	4.3e-239
WP_102140800.1|1290877_1291225_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	39.8	3.8e-13
WP_102140801.1|1291228_1291525_+	ATP-binding protein	NA	Q8VNN4	Enterobacteria_phage	42.7	5.5e-13
WP_102140843.1|1291508_1292066_+|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	43.4	1.1e-33
WP_116068737.1|1292065_1292464_+|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	48.9	6.0e-31
WP_102140821.1|1292475_1292988_+|tail	phage tail protein	tail	O64327	Escherichia_phage	61.2	1.0e-54
WP_102140822.1|1293351_1293753_+	hypothetical protein	NA	Q9B021	Phage_GMSE-1	76.8	9.3e-16
WP_116068664.1|1293847_1294231_+	hypothetical protein	NA	A5LH36	Enterobacteria_phage	32.3	2.1e-09
WP_096863918.1|1294254_1294569_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	48.0	1.2e-15
WP_116068734.1|1294543_1297513_+|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	35.4	8.2e-117
WP_168222833.1|1297557_1297887_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	41.3	7.7e-16
WP_102140751.1|1297963_1298833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096863838.1|1298930_1299170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096863839.1|1299224_1299923_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	54.7	6.7e-70
WP_096863840.1|1299931_1300660_+	C40 family peptidase	NA	A0A0P0ZDJ9	Stx2-converting_phage	61.6	5.7e-88
WP_116068731.1|1300563_1301220_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	50.0	3.2e-53
WP_102140733.1|1301222_1304921_+	DUF1983 domain-containing protein	NA	A0A0K2FI38	Escherichia_phage	54.1	2.0e-266
WP_102140732.1|1304917_1306006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168222834.1|1306014_1306170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116068728.1|1306234_1307800_+	hypothetical protein	NA	A0A1S6KUV1	Providencia_phage	37.0	6.2e-47
WP_102140246.1|1307857_1308358_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_102140247.1|1308568_1308979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102140248.1|1308978_1309599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102140249.1|1310170_1310731_-	lipoprotein	NA	NA	NA	NA	NA
WP_102140250.1|1310769_1311975_-	multidrug efflux MFS transporter MdtH	NA	NA	NA	NA	NA
WP_102140251.1|1312368_1312956_+	ribosomal protein S5-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_102140252.1|1313039_1314578_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_102140253.1|1315173_1315746_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	55.8	2.0e-51
WP_102140254.1|1315767_1317498_-|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	34.6	8.8e-87
WP_102140255.1|1317666_1318221_+	VOC family protein	NA	NA	NA	NA	NA
WP_102140256.1|1318402_1319164_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_102140257.1|1321889_1322507_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	64.4	1.0e-85
WP_102140258.1|1322508_1323285_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	42.4	3.3e-41
WP_102140259.1|1323346_1324318_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_102140260.1|1324320_1325070_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	NA	NA	NA	NA
WP_102140261.1|1325201_1325600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102140262.1|1325749_1326154_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_102140263.1|1326262_1326586_-	DUF4377 domain-containing protein	NA	NA	NA	NA	NA
WP_102140264.1|1327096_1328866_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	24.2	7.8e-22
WP_102140265.1|1328871_1329303_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_102140266.1|1329333_1330077_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_102140267.1|1330260_1330782_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	30.2	3.4e-10
WP_102140268.1|1330944_1331562_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_102140269.1|1331578_1332589_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	27.7	1.1e-07
WP_102140270.1|1332694_1333480_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_004910688.1|1333472_1334240_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	32.2	2.1e-16
WP_102140271.1|1334316_1335276_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_102140272.1|1335296_1336637_+	murein DD-endopeptidase MepM	NA	Q8SBN9	Clostridium_phage	39.1	8.2e-16
WP_102140273.1|1336755_1337730_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_102140274.1|1338981_1339839_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_102140275.1|1340000_1340549_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_102140276.1|1340606_1341269_+	molecular chaperone	NA	NA	NA	NA	NA
WP_102140277.1|1341280_1343767_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_102140278.1|1343775_1344792_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_102140279.1|1344949_1345378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102140280.1|1345431_1346874_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_102140281.1|1347073_1347919_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_102140282.1|1348391_1349867_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	3.3e-82
WP_102140283.1|1349970_1350819_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_042843885.1|1351453_1351882_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_004254980.1|1351883_1352216_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_102140284.1|1352498_1352846_-	RidA family protein	NA	NA	NA	NA	NA
WP_102140285.1|1352997_1354923_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.6	4.1e-85
WP_102140286.1|1355017_1355716_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_114365413.1|1355917_1356376_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	33.1	1.5e-14
>prophage 5
NZ_CP031123	Providencia sp. WCHPHu000369 strain WCHPr000369 chromosome, complete genome	4573616	1418223	1470400	4573616	head,transposase,tail,plate,integrase,capsid,terminase	Pseudomonas_phage(21.05%)	62	1464850:1464864	1473891:1473905
WP_114365413.1|1418223_1418682_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	33.1	1.5e-14
WP_102140679.1|1418986_1419490_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	65.9	5.9e-60
WP_102140667.1|1422490_1423621_-	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_102140668.1|1423878_1424481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102140669.1|1424491_1425607_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	26.1	9.5e-34
WP_102140670.1|1426909_1428058_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	65.3	1.5e-130
WP_102140671.1|1428103_1428352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102140672.1|1428356_1429640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102140673.1|1429950_1431411_+	ATP-binding protein	NA	E5E3R2	Burkholderia_phage	23.2	1.4e-08
WP_102140674.1|1431742_1432288_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_102140675.1|1432373_1432979_+	thiamine biosynthesis protein ThiJ	NA	NA	NA	NA	NA
WP_102140676.1|1433420_1434398_+	DUF1852 domain-containing protein	NA	NA	NA	NA	NA
WP_102140677.1|1434427_1435459_+	methionine synthase	NA	NA	NA	NA	NA
WP_102140678.1|1435631_1435979_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_102140723.1|1436564_1437182_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	39.8	6.4e-32
WP_102140730.1|1437181_1437880_-|tail	phage tail protein	tail	A0A219YBC2	Aeromonas_phage	46.8	2.3e-30
WP_102140724.1|1438643_1439207_-	DUF2313 domain-containing protein	NA	F6MIL7	Haemophilus_phage	40.9	8.8e-36
WP_102140725.1|1439203_1440265_-|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	46.2	4.4e-81
WP_102140726.1|1440264_1440615_-	hypothetical protein	NA	F6MIL5	Haemophilus_phage	56.4	6.0e-27
WP_102140727.1|1440684_1441338_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	46.2	2.1e-49
WP_102140728.1|1441348_1442599_-|tail	phage tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	36.9	2.7e-69
WP_116068726.1|1442582_1444007_-	multidrug DMT transporter permease	NA	A0A0M3LQ21	Mannheimia_phage	27.2	1.1e-34
WP_102140780.1|1444003_1446277_-|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	31.4	1.6e-64
WP_102140781.1|1446455_1446812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116068724.1|1446811_1447189_-|tail	phage tail protein	tail	A0A0M3LRV6	Mannheimia_phage	55.4	3.3e-31
WP_116068722.1|1447197_1448619_-|tail	phage tail protein	tail	B7SDP8	Haemophilus_phage	46.3	5.0e-104
WP_102140764.1|1448615_1448801_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_102140766.1|1448797_1449403_-	DUF1834 family protein	NA	NA	NA	NA	NA
WP_102140763.1|1449447_1449876_-	DUF1320 domain-containing protein	NA	B7SDP4	Haemophilus_phage	37.4	1.4e-17
WP_102140762.1|1449887_1450235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116068720.1|1450234_1451143_-|head	head protein	head	A0A2H4J778	uncultured_Caudovirales_phage	66.6	2.3e-110
WP_116068716.1|1451156_1451549_-	hypothetical protein	NA	A0A0U5KRP3	unidentified_phage	47.7	1.6e-20
WP_116068713.1|1451552_1452653_-	hypothetical protein	NA	A0A2D1GNS3	Pseudomonas_phage	43.9	9.9e-68
WP_102140771.1|1452869_1453409_-	phage virion morphogenesis protein	NA	J9SNH3	Pseudomonas_phage	37.2	5.3e-22
WP_102140772.1|1453416_1454574_-|capsid	minor capsid protein	capsid	Q6QIB9	Burkholderia_phage	46.2	2.0e-63
WP_116068711.1|1454560_1456141_-	DUF935 domain-containing protein	NA	A0A0M5MS00	Ralstonia_phage	45.5	8.8e-126
WP_102140786.1|1456150_1457782_-|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	63.6	9.2e-195
WP_102140787.1|1457835_1458336_+	hypothetical protein	NA	K7P861	Enterobacteria_phage	27.7	3.4e-07
WP_112307074.1|1458637_1459138_-	DUF1804 family protein	NA	I6PBD1	Pseudomonas_phage	54.2	4.1e-45
WP_102140862.1|1459140_1459389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116068708.1|1459385_1459613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116068706.1|1459609_1460167_-	hypothetical protein	NA	S4TTP1	Salmonella_phage	40.2	3.1e-17
WP_102140802.1|1460163_1460727_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	61.9	1.5e-59
WP_102140805.1|1460728_1460977_-	potassium channel protein	NA	A0A2H4FNF0	Salmonella_phage	45.0	8.1e-10
WP_102140804.1|1461222_1461681_-	mor transcription activator family protein	NA	NA	NA	NA	NA
WP_102140820.1|1461771_1462218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168222835.1|1462225_1462657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102140818.1|1462637_1463066_-	regulatory protein GemA	NA	A0A2D1GNN4	Pseudomonas_phage	58.6	1.9e-38
WP_116068704.1|1463065_1463449_-	hypothetical protein	NA	H9C172	Pectobacterium_phage	35.0	2.1e-09
WP_116068702.1|1463445_1463877_-	hypothetical protein	NA	M4MHH2	Vibrio_phage	42.3	5.5e-22
WP_102140815.1|1463863_1464178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102140814.1|1464170_1464623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102140813.1|1464715_1464910_-	hypothetical protein	NA	A0A2D1GNV5	Pseudomonas_phage	52.6	9.7e-11
1464850:1464864	attL	AAATGAAGGTATGAC	NA	NA	NA	NA
WP_102140812.1|1464881_1465079_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_116068699.1|1465080_1465719_-	DUF3164 family protein	NA	Q6QIE4	Burkholderia_phage	66.7	1.3e-72
WP_102140852.1|1465708_1465900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112307088.1|1465908_1466184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168222836.1|1466195_1466366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102140834.1|1466374_1467268_-	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	55.8	8.9e-91
WP_116068697.1|1467280_1469329_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	47.7	2.4e-176
WP_102140360.1|1469340_1469619_-	transcriptional regulator	NA	M1PVU4	Vibrio_phage	49.2	5.7e-12
WP_102140359.1|1469782_1470400_+	helix-turn-helix transcriptional regulator	NA	L7P7S1	Pseudomonas_phage	37.2	3.2e-07
1473891:1473905	attR	GTCATACCTTCATTT	NA	NA	NA	NA
>prophage 6
NZ_CP031123	Providencia sp. WCHPHu000369 strain WCHPr000369 chromosome, complete genome	4573616	1744284	1844950	4573616	head,transposase,tail,plate,capsid,integrase,terminase,tRNA	Pseudomonas_phage(15.91%)	102	1753232:1753247	1809111:1809126
WP_102138713.1|1744284_1744878_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_089110956.1|1744899_1745295_+	S-adenosylhomocysteine hydrolase	NA	NA	NA	NA	NA
WP_004393990.1|1745400_1746009_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_102138714.1|1746005_1747157_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_089110954.1|1747153_1748359_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014611607.1|1748360_1749071_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	3.7e-31
WP_102138715.1|1751580_1752357_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_004394002.1|1752367_1752541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102138716.1|1752799_1753987_-|integrase	site-specific integrase	integrase	T1S9J3	Salmonella_phage	55.5	2.2e-121
1753232:1753247	attL	AAAGTTAATTTCACTC	NA	NA	NA	NA
WP_102138735.1|1754294_1755872_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_102138717.1|1755957_1757424_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.3	1.8e-88
WP_102138718.1|1757595_1758963_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.4	1.1e-36
WP_102138719.1|1759680_1760298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102138720.1|1760481_1760736_+	transcriptional regulator	NA	M1PVU4	Vibrio_phage	58.3	6.3e-18
WP_116068692.1|1760716_1762759_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	48.4	1.5e-178
WP_102140833.1|1762771_1763665_+	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	55.8	1.8e-91
WP_102140832.1|1763673_1763859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116068690.1|1763867_1764143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102140852.1|1764151_1764343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116068688.1|1764332_1764971_+	DUF3164 family protein	NA	Q6QIE4	Burkholderia_phage	66.7	1.0e-72
WP_102140807.1|1764972_1765170_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_102140813.1|1765141_1765336_+	hypothetical protein	NA	A0A2D1GNV5	Pseudomonas_phage	52.6	9.7e-11
WP_102140808.1|1765431_1765689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102140809.1|1765675_1765906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102140810.1|1765898_1766213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116068686.1|1766199_1766631_+	hypothetical protein	NA	M4MHH2	Vibrio_phage	43.1	8.5e-23
WP_116068684.1|1766627_1767011_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	34.2	1.1e-08
WP_102140823.1|1767010_1767439_+	regulatory protein GemA	NA	A0A2D1GNN4	Pseudomonas_phage	60.0	3.8e-39
WP_168222843.1|1767419_1767851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102140825.1|1767863_1768205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102140804.1|1768295_1768754_+	mor transcription activator family protein	NA	NA	NA	NA	NA
WP_102140805.1|1768999_1769248_+	potassium channel protein	NA	A0A2H4FNF0	Salmonella_phage	45.0	8.1e-10
WP_102140802.1|1769249_1769813_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	61.9	1.5e-59
WP_102140803.1|1769809_1770367_+	hypothetical protein	NA	S4TTP1	Salmonella_phage	39.6	2.0e-16
WP_148241595.1|1770363_1770591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102140862.1|1770587_1770836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112307074.1|1770838_1771339_+	DUF1804 family protein	NA	I6PBD1	Pseudomonas_phage	54.2	4.1e-45
WP_102140796.1|1771331_1771544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102140795.1|1771549_1773181_+|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	62.8	1.6e-191
WP_116068682.1|1773190_1774771_+	DUF935 domain-containing protein	NA	A0A0M5MS00	Ralstonia_phage	45.1	7.5e-125
WP_102140775.1|1774757_1775915_+|capsid	minor capsid protein	capsid	Q6QIB9	Burkholderia_phage	46.8	9.2e-64
WP_102140774.1|1775922_1776462_+	phage virion morphogenesis protein	NA	J9SNH3	Pseudomonas_phage	36.6	2.0e-21
WP_116068838.1|1776678_1777779_+	hypothetical protein	NA	A0A2D1GNS3	Pseudomonas_phage	44.5	2.6e-68
WP_102140830.1|1777782_1778175_+	hypothetical protein	NA	A0A0U5KRP3	unidentified_phage	46.9	2.1e-20
WP_116068680.1|1778188_1779097_+|head	head protein	head	A0A2H4J778	uncultured_Caudovirales_phage	66.6	2.3e-110
WP_102140767.1|1779096_1779444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102140768.1|1779455_1779884_+	DUF1320 domain-containing protein	NA	B7SDP4	Haemophilus_phage	36.0	3.1e-17
WP_102140769.1|1779877_1780534_+	DUF1834 family protein	NA	A0A0M3LQJ7	Mannheimia_phage	35.1	1.3e-22
WP_102140764.1|1780530_1780716_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_116068678.1|1780712_1782134_+|tail	phage tail protein	tail	B7SDP8	Haemophilus_phage	46.5	5.9e-105
WP_112307064.1|1782142_1782520_+|tail	phage tail protein	tail	A0A0M3LRV6	Mannheimia_phage	56.2	3.3e-31
WP_102140778.1|1782519_1782876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102140777.1|1783054_1785343_+|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	34.0	9.6e-65
WP_116068676.1|1785339_1786764_+	multidrug DMT transporter permease	NA	A0A0M3LQ21	Mannheimia_phage	27.0	2.5e-34
WP_102140728.1|1786747_1787998_+|tail	phage tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	36.9	2.7e-69
WP_102140727.1|1788008_1788662_+|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	46.2	2.1e-49
WP_102140726.1|1788731_1789082_+	hypothetical protein	NA	F6MIL5	Haemophilus_phage	56.4	6.0e-27
WP_102140725.1|1789081_1790143_+|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	46.2	4.4e-81
WP_102140724.1|1790139_1790703_+	DUF2313 domain-containing protein	NA	F6MIL7	Haemophilus_phage	40.9	8.8e-36
WP_102140730.1|1791466_1792165_+|tail	phage tail protein	tail	A0A219YBC2	Aeromonas_phage	46.8	2.3e-30
WP_102140723.1|1792164_1792782_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	39.8	6.4e-32
WP_102139846.1|1794888_1797021_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_102139845.1|1797033_1797837_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_168222844.1|1797982_1798849_-	iron-regulated protein	NA	NA	NA	NA	NA
WP_102139844.1|1798968_1801248_-	NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase	NA	NA	NA	NA	NA
WP_102139843.1|1801787_1802408_+	response regulator	NA	NA	NA	NA	NA
WP_168222845.1|1802553_1802925_+	ArsC family reductase	NA	NA	NA	NA	NA
WP_102139842.1|1802938_1804069_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_102139841.1|1804065_1804734_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_102139840.1|1804788_1805181_-	DUF454 family protein	NA	NA	NA	NA	NA
WP_102139839.1|1805694_1807716_-|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
WP_102139838.1|1807723_1808176_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_102139837.1|1808753_1809179_+	DNA-binding protein	NA	NA	NA	NA	NA
1809111:1809126	attR	AAAGTTAATTTCACTC	NA	NA	NA	NA
WP_102139836.1|1809215_1809797_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_168222846.1|1809797_1810502_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_102139835.1|1810492_1811356_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_102139834.1|1811342_1812143_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.5	4.6e-14
WP_102139833.1|1812216_1812930_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	34.8	1.7e-36
WP_102139848.1|1813351_1813984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102139832.1|1814191_1815247_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_102139831.1|1815263_1816172_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_102139830.1|1816459_1817017_+	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
WP_004253548.1|1817031_1817502_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_102139829.1|1817549_1818614_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_102139828.1|1818808_1820272_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_102139827.1|1820284_1820641_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_102139826.1|1820684_1821404_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_102139825.1|1821513_1822809_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.0	1.5e-62
WP_004253541.1|1822907_1823534_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_102139824.1|1823886_1824927_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	42.6	1.2e-70
WP_102139823.1|1824926_1825565_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	40.6	1.5e-28
WP_102139822.1|1825801_1826389_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_102139821.1|1826443_1828513_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_102139820.1|1828517_1830047_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_102139819.1|1830233_1831694_+	magnesium transporter	NA	NA	NA	NA	NA
WP_102139818.1|1832279_1833632_+	MFS transporter	NA	NA	NA	NA	NA
WP_102139817.1|1833880_1835125_+	MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_102139816.1|1835124_1838247_+	MdtB/MuxB family multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_102139815.1|1838246_1841348_+	multidrug efflux RND transporter permease subunit MdtC	NA	NA	NA	NA	NA
WP_102139814.1|1841337_1842726_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.8	9.1e-34
WP_102139813.1|1842722_1843436_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	34.5	3.9e-33
WP_102139812.1|1843564_1844950_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	83.5	1.3e-181
>prophage 7
NZ_CP031123	Providencia sp. WCHPHu000369 strain WCHPr000369 chromosome, complete genome	4573616	1870394	1912167	4573616	portal,protease,transposase,tail,holin,integrase,terminase	Enterobacteria_phage(29.73%)	57	1870259:1870283	1913253:1913277
1870259:1870283	attL	GAGTTTTGCAGAAGAATTTTTCTAG	NA	NA	NA	NA
WP_114365413.1|1870394_1870853_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	33.1	1.5e-14
WP_102140790.1|1871450_1872209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102140789.1|1872676_1873015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116068674.1|1873180_1873294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168222834.1|1874835_1874991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102140732.1|1874999_1876088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102140733.1|1876084_1879783_-	DUF1983 domain-containing protein	NA	A0A0K2FI38	Escherichia_phage	54.1	2.0e-266
WP_116068671.1|1879785_1880442_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	50.5	4.9e-54
WP_116068668.1|1880345_1881074_-	C40 family peptidase	NA	A0A0P0ZDJ9	Stx2-converting_phage	60.3	5.9e-85
WP_102140756.1|1881082_1881781_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	54.3	2.6e-69
WP_102140757.1|1881834_1882134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102140758.1|1882282_1882627_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	41.6	6.8e-15
WP_116068666.1|1882654_1885651_-|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	35.7	1.4e-119
WP_102140847.1|1885625_1885940_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	48.0	1.2e-15
WP_116068664.1|1885963_1886347_-	hypothetical protein	NA	A5LH36	Enterobacteria_phage	32.3	2.1e-09
WP_096863834.1|1886390_1886903_-	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	39.5	9.7e-26
WP_096863833.1|1887107_1887620_-|tail	phage tail protein	tail	O64327	Escherichia_phage	63.1	1.8e-56
WP_096863832.1|1887631_1888030_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	48.9	6.0e-31
WP_102140843.1|1888029_1888587_-|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	43.4	1.1e-33
WP_096863830.1|1888570_1888867_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	46.0	8.1e-17
WP_102140798.1|1888870_1889218_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	39.8	4.9e-13
WP_148241613.1|1889300_1891280_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	63.4	7.2e-234
WP_116068658.1|1891317_1892823_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	66.4	6.7e-192
WP_102140840.1|1892819_1893035_-	hypothetical protein	NA	K7PMB5	Enterobacterial_phage	57.1	4.2e-15
WP_116068656.1|1893031_1895149_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	66.0	8.9e-283
WP_102140851.1|1895145_1895649_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	55.6	2.8e-41
WP_102137782.1|1896034_1896298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102137781.1|1896294_1896633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102137780.1|1896691_1896889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102137779.1|1897159_1897693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102137778.1|1897733_1898225_-	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	44.9	1.6e-25
WP_102137777.1|1898283_1898853_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	62.7	3.0e-52
WP_004911666.1|1898833_1899058_-|holin	holin protein	holin	H9C183	Pectobacterium_phage	68.7	3.3e-18
WP_102137776.1|1899182_1900241_-	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	71.0	5.3e-143
WP_102137775.1|1900374_1900575_-	TrmB family transcriptional regulator	NA	Q8SBE3	Shigella_phage	58.8	1.8e-07
WP_102137774.1|1900758_1901424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102137773.1|1901446_1901989_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	58.6	3.7e-39
WP_102137772.1|1901985_1902780_-	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	64.3	1.8e-90
WP_102137771.1|1902819_1903005_-	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_102137770.1|1903001_1903382_-	hypothetical protein	NA	A0A1W6JP80	Morganella_phage	61.4	8.2e-38
WP_102137769.1|1903374_1903671_-	hypothetical protein	NA	V9SHM3	Achromobacter_phage	54.9	1.8e-24
WP_102137768.1|1903667_1904015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102137767.1|1904011_1904545_-	phage N-6-adenine-methyltransferase	NA	Q4A1M4	Enterobacteria_phage	65.3	2.5e-64
WP_102137766.1|1904544_1904790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102137765.1|1904789_1905851_-	replication protein	NA	A0A248SL49	Klebsiella_phage	44.9	1.0e-29
WP_102137764.1|1905847_1906030_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_154638958.1|1906022_1906229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102137762.1|1906309_1906768_-	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	64.0	1.8e-47
WP_102137761.1|1906844_1907081_-	cytoplasmic chaperone TorD	NA	NA	NA	NA	NA
WP_102137760.1|1907204_1907891_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	41.1	1.3e-41
WP_102137759.1|1908169_1908391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102137808.1|1908423_1908612_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	62.7	5.9e-13
WP_102137758.1|1908804_1909176_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	69.2	8.3e-43
WP_102137757.1|1909236_1910064_+	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	54.7	1.1e-82
WP_102137756.1|1910168_1910744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102137755.1|1910813_1911056_+	excisionase	NA	NA	NA	NA	NA
WP_102137754.1|1911039_1912167_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	57.6	2.0e-124
1913253:1913277	attR	GAGTTTTGCAGAAGAATTTTTCTAG	NA	NA	NA	NA
>prophage 8
NZ_CP031123	Providencia sp. WCHPHu000369 strain WCHPr000369 chromosome, complete genome	4573616	2611789	2627637	4573616	integrase	Morganella_phage(70.0%)	22	2605281:2605300	2627669:2627688
2605281:2605300	attL	ATGCCCCCAATTATGCCCCC	NA	NA	NA	NA
WP_102139347.1|2611789_2615122_-	hypothetical protein	NA	A0A1W6JNU2	Morganella_phage	27.9	7.2e-37
WP_102139348.1|2615135_2615474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102139349.1|2615473_2615647_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_102139350.1|2615827_2616337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102139439.1|2616411_2616804_-	ProQ/FinO family protein	NA	A0A1W6JPI6	Morganella_phage	61.8	1.8e-16
WP_102139351.1|2617272_2620008_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	70.4	0.0e+00
WP_102139352.1|2619994_2620369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102139353.1|2620369_2620564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004255426.1|2620563_2620737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102139354.1|2620733_2621318_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	58.0	3.1e-28
WP_004906529.1|2621314_2621524_-	hypothetical protein	NA	A0A1W6JPF1	Morganella_phage	50.7	1.8e-10
WP_036960434.1|2621520_2621700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102139355.1|2621696_2621888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102139356.1|2621890_2622064_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_102139440.1|2622056_2622281_-	host cell division inhibitor Icd-like protein	NA	A0A1W6JPK3	Morganella_phage	54.0	1.7e-11
WP_102139357.1|2622423_2622615_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_102139358.1|2623315_2623912_-	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	70.2	6.6e-74
WP_094960712.1|2623924_2624320_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	52.1	7.8e-31
WP_036951665.1|2624319_2624538_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	45.3	6.6e-08
WP_102139441.1|2624662_2625418_-	protein kinase	NA	NA	NA	NA	NA
WP_102139359.1|2625413_2626214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102139360.1|2626425_2627637_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.4	5.0e-129
2627669:2627688	attR	ATGCCCCCAATTATGCCCCC	NA	NA	NA	NA
>prophage 9
NZ_CP031123	Providencia sp. WCHPHu000369 strain WCHPr000369 chromosome, complete genome	4573616	3585441	3689533	4573616	portal,protease,head,transposase,plate,tail,holin,capsid,terminase,integrase,tRNA	Salmonella_phage(41.46%)	106	3621582:3621610	3698566:3698594
WP_102140395.1|3585441_3586539_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_102140396.1|3586607_3586997_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_004265350.1|3587009_3587666_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_102140397.1|3588128_3589526_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_102140398.1|3589604_3590510_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_102140399.1|3591621_3591975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102140400.1|3592038_3593415_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_102140401.1|3593493_3594714_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_102140402.1|3594758_3595535_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_102140403.1|3595549_3596554_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_102140404.1|3596656_3597811_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_102140405.1|3598040_3598925_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_102140406.1|3599592_3600993_+	glutamate decarboxylase	NA	NA	NA	NA	NA
WP_102140407.1|3601105_3602659_+	glutamate:gamma-aminobutyrate antiporter	NA	NA	NA	NA	NA
WP_102140408.1|3602727_3605367_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_102140409.1|3605770_3608212_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_102140410.1|3608224_3609385_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_004265315.1|3609700_3610018_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_102140411.1|3610386_3611100_+	porin family protein	NA	NA	NA	NA	NA
WP_004265313.1|3611187_3611403_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_102140412.1|3611621_3613820_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_102140413.1|3614161_3615190_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_102140414.1|3615263_3616070_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_004265304.1|3616239_3616770_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_102140415.1|3616781_3618116_+	HslU--HslV peptidase ATPase subunit	NA	A0A173GFL6	Erwinia_phage	28.0	1.1e-41
WP_102140416.1|3618303_3619227_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_102140417.1|3619346_3619871_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_004265299.1|3620480_3620720_-	cell division protein ZapB	NA	NA	NA	NA	NA
3621582:3621610	attL	GGTCACGTATCCAAAGGGTTGATGGCATT	NA	NA	NA	NA
WP_102140845.1|3621610_3622308_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	46.8	2.6e-61
WP_102140630.1|3622683_3624210_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_102140629.1|3624440_3628250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102140628.1|3628292_3629477_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	26.2	8.9e-14
WP_102140627.1|3629954_3630701_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_004907027.1|3630758_3631178_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_102140632.1|3631228_3631843_+	DUF1454 family protein	NA	NA	NA	NA	NA
WP_102140626.1|3632021_3632792_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_102140625.1|3633225_3634170_+	OmpG family monomeric porin	NA	NA	NA	NA	NA
WP_102140631.1|3634594_3636475_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_004907017.1|3636600_3637557_+	OmpG family monomeric porin	NA	NA	NA	NA	NA
WP_102140624.1|3637876_3638890_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004265237.1|3639073_3640051_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_102140623.1|3640456_3641401_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_102140622.1|3641397_3642039_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_004907010.1|3642276_3643029_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_102140620.1|3643255_3643837_-	HutD family protein	NA	NA	NA	NA	NA
WP_102140619.1|3643998_3644283_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_102140618.1|3644263_3644545_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_102140617.1|3644904_3645636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102140616.1|3645668_3645887_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	71.9	3.6e-22
WP_116068830.1|3645958_3647056_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	58.9	2.5e-119
WP_102140831.1|3647052_3647499_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	62.6	1.9e-41
WP_116068827.1|3647501_3650201_-|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	39.0	4.2e-128
WP_036962273.1|3650193_3650313_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	66.7	7.2e-09
WP_036962040.1|3650327_3650636_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	56.5	2.9e-17
WP_036962042.1|3650645_3651161_-|tail	phage major tail tube protein	tail	Q37845	Escherichia_phage	58.7	1.5e-50
WP_116068825.1|3651163_3652336_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	72.7	1.0e-166
WP_102140735.1|3652459_3653080_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	39.6	1.5e-28
WP_102140740.1|3653079_3654417_-|tail	phage tail protein	tail	K7P7Q7	Enterobacteria_phage	54.2	2.5e-36
WP_102140736.1|3654782_3655394_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	64.8	5.7e-73
WP_102140737.1|3655386_3656298_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	66.4	2.6e-106
WP_102140738.1|3656300_3656642_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	58.6	1.6e-29
WP_102140739.1|3656638_3657262_-|plate	phage baseplate assembly protein V	plate	O80314	Escherichia_phage	55.0	6.7e-53
WP_116068823.1|3657265_3657649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102140826.1|3657737_3658355_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	39.3	5.4e-31
WP_102140827.1|3658351_3658780_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	45.3	1.4e-25
WP_116068843.1|3658763_3659315_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_116068821.1|3659357_3659801_-	structural protein	NA	A0A193GYI3	Enterobacter_phage	47.1	2.0e-27
WP_036962068.1|3659793_3660099_-|holin	holin	holin	E7C9S8	Salmonella_phage	56.3	2.1e-23
WP_071548739.1|3660102_3660306_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	56.7	1.0e-15
WP_116068819.1|3660302_3660779_-|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	45.7	2.6e-25
WP_116068817.1|3660867_3661500_-	hypothetical protein	NA	A0A077K804	Ralstonia_phage	40.9	8.3e-35
WP_116068815.1|3661527_3662622_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	61.4	1.1e-119
WP_102140817.1|3662634_3663462_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	47.0	3.0e-53
WP_116068813.1|3663620_3665378_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	75.9	3.1e-273
WP_116068811.1|3665377_3666415_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	71.0	1.5e-142
WP_102140503.1|3666933_3667410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102140502.1|3667446_3667680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102140501.1|3667681_3668374_-	hypothetical protein	NA	E5E3S6	Burkholderia_phage	36.9	1.2e-15
WP_102140500.1|3668385_3668649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102140499.1|3668635_3668872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102140498.1|3668868_3671265_-	replication endonuclease	NA	M1SV59	Escherichia_phage	47.1	3.0e-162
WP_102140497.1|3671257_3671581_-	DUF5405 family protein	NA	NA	NA	NA	NA
WP_102140496.1|3671580_3672438_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	E5G6L8	Salmonella_phage	49.5	2.0e-60
WP_053083855.1|3672430_3672733_-	DUF3850 domain-containing protein	NA	A0A2P0W9X8	Enterobacter_phage	39.4	1.3e-06
WP_102140495.1|3672729_3672951_-	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	51.4	1.7e-11
WP_102140494.1|3672943_3673297_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_102140493.1|3673315_3673735_-	DUF5347 family protein	NA	NA	NA	NA	NA
WP_102140492.1|3673751_3674063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102140491.1|3674078_3674240_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_102140490.1|3674244_3674463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102140489.1|3674464_3674755_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	65.6	7.9e-33
WP_102140488.1|3674877_3675177_+	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	55.6	5.5e-21
WP_102140487.1|3675243_3676215_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	66.3	6.2e-122
WP_102140486.1|3676485_3677070_-	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_004265224.1|3677220_3677919_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	29.5	4.0e-06
WP_004906999.1|3677915_3679286_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.7	1.6e-19
WP_102140485.1|3679768_3681208_+	capsule assembly Wzi family protein	NA	NA	NA	NA	NA
WP_102140484.1|3681843_3682098_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_102140483.1|3682103_3683441_+	acyl--CoA ligase	NA	NA	NA	NA	NA
WP_102140482.1|3683433_3684159_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_102140481.1|3684203_3684767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102140480.1|3684810_3685824_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	A0A1V0SAI8	Catovirus	36.6	2.4e-44
WP_102140479.1|3685832_3686993_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2K9L470	Tupanvirus	30.1	1.3e-33
WP_102140478.1|3686996_3687695_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	32.9	3.3e-08
WP_102140477.1|3687685_3688765_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_102140476.1|3688837_3689533_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
3698566:3698594	attR	GGTCACGTATCCAAAGGGTTGATGGCATT	NA	NA	NA	NA
>prophage 10
NZ_CP031123	Providencia sp. WCHPHu000369 strain WCHPr000369 chromosome, complete genome	4573616	3810684	3870069	4573616	transposase,integrase,protease,tRNA	Bacillus_phage(14.29%)	47	3802651:3802667	3876925:3876941
3802651:3802667	attL	AAGCTAAATAATTTTAT	NA	NA	NA	NA
WP_102140064.1|3810684_3811260_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_102140065.1|3811425_3813939_+	penicillin acylase	NA	NA	NA	NA	NA
WP_102140066.1|3813976_3814639_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_102140067.1|3814713_3816123_+	MFS transporter	NA	NA	NA	NA	NA
WP_102140068.1|3816165_3817671_-	MFS transporter	NA	NA	NA	NA	NA
WP_102140069.1|3817766_3818312_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_102140070.1|3818381_3819296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102140071.1|3819414_3820581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001353740.1|3821196_3821436_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_000777554.1|3822932_3823406_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
WP_000704156.1|3823500_3824025_+	streptothricin N-acetyltransferase Sat2	NA	E4ZFP7	Streptococcus_phage	38.9	4.2e-16
WP_001206315.1|3824082_3824871_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_001444089.1|3824946_3825444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000119696.1|3825504_3825876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001271300.1|3826285_3826663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251879.1|3826893_3828510_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001243518.1|3828510_3830037_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001276994.1|3830039_3831707_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000267723.1|3831703_3833812_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001029679.1|3833798_3834620_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_102140418.1|3834780_3836613_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	44.2	7.8e-134
WP_102140419.1|3836819_3838190_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.3	2.1e-35
WP_004906291.1|3838316_3838742_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_102140420.1|3838763_3840146_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_102140421.1|3840180_3841044_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_102140422.1|3841096_3842638_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_102140423.1|3842652_3843186_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_004906301.1|3843198_3843669_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_004093904.1|3843727_3843967_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_042846803.1|3844015_3844834_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_102140424.1|3844867_3845245_-	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_102140425.1|3845843_3846464_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_102140426.1|3846465_3848355_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_102140427.1|3848732_3849173_-	FMN-binding protein MioC	NA	NA	NA	NA	NA
WP_102140428.1|3849264_3849726_-	transcriptional regulator AsnC	NA	NA	NA	NA	NA
WP_102140429.1|3849887_3850880_+	aspartate--ammonia ligase	NA	NA	NA	NA	NA
WP_102140430.1|3850880_3852338_-	ATPase RavA stimulator ViaA	NA	NA	NA	NA	NA
WP_102140431.1|3852340_3853858_-	ATPase RavA	NA	A0A0N9PBE1	Sulfolobus_monocaudavirus	31.3	3.1e-19
WP_102140432.1|3854139_3854559_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_102140433.1|3854566_3856081_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	3.2e-16
WP_102140434.1|3856077_3857040_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_102140435.1|3857058_3857949_+	ribose ABC transporter substrate-binding protein RbsB	NA	NA	NA	NA	NA
WP_102140436.1|3858027_3858957_+	ribokinase	NA	NA	NA	NA	NA
WP_166268174.1|3858960_3859962_+	ribose operon transcriptional repressor RbsR	NA	NA	NA	NA	NA
WP_102140437.1|3859958_3861362_-	multidrug transporter subunit MdtD	NA	NA	NA	NA	NA
WP_102140438.1|3861410_3862109_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_102140835.1|3868916_3870069_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	38.6	7.8e-47
3876925:3876941	attR	AAGCTAAATAATTTTAT	NA	NA	NA	NA
>prophage 11
NZ_CP031123	Providencia sp. WCHPHu000369 strain WCHPr000369 chromosome, complete genome	4573616	4399206	4407712	4573616		Escherichia_phage(50.0%)	8	NA	NA
WP_102139132.1|4399206_4401624_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	36.6	8.1e-139
WP_102139131.1|4401620_4402259_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	55.3	9.5e-63
WP_102139130.1|4402255_4403152_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_102139129.1|4403189_4403756_+	DmsD	NA	A0A077SLS7	Escherichia_phage	31.8	2.3e-15
WP_102139128.1|4403962_4404385_+	DoxX family protein	NA	NA	NA	NA	NA
WP_102139127.1|4404472_4405267_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	43.0	4.7e-43
WP_102139126.1|4405291_4406518_-	RtcB family protein	NA	A0A1V0EEW8	Caulobacter_phage	62.3	4.3e-136
WP_102139190.1|4406521_4407712_-	slipin family protein	NA	A0A2P1EMF1	Moumouvirus	28.3	4.7e-15
>prophage 1
NZ_CP031122	Providencia sp. WCHPHu000369 strain WCHPr000369 plasmid pIMP69_000369, complete sequence	164992	23752	50415	164992	transposase,integrase	Salmonella_phage(33.33%)	23	36260:36290	54221:54251
WP_012372820.1|23752_25285_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001253717.1|25376_26168_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001257840.1|26188_27364_-	tetracycline efflux MFS transporter Tet(G)	NA	NA	NA	NA	NA
WP_000163574.1|27467_28094_+	tetracycline resistance transcriptional repressor TetR(G)	NA	NA	NA	NA	NA
WP_001747812.1|28090_28273_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214125.1|28300_29515_-	chloramphenicol/florfenicol efflux MFS transporter FloR2	NA	S4TR35	Salmonella_phage	23.7	9.8e-16
WP_000259026.1|29731_30703_-	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_000679427.1|30696_31044_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|31207_31999_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_071523897.1|32004_32250_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|32406_32904_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_002075255.1|33048_34062_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_001067855.1|34196_34901_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000101568.1|35033_36074_-	DNA-binding protein	NA	NA	NA	NA	NA
36260:36290	attL	CCGCAGAATTCGGAAAAAATCGTACGCTAAG	NA	NA	NA	NA
WP_001161490.1|39255_39816_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_002075255.1|40159_41173_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_099156051.1|41325_42066_+	subclass B1 metallo-beta-lactamase IMP-69	NA	NA	NA	NA	NA
WP_012695458.1|42164_42719_+	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_003155741.1|42881_43505_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.7	3.7e-35
WP_088244043.1|43566_44784_-	TniQ family protein	NA	NA	NA	NA	NA
WP_028604704.1|44780_45689_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_088244042.1|45691_47410_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	M4T586	Rhodobacter_phage	25.6	8.4e-05
WP_013362812.1|49446_50415_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
54221:54251	attR	CTTAGCGTACGATTTTTTCCGAATTCTGCGG	NA	NA	NA	NA
