The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025425	Enterococcus faecium strain SC4 chromosome, complete genome	2772425	228386	276979	2772425	transposase	Streptococcus_phage(25.0%)	52	NA	NA
WP_002297404.1|228386_229637_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002288246.1|230046_231198_+	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_002294170.1|231324_232083_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288242.1|232182_232827_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_002288240.1|232833_233841_+	sugar kinase	NA	NA	NA	NA	NA
WP_002288239.1|233856_234699_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_002294167.1|234718_235522_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002288234.1|235770_236835_-	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_002288233.1|236831_237917_-	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_002288232.1|237929_238907_-	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_002288231.1|238899_239844_-	mevalonate kinase	NA	NA	NA	NA	NA
WP_002322895.1|240165_240819_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	52.3	1.1e-58
WP_002294163.1|240903_241809_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_002294161.1|241810_242443_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002293357.1|242762_243287_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.3	1.4e-14
WP_002289309.1|243358_243559_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_002289310.1|243611_243971_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_002289312.1|244222_245560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289314.1|245607_247737_+	hydantoinase	NA	NA	NA	NA	NA
WP_002289315.1|247711_248401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289316.1|248808_249495_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002315615.1|249630_249825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289317.1|249874_250315_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_002289318.1|250318_251164_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_002294157.1|251312_252731_+	dipeptidase PepV	NA	NA	NA	NA	NA
WP_002289860.1|252787_253735_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002289862.1|253957_254308_-	peptidase	NA	NA	NA	NA	NA
WP_002294156.1|254507_255587_+	glutamyl aminopeptidase	NA	NA	NA	NA	NA
WP_002287837.1|255730_256051_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_002287838.1|256072_256537_+	universal stress protein	NA	NA	NA	NA	NA
WP_002294153.1|256741_257347_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_002302440.1|257566_258868_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002297218.1|259006_260302_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002294152.1|260408_261698_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.2	5.7e-22
WP_002287841.1|262125_262605_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_002296569.1|262689_263199_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	34.8	2.8e-17
WP_002296570.1|263298_263949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002291914.1|264399_265338_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_002291912.1|265350_266403_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002297185.1|266703_267999_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002296392.1|268190_268826_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_002296391.1|269016_269808_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002326839.1|270287_271196_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002295755.1|271251_271749_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002340421.1|271785_272469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296262.1|272815_273082_+	DUF960 domain-containing protein	NA	NA	NA	NA	NA
WP_002296261.1|273108_273408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296259.1|273581_274133_+	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_002296258.1|274278_274572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002304106.1|274564_274861_+	peptidase	NA	NA	NA	NA	NA
WP_002296256.1|274935_275934_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_000222572.1|276025_276979_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP025425	Enterococcus faecium strain SC4 chromosome, complete genome	2772425	563639	611729	2772425	integrase,transposase	Streptococcus_phage(25.0%)	43	570384:570406	603999:604021
WP_002297218.1|563639_564935_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002287679.1|565246_566020_+	Fe-S cluster assembly ATPase SufC	NA	A0A2R8FG22	Brazilian_cedratvirus	28.8	2.1e-08
WP_002287681.1|566032_567319_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_002287683.1|567315_568551_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	47.7	3.9e-113
WP_002287684.1|568537_569008_+	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_002287686.1|569012_570404_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
570384:570406	attL	ATGGAAGGGTCTGTGGGGTAATA	NA	NA	NA	NA
WP_002287688.1|570501_571644_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	36.3	4.6e-60
WP_101699692.1|571694_572492_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_048945402.1|572688_572991_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_101699693.1|573140_573926_+	helix-turn-helix domain-containing protein	NA	F8J194	Lactobacillus_virus	64.9	7.7e-30
WP_101699694.1|573928_574159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101699695.1|574133_576758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101699696.1|576771_576960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101699697.1|576971_577583_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_101699698.1|577567_578959_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_101699699.1|579173_579476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100970555.1|579468_579963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101699700.1|580039_580342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002322861.1|580452_580701_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_101699701.1|580930_581704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025479813.1|581808_582054_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_100970553.1|582188_584063_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_101699702.1|584059_585874_+	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	27.2	1.7e-43
WP_002287705.1|586392_587535_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	34.8	3.3e-58
WP_002287709.1|587573_588308_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002287723.1|588539_588815_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002287725.1|588912_590910_+	hypothetical protein	NA	A0A1Z1LZK7	Bacillus_phage	23.8	5.2e-22
WP_002287726.1|590985_591321_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002296546.1|591449_591665_+	helix-turn-helix transcriptional regulator	NA	A0A139ZPI6	Marinitoga_camini_virus	41.8	4.7e-06
WP_002287729.1|591701_592067_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_002287730.1|592103_592430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287731.1|592583_593309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287732.1|593818_595411_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	50.9	6.8e-126
WP_002287733.1|595403_596648_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	26.9	3.3e-19
WP_002297404.1|596783_598034_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002287735.1|598444_601594_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_101699703.1|602311_603775_-|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.0	9.0e-125
WP_002288539.1|605087_605753_-	helix-turn-helix domain-containing protein	NA	A0A2I7SCV6	Paenibacillus_phage	47.8	1.1e-05
603999:604021	attR	ATGGAAGGGTCTGTGGGGTAATA	NA	NA	NA	NA
WP_002288541.1|605878_607915_+	DUF1430 domain-containing protein	NA	NA	NA	NA	NA
WP_002291166.1|607918_608557_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.8	5.9e-12
WP_002288545.1|608584_609013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288548.1|609469_610381_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_002296840.1|610541_611729_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
>prophage 3
NZ_CP025425	Enterococcus faecium strain SC4 chromosome, complete genome	2772425	743693	752165	2772425		Streptococcus_phage(66.67%)	9	NA	NA
WP_002294039.1|743693_744338_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.6	4.2e-58
WP_002292340.1|744352_744682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288071.1|744695_745634_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.4	3.3e-35
WP_002288073.1|745669_746494_+	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_002288076.1|746486_746834_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	41.1	5.1e-18
WP_002288078.1|746902_747775_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	60.4	3.1e-88
WP_002294035.1|747883_749005_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_002288081.1|749058_749661_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	58.6	1.7e-53
WP_002288083.1|749975_752165_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	66.6	1.8e-286
>prophage 4
NZ_CP025425	Enterococcus faecium strain SC4 chromosome, complete genome	2772425	805175	884720	2772425	integrase,protease,tRNA,holin,portal,transposase,head,terminase,capsid,tail	Enterococcus_phage(26.32%)	94	860759:860774	864112:864127
WP_002296621.1|805175_807974_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.4	2.1e-74
WP_002286618.1|808022_809549_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	35.3	8.9e-75
WP_002286616.1|809563_810211_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286678.1|810394_810724_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_002286614.1|810900_811629_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_002286612.1|811644_812658_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002286608.1|812657_813935_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.8	5.8e-35
WP_002286607.1|813997_816700_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286606.1|816851_817169_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002286604.1|817198_817519_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002286601.1|817626_819087_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002286598.1|819154_819376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286596.1|819406_819589_+	DUF3188 domain-containing protein	NA	NA	NA	NA	NA
WP_002286592.1|819588_820002_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_002286589.1|820124_821306_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_070828588.1|821836_822976_-|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	47.1	2.6e-95
WP_002296617.1|823274_823910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296616.1|824022_824658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303013.1|824691_825153_-	DUF4429 domain-containing protein	NA	A0A0F6N4L7	Staphylococcus_phage	34.8	4.5e-06
WP_002296613.1|825282_825714_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002296612.1|825731_826052_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SDR1	Streptococcus_phage	40.2	2.0e-13
WP_002290310.1|826350_827127_+	phage antirepressor protein	NA	A0A1Q1PVU2	Staphylococcus_phage	53.8	1.1e-73
WP_002296611.1|827141_827345_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002286573.1|827360_827699_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_002296610.1|827685_827865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286568.1|827907_828378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|828464_829163_+	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286559.1|829340_829682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286557.1|829674_830346_+	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_002286553.1|830351_831038_+	hypothetical protein	NA	C9E2N1	Enterococcus_phage	69.1	3.2e-88
WP_101699704.1|831040_831790_+	helix-turn-helix domain-containing protein	NA	A0A1L2BY83	Clostridium_phage	54.0	1.7e-31
WP_002286696.1|831801_832071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286695.1|832232_832535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296606.1|832531_832693_+	antitoxin	NA	NA	NA	NA	NA
WP_002286694.1|832689_832995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101699705.1|832994_833351_+	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	37.4	4.0e-10
WP_002296604.1|833310_833556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286547.1|833552_833972_+	hypothetical protein	NA	D2IZL0	Enterococcus_phage	54.3	4.1e-30
WP_002286545.1|833968_834526_+	DUF1642 domain-containing protein	NA	A0A0C5KKV2	Enterococcus_phage	36.2	2.8e-10
WP_002286693.1|834522_834819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286542.1|834895_835309_+	autolysin	NA	C9E2P5	Enterococcus_phage	81.0	1.5e-56
WP_002300143.1|835766_836042_-	hypothetical protein	NA	A0A2H4JEH2	uncultured_Caudovirales_phage	45.7	9.9e-17
WP_002311723.1|836495_836702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296600.1|836897_837065_+	thymidylate synthase	NA	NA	NA	NA	NA
WP_002286540.1|837090_837435_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	57.1	3.8e-26
WP_002296599.1|837439_837721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286538.1|837823_838138_+|terminase	terminase	terminase	A0A1S7FYW6	Listeria_phage	37.9	3.3e-08
WP_002286533.1|838115_839810_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	49.6	3.0e-148
WP_002286530.1|839829_841008_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	40.4	5.4e-80
WP_002286527.1|840970_841657_+|protease	Clp protease ClpP	protease	A0A2I6PDD0	Staphylococcus_phage	39.7	1.0e-30
WP_002286525.1|841656_842817_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	50.1	1.8e-99
WP_002286524.1|842826_843702_+	hypothetical protein	NA	D2IYX3	Enterococcus_phage	74.2	5.6e-130
WP_002286523.1|843698_844010_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	42.1	6.3e-12
WP_002286522.1|843999_844353_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_002296598.1|844342_844744_+	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	33.3	1.1e-13
WP_002286516.1|844736_845141_+	hypothetical protein	NA	R4IBU7	Listeria_phage	29.5	6.1e-07
WP_002286512.1|845152_845761_+	hypothetical protein	NA	Q8W5Z9	Listeria_phage	41.1	3.0e-34
WP_002286510.1|845780_846143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305377.1|846145_846328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286502.1|846344_849776_+|tail	phage tail tape measure protein	tail	A0A1D3SNL5	Enterococcus_phage	44.4	3.1e-67
WP_002286500.1|849826_850564_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002296595.1|850573_852865_+	hypothetical protein	NA	A0A1D3SNL1	Enterococcus_phage	30.0	1.6e-88
WP_002286495.1|852888_855015_+	hypothetical protein	NA	A0A060AI60	Enterococcus_phage	40.1	1.4e-62
WP_002286491.1|855177_855624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296594.1|855625_855763_+	XkdX family protein	NA	NA	NA	NA	NA
WP_002286686.1|855800_856094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286683.1|856090_856315_+|holin	holin	holin	NA	NA	NA	NA
WP_002286484.1|856311_857337_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.1e-64
WP_087046766.1|858276_859438_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_002286474.1|860361_860769_+	hypothetical protein	NA	NA	NA	NA	NA
860759:860774	attL	AAAAAAATTAAGGAGA	NA	NA	NA	NA
WP_002296902.1|860782_861184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286473.1|861185_861557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286680.1|861592_861895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286470.1|862143_862344_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9AZR0	Lactococcus_phage	75.7	4.6e-08
WP_002286469.1|862648_863881_-	aminopeptidase	NA	NA	NA	NA	NA
WP_002286467.1|864137_864707_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
864112:864127	attR	AAAAAAATTAAGGAGA	NA	NA	NA	NA
WP_002297963.1|864884_865325_-	flavodoxin	NA	NA	NA	NA	NA
WP_002294533.1|865482_866247_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_045136030.1|866278_867202_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_002331243.1|867277_868417_+	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_002377108.1|868409_869210_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_010721709.1|869209_870037_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_072538645.1|870014_870749_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002286449.1|870848_871715_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.5	3.7e-102
WP_002286442.1|871728_872301_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	49.2	8.3e-42
WP_002296544.1|872322_873351_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	43.2	2.2e-69
WP_002294531.1|873448_874300_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.0	1.3e-38
WP_002296543.1|874334_876368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052679387.1|876411_877692_+	EpaQ family protein	NA	NA	NA	NA	NA
WP_002289081.1|877901_878708_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002296541.1|878719_879940_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	3.3e-11
WP_002296539.1|879929_881516_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002296538.1|881554_883693_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002297271.1|883760_884720_-|transposase	IS30-like element IS6770 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP025425	Enterococcus faecium strain SC4 chromosome, complete genome	2772425	1177327	1186388	2772425		Gordonia_phage(16.67%)	9	NA	NA
WP_002288023.1|1177327_1178623_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.1	4.5e-19
WP_002297115.1|1178802_1179180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288021.1|1179435_1180164_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	41.4	4.6e-45
WP_002295474.1|1180163_1180418_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_002302316.1|1180419_1181091_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_002299012.1|1181091_1183314_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.4	1.1e-150
WP_002299010.1|1183298_1184738_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	2.4e-53
WP_002299008.1|1184769_1185813_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.7	2.7e-62
WP_002302314.1|1185809_1186388_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.4	9.0e-28
>prophage 6
NZ_CP025425	Enterococcus faecium strain SC4 chromosome, complete genome	2772425	1462447	1502298	2772425	transposase,protease	Streptococcus_phage(25.0%)	46	NA	NA
WP_101699712.1|1462447_1463596_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	90.8	1.3e-200
WP_002287522.1|1463612_1464017_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002295138.1|1465133_1465607_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_002295139.1|1465615_1465843_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002347126.1|1466276_1467812_-|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.2	3.3e-125
WP_002295142.1|1468035_1468407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002291278.1|1468662_1468905_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002291274.1|1469852_1470041_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002296677.1|1470054_1470618_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_002300977.1|1470655_1471549_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	46.0	5.2e-59
WP_002296674.1|1471626_1472565_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_002296672.1|1472598_1472949_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_002296671.1|1472981_1473884_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_002296670.1|1473876_1474734_-	glycosyltransferase family 8 protein	NA	A0ZYL4	Archaeal_BJ1_virus	27.1	1.3e-19
WP_002296669.1|1475067_1475877_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002296667.1|1475916_1476414_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_002321681.1|1477058_1477382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296665.1|1477545_1477800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296663.1|1477869_1478115_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002296662.1|1478190_1478556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303842.1|1478616_1479180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002293303.1|1479747_1479948_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	77.3	3.9e-23
WP_002296623.1|1480624_1481920_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002296656.1|1482210_1482924_-	HAD family phosphatase	NA	A0A1D8KPI1	Synechococcus_phage	23.0	5.4e-06
WP_002296654.1|1482916_1484002_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_002296653.1|1484018_1484462_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002321678.1|1484495_1484849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296650.1|1484960_1485362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296648.1|1485398_1485908_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002296647.1|1485929_1486787_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002296646.1|1486804_1487638_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002296645.1|1487651_1488449_-	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_002321677.1|1488481_1488766_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002296641.1|1488762_1489764_-	2-hydroxyacid dehydrogenase	NA	M1H9J0	Paramecium_bursaria_Chlorella_virus	29.0	2.8e-24
WP_002296640.1|1489765_1490668_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	A0A1D8KGX1	Synechococcus_phage	35.3	3.3e-53
WP_002296639.1|1490831_1491680_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_101699714.1|1491802_1493098_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.7e-08
WP_002296638.1|1493847_1494054_+	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_002296637.1|1494255_1495257_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	31.8	2.5e-09
WP_002311095.1|1495261_1497175_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_002296634.1|1497342_1497849_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_002296633.1|1498008_1498449_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_002296632.1|1498474_1499632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296631.1|1499634_1499991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296629.1|1500288_1501263_-	LPXTG-anchored fibrinogen/nidogen-binding adhesin SgrA	NA	NA	NA	NA	NA
WP_002296628.1|1501458_1502298_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 7
NZ_CP025425	Enterococcus faecium strain SC4 chromosome, complete genome	2772425	1647042	1704001	2772425	tRNA,transposase,protease	Paenibacillus_phage(10.0%)	52	NA	NA
WP_086956687.1|1647042_1648205_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002325767.1|1648354_1649068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294465.1|1649182_1650193_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_002294466.1|1650229_1650712_-|tRNA	prolyl-tRNA editing protein	tRNA	NA	NA	NA	NA
WP_002294467.1|1650861_1651230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294470.1|1651694_1652147_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002288523.1|1652270_1653122_-	sugar transporter	NA	NA	NA	NA	NA
WP_002294471.1|1653134_1653920_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002294472.1|1654314_1655256_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_002294474.1|1655259_1656183_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_002347402.1|1656610_1657564_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002294145.1|1657619_1659983_-	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_002294143.1|1660430_1660652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294142.1|1660759_1661107_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_002294141.1|1661133_1663440_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.7	3.6e-19
WP_002288509.1|1663452_1663764_-	YlxQ-related RNA-binding protein	NA	NA	NA	NA	NA
WP_002288501.1|1663760_1664054_-	YlxR family protein	NA	NA	NA	NA	NA
WP_002288500.1|1664075_1665251_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_002288499.1|1665274_1665748_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_002294138.1|1665891_1670244_-	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	41.4	3.9e-22
WP_101699723.1|1670455_1672165_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002294136.1|1672232_1673501_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_002294135.1|1673661_1674462_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002294134.1|1674458_1675271_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	46.8	2.0e-25
WP_010729587.1|1675679_1676930_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	62.1	6.8e-113
WP_002293875.1|1677248_1677806_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_002293877.1|1677808_1678531_-	UMP kinase	NA	NA	NA	NA	NA
WP_002293878.1|1678666_1679548_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_002293880.1|1679646_1680429_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_002293881.1|1680787_1681267_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002326249.1|1681483_1682575_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_002293884.1|1682567_1683353_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_002293885.1|1683698_1685390_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.8	9.9e-75
WP_002288434.1|1685811_1686759_-	carbamate kinase	NA	NA	NA	NA	NA
WP_002288437.1|1686873_1687893_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_002288439.1|1687983_1689213_-	arginine deiminase	NA	NA	NA	NA	NA
WP_002288442.1|1689673_1690375_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_002297185.1|1690546_1691842_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002293887.1|1692468_1693485_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.4	5.4e-60
WP_002293888.1|1693481_1693946_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002293890.1|1693952_1694495_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002302614.1|1694478_1695303_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002293893.1|1695391_1696372_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.9	5.8e-19
WP_002293895.1|1696395_1697880_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_002293897.1|1697891_1698881_-	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	36.8	1.6e-48
WP_002288457.1|1699129_1699297_+	DUF3042 family protein	NA	NA	NA	NA	NA
WP_002293899.1|1699358_1701170_-	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_002288459.1|1701166_1701532_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_002293900.1|1701694_1702090_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002293901.1|1702107_1703070_-	ROK family glucokinase	NA	NA	NA	NA	NA
WP_002293902.1|1703069_1703282_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_002289885.1|1703302_1704001_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 8
NZ_CP025425	Enterococcus faecium strain SC4 chromosome, complete genome	2772425	1725252	1807012	2772425	plate,integrase,protease,tRNA,holin,portal,transposase,head,terminase,capsid,tail	Enterococcus_phage(30.23%)	99	1759046:1759105	1805717:1805817
WP_002288576.1|1725252_1726506_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	55.3	7.7e-24
WP_002347404.1|1726576_1727062_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_002326253.1|1727084_1727843_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.9	6.5e-26
WP_002322842.1|1727858_1729037_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	48.9	5.1e-102
WP_002326254.1|1729266_1731387_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	58.3	6.3e-220
WP_002326255.1|1731609_1732335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288586.1|1732324_1732834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288588.1|1732903_1734352_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.3	1.7e-19
WP_002293942.1|1734351_1735068_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
WP_002288595.1|1735048_1735399_-	SdpI family protein	NA	NA	NA	NA	NA
WP_002288592.1|1735542_1736316_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002323892.1|1737286_1737601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002324322.1|1737705_1738884_+|transposase	IS256-like element ISEfm2 family transposase	transposase	NA	NA	NA	NA
WP_002321266.1|1739219_1739459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289617.1|1739820_1740081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289618.1|1740265_1740763_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002323008.1|1740892_1741603_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_002297645.1|1741615_1743280_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_002297646.1|1743485_1744148_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_002325788.1|1744157_1744973_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002288989.1|1745234_1745678_-	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_002321036.1|1745811_1746150_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002302962.1|1746137_1746515_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997695.1|1746677_1747856_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002322902.1|1748084_1749278_+	MFS transporter	NA	NA	NA	NA	NA
WP_002288984.1|1749443_1749866_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002303955.1|1750455_1750911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288982.1|1751072_1752245_-	class C sortase	NA	NA	NA	NA	NA
WP_002303963.1|1755375_1757703_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002288970.1|1758545_1758839_-	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
1759046:1759105	attL	AAAAAAGAACCCTTGAATACCAAGGGTTCTTTCTCAGTCTGATAACAATGATTAACGACG	NA	NA	NA	NA
WP_002299614.1|1759340_1759571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002330703.1|1759576_1759876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286473.1|1759911_1760283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296902.1|1760284_1760686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286474.1|1760699_1761107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087046766.1|1762029_1763192_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_101699725.1|1764131_1765151_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	66.1	3.2e-60
WP_002352448.1|1765161_1765359_-|holin	holin	holin	A0A0S2MYF6	Enterococcus_phage	82.8	1.1e-22
WP_002312831.1|1765374_1765617_-|holin	holin	holin	D2J075	Enterococcus_phage	62.0	2.0e-21
WP_002290625.1|1765651_1765789_-	XkdX family protein	NA	NA	NA	NA	NA
WP_002352447.1|1765790_1766237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002371746.1|1766237_1768340_-|plate	BppU family phage baseplate upper protein	plate	A0A060AI60	Enterococcus_phage	70.1	2.3e-137
WP_002371747.1|1768339_1769371_-	hypothetical protein	NA	A0A0B5D0C2	Listeria_phage	29.1	1.4e-23
WP_002371749.1|1769370_1770414_-	hypothetical protein	NA	Q9T1A5	Listeria_phage	54.1	2.4e-103
WP_002371751.1|1770422_1771244_-|tail	phage tail family protein	tail	Q9T1A6	Listeria_phage	43.0	9.4e-55
WP_002371753.1|1771247_1778012_-|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	38.4	1.5e-17
WP_002337251.1|1778206_1778515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002371755.1|1778560_1779028_-	Ig domain-containing protein	NA	C9E2K1	Enterococcus_phage	43.9	8.1e-19
WP_002371756.1|1779100_1779688_-|tail	phage tail protein	tail	A0A2P0ZLF5	Lactobacillus_phage	41.0	2.7e-35
WP_002371758.1|1779748_1780159_-	hypothetical protein	NA	A0A059T681	Listeria_phage	47.2	3.1e-22
WP_002371760.1|1780155_1780560_-	hypothetical protein	NA	A0A2H4J7V9	uncultured_Caudovirales_phage	38.6	3.1e-19
WP_073357576.1|1780575_1780947_-|head,tail	phage head-tail adapter protein	head,tail	A0A059T6F2	Listeria_phage	55.4	1.2e-28
WP_002371763.1|1780927_1781206_-	hypothetical protein	NA	A0A1W6JQ66	Staphylococcus_phage	48.2	1.8e-13
WP_002371765.1|1781281_1782442_-|capsid	phage major capsid protein	capsid	D2XR18	Bacillus_phage	39.4	4.1e-64
WP_002371767.1|1782446_1783151_-|protease	Clp protease ClpP	protease	A0A2H4J8Y7	uncultured_Caudovirales_phage	45.9	9.5e-48
WP_002371768.1|1783137_1784310_-|portal	phage portal protein	portal	A0A2P0ZLC9	Lactobacillus_phage	46.8	9.9e-82
WP_098388098.1|1784358_1785306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002371772.1|1785337_1787029_-|terminase	terminase large subunit	terminase	A0A059T7Q8	Listeria_phage	51.9	2.5e-166
WP_074394494.1|1787031_1787586_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JA84	uncultured_Caudovirales_phage	55.8	8.1e-26
WP_002371775.1|1787753_1788014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002371777.1|1788004_1788316_-	HNH endonuclease	NA	A0A1S5SFB3	Streptococcus_phage	60.2	1.7e-28
WP_002371779.1|1788316_1788889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002315369.1|1788929_1789214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002315370.1|1789210_1789438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002315371.1|1789444_1789657_-	hypothetical protein	NA	D2IZF7	Enterococcus_phage	59.6	3.8e-08
WP_101699726.1|1789848_1790064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002351790.1|1790196_1790670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002351789.1|1790647_1790860_-	hypothetical protein	NA	A0A182BQC3	Lactococcus_phage	58.8	7.9e-14
WP_101699728.1|1790883_1791120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305391.1|1791396_1791864_-	ArpU family transcriptional regulator	NA	D7RWH7	Brochothrix_phage	28.5	2.4e-07
WP_002341971.1|1791938_1792379_-	transcriptional regulator	NA	D2IYV6	Enterococcus_phage	38.4	5.3e-20
WP_002369129.1|1792408_1792702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002353687.1|1792698_1792902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002369131.1|1792908_1793139_-	hypothetical protein	NA	A0A0S2MYD2	Enterococcus_phage	50.7	1.8e-11
WP_002371781.1|1793135_1793474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002371784.1|1793470_1793869_-	hypothetical protein	NA	D2IZL0	Enterococcus_phage	60.3	1.7e-33
WP_033794891.1|1793865_1794111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002371787.1|1794070_1794427_-	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	36.4	5.2e-10
WP_002304472.1|1794565_1795381_-	prohibitin family protein	NA	A0A288TXV9	Enterococcus_phage	69.4	1.8e-82
WP_002371788.1|1795391_1795610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002371790.1|1795606_1795918_-	hypothetical protein	NA	A0A0D3MVS9	Staphylococcus_phage	57.0	2.0e-26
WP_002371792.1|1795914_1796217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101699729.1|1796378_1796648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101699730.1|1796659_1797487_-	replisome organizer	NA	A0A0S2MYA8	Enterococcus_phage	54.9	3.9e-40
WP_002330650.1|1797489_1797717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101699732.1|1797719_1798406_-	hypothetical protein	NA	C9E2N1	Enterococcus_phage	70.9	7.5e-90
WP_074394502.1|1798411_1799083_-	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.8	5.5e-29
WP_060809376.1|1799075_1799417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101699733.1|1799594_1800293_-	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	2.3e-25
WP_002342078.1|1800347_1801013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002371134.1|1801311_1801560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002337458.1|1801572_1801758_-	helix-turn-helix transcriptional regulator	NA	Q5YAA3	Bacillus_phage	55.0	1.1e-11
WP_002337457.1|1802042_1802417_+	helix-turn-helix transcriptional regulator	NA	A0A2P0ZLA1	Lactobacillus_phage	44.6	6.9e-21
WP_002371136.1|1802421_1802850_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002371138.1|1802899_1803553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002371140.1|1803690_1804383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033794991.1|1804499_1805636_+|integrase	site-specific integrase	integrase	A0A1P8BMN3	Lactococcus_phage	36.2	5.5e-53
WP_002286913.1|1805767_1806115_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
1805717:1805817	attR	AAAAAAGAACCCTTGAATACCAAGGGTTCTTTCTCAGTCTGATAACAATGATTAACGACGGATTTCTTTGATACGAGCAGCTTTTCCGTGTAATGCACGTA	NA	NA	NA	NA
WP_002293717.1|1806250_1807012_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP025425	Enterococcus faecium strain SC4 chromosome, complete genome	2772425	1821874	1880043	2772425	tRNA,integrase,transposase	Streptococcus_phage(25.0%)	51	1812918:1812934	1870129:1870145
1812918:1812934	attL	AAAATCATCTGCATAAT	NA	NA	NA	NA
WP_101699735.1|1821874_1823036_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	50.9	7.8e-79
WP_002295271.1|1823608_1824583_-	choloylglycine hydrolase family protein	NA	M1HVK5	Paramecium_bursaria_Chlorella_virus	31.8	5.4e-25
WP_002295273.1|1824745_1825003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008266934.1|1825234_1825648_-	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_086953915.1|1825924_1827264_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002294831.1|1827335_1828028_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9MCC6	Lactobacillus_phage	43.4	2.3e-30
WP_002294833.1|1828022_1828289_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	58.7	2.8e-08
WP_002294835.1|1828464_1829034_-	prevent-host-death protein	NA	NA	NA	NA	NA
WP_049143547.1|1829107_1830397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304700.1|1830750_1831599_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_002374090.1|1831743_1832685_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_002327341.1|1834957_1837129_-	copper/silver-translocating P-type ATPase CopB	NA	A0A218MNH6	uncultured_virus	32.3	5.0e-71
WP_002325801.1|1837148_1839335_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.6	5.3e-121
WP_002289040.1|1839334_1839544_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_002294855.1|1839556_1839997_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_002294858.1|1840070_1840610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288779.1|1840856_1842323_-	amino acid permease	NA	NA	NA	NA	NA
WP_060811631.1|1842633_1844715_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.7	2.2e-116
WP_002288776.1|1845238_1845598_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002323870.1|1845627_1845969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294865.1|1845965_1846640_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002291771.1|1847817_1849116_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.3	9.0e-60
WP_002325036.1|1849155_1850346_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002348809.1|1850366_1850894_-	DUF5590 domain-containg protein	NA	NA	NA	NA	NA
WP_002341537.1|1850940_1853730_-	DEAD/DEAH box helicase family protein	NA	A0A1X9I5C8	Streptococcus_phage	30.9	1.4e-89
WP_002288762.1|1853876_1854077_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	74.2	2.5e-22
WP_002301399.1|1854445_1855405_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002325038.1|1855593_1855914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294874.1|1856294_1857413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302201.1|1857883_1859191_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_002302199.1|1859309_1860509_+	DUF218 domain-containing protein	NA	NA	NA	NA	NA
WP_002321583.1|1860535_1861804_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.1	4.9e-42
WP_002302197.1|1861966_1862614_-	elongation factor G-binding protein	NA	NA	NA	NA	NA
WP_002289559.1|1862892_1863396_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_002302195.1|1863518_1864283_-	RNA methyltransferase	NA	A0A2D1A6G0	Rhodococcus_phage	26.8	7.5e-06
WP_002289551.1|1864389_1864665_+	acylphosphatase	NA	NA	NA	NA	NA
WP_002305672.1|1865341_1866292_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_002325884.1|1866454_1867408_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002305671.1|1867662_1867821_-	PTS sugar transporter	NA	NA	NA	NA	NA
WP_002349152.1|1868125_1868320_-	hypothetical protein	NA	M1PSF2	Streptococcus_phage	72.0	1.1e-14
WP_002305669.1|1869262_1869616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002349156.1|1869743_1870283_-	hypothetical protein	NA	NA	NA	NA	NA
1870129:1870145	attR	AAAATCATCTGCATAAT	NA	NA	NA	NA
WP_002350942.1|1870312_1870504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305667.1|1870545_1871412_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002305666.1|1871435_1873088_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	40.5	2.6e-104
WP_002323227.1|1873092_1873995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305664.1|1874078_1875392_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	26.9	2.6e-38
WP_002305663.1|1875459_1876404_-	GDP-L-fucose synthase	NA	A0A1D8KU05	Synechococcus_phage	53.4	1.5e-93
WP_002323224.1|1876440_1877454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305661.1|1877533_1878580_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	63.1	1.8e-122
WP_002297185.1|1878747_1880043_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
>prophage 10
NZ_CP025425	Enterococcus faecium strain SC4 chromosome, complete genome	2772425	2640321	2657217	2772425		Streptococcus_phage(92.86%)	18	NA	NA
WP_002297366.1|2640321_2640636_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.0e-25
WP_002297365.1|2640648_2641023_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	66.1	2.4e-34
WP_002311649.1|2641023_2641368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321809.1|2641450_2642791_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	65.4	2.4e-164
WP_002297358.1|2642868_2643543_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002321810.1|2643775_2644210_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1S5SDW2	Streptococcus_phage	77.1	6.5e-63
WP_002297356.1|2644210_2644918_+	DNA methylase	NA	A0A1S5SEK0	Streptococcus_phage	50.4	5.8e-53
WP_002297354.1|2644907_2645198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297353.1|2645456_2646641_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	61.6	2.9e-142
WP_002317225.1|2646637_2646775_+	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002286940.1|2647520_2649431_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_033658092.1|2649534_2649759_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	1.2e-23
WP_002297350.1|2649771_2650275_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.9	9.2e-53
WP_002297349.1|2650334_2650724_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	68.3	3.9e-43
WP_002297348.1|2650710_2653158_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	76.0	0.0e+00
WP_002297347.1|2653162_2655286_+	hypothetical protein	NA	A0A1S5SF30	Streptococcus_phage	59.7	1.2e-181
WP_002297346.1|2655282_2656287_+	peptidase P60	NA	A0A1S5SEZ8	Streptococcus_phage	63.5	5.6e-118
WP_002297345.1|2656305_2657217_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	44.0	2.2e-65
>prophage 1
NZ_CP025426	Enterococcus faecium strain SC4 plasmid p1, complete sequence	253120	7031	173578	253120	holin,transposase,integrase	Streptococcus_phage(25.0%)	149	131028:131044	139809:139825
WP_001015311.1|7031_7712_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_086968564.1|7822_8963_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	57.7	3.8e-78
WP_000751236.1|9198_9651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000718009.1|9664_10354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000344083.1|10478_12830_+	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_002304891.1|12909_13305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001224538.1|13629_14247_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.1	5.1e-13
WP_000366408.1|14287_14587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000824191.1|14620_14788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729776.1|14832_15303_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	33.6	1.5e-09
WP_025189010.1|17504_17897_+	GNAT family N-acetyltransferase	NA	A0A0N7GFH7	Staphylococcus_phage	96.9	1.4e-69
WP_099137877.1|17897_19265_+	APH(2'')-Ia/If/Ih family aminoglycoside O-phosphotransferase	NA	A0A0N9SKF6	Staphylococcus_phage	100.0	2.5e-270
WP_025189010.1|19245_19638_+	GNAT family N-acetyltransferase	NA	A0A0N7GFH7	Staphylococcus_phage	96.9	1.4e-69
WP_001028141.1|19638_21078_+	bifunctional aminoglycoside N-acetyltransferase AAC(6')-Ie/aminoglycoside O-phosphotransferase APH(2'')-Ia	NA	A0A0N9SKF6	Staphylococcus_phage	100.0	8.5e-285
WP_002354485.1|21538_22225_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_106913803.1|22741_22837_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_000353844.1|23536_23821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001232859.1|23823_24240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311815.1|24376_25096_-	replication initiation protein	NA	NA	NA	NA	NA
WP_002354485.1|25318_26005_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002305788.1|27318_27588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296377.1|27819_28116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729773.1|28117_28540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296379.1|28558_30151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086968564.1|30652_31794_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	57.7	3.8e-78
WP_002322479.1|32041_32236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002330536.1|32371_33622_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	3.0e-113
WP_002313122.1|34591_36403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002313123.1|36463_37933_+	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_044383536.1|37943_39953_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	52.6	1.6e-111
WP_002299811.1|40298_40895_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_002301800.1|40907_41807_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_002301801.1|41809_41941_+	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	83.3	1.3e-11
WP_002305808.1|41962_42295_+	single-stranded DNA-binding protein	NA	W6LM61	Streptococcus_phage	53.2	6.1e-21
WP_002295625.1|42316_42574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295624.1|42732_42855_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_074399798.1|43044_43269_+	hypothetical protein	NA	A0A0S2MYI8	Enterococcus_phage	56.9	3.6e-09
WP_002296239.1|43716_43923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296238.1|43922_44174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296237.1|44188_44626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002353391.1|44618_45326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305761.1|45706_45886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287514.1|46226_46490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321032.1|46483_46834_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_010729795.1|46857_47472_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	31.4	6.4e-16
WP_002288787.1|47785_48208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002299573.1|48217_48421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002299575.1|48631_49216_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.7	5.9e-43
WP_086322086.1|49404_50091_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.7	2.9e-126
WP_010729807.1|52289_52922_+	HAD family phosphatase	NA	A0A1D8KNV9	Synechococcus_phage	27.9	3.0e-08
WP_077974475.1|53126_53354_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_086322080.1|53350_53689_+	antitoxin	NA	NA	NA	NA	NA
WP_002389879.1|53678_53948_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5SCV8	Streptococcus_phage	48.8	8.7e-18
WP_002302440.1|54126_55428_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002296127.1|55656_57204_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	1.7e-44
WP_002287659.1|57305_57659_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002285758.1|57648_57843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729749.1|57921_59214_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002336724.1|59976_60945_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002288615.1|60955_61771_+	fructoselysine 6-kinase	NA	NA	NA	NA	NA
WP_010729750.1|61838_62549_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288620.1|62584_63826_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_002296840.1|63883_65071_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002298077.1|65605_67006_+	putative basic amino acid antiporter YfcC	NA	NA	NA	NA	NA
WP_002322961.1|67038_67206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002350223.1|68071_68932_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002350224.1|69351_70284_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_002339141.1|70326_70938_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	53.2	1.7e-56
WP_002339142.1|70957_72178_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	58.5	3.9e-57
WP_085910366.1|72235_72922_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	5.9e-127
WP_002331328.1|73411_73633_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002342384.1|73648_74491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729753.1|74553_76356_+	exonuclease DNA polymerase III epsilon subunit	NA	A0A0A7RWA3	Clostridium_phage	30.4	7.6e-33
WP_010729754.1|76414_77323_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_002336308.1|77872_78832_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.5	6.5e-31
WP_002313084.1|80220_80826_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	32.6	3.6e-19
WP_010729506.1|81860_82832_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	22.4	1.2e-05
WP_002322554.1|82926_84285_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002322555.1|84327_85194_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002313079.1|85190_86039_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002322556.1|86052_87525_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_010729757.1|87541_88414_+	ROK family protein	NA	NA	NA	NA	NA
WP_002292678.1|91677_92007_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_002300557.1|91996_92284_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002292680.1|92567_93425_+	ParA family protein	NA	F0PIG8	Enterococcus_phage	30.7	8.1e-33
WP_002292681.1|93425_93974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044383156.1|94603_95284_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	83.6	3.2e-109
WP_002287522.1|96187_96592_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002287525.1|96608_97757_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_002350449.1|97939_98947_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_016922317.1|99413_100820_+	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	30.2	3.4e-44
WP_002350447.1|100842_101166_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_016922316.1|101176_102859_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002350442.1|104483_105236_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	1.9e-17
WP_002350440.1|105828_107286_-	PTS glucitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_002350439.1|107307_107610_-	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_002350438.1|107666_108146_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_010731480.1|108310_109084_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.1	1.3e-18
WP_010731481.1|109103_109532_+	galactose-6-phosphate isomerase subunit LacA	NA	NA	NA	NA	NA
WP_010731482.1|109550_110066_+	galactose-6-phosphate isomerase subunit LacB	NA	A0A222YX14	Synechococcus_phage	29.0	9.5e-05
WP_002350433.1|110078_111005_+	tagatose-6-phosphate kinase	NA	NA	NA	NA	NA
WP_002350432.1|111017_112004_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002350430.1|112459_113128_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.4	8.8e-27
WP_010731484.1|113118_114252_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_002326540.1|115614_116400_-	SinI family restriction endonuclease	NA	NA	NA	NA	NA
WP_044383147.1|116524_118120_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	51.1	1.8e-126
WP_016922464.1|118109_119327_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	33.7	9.2e-14
WP_044383143.1|119340_122490_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	23.1	1.1e-21
WP_094868189.1|122701_123388_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	5.9e-127
WP_002344897.1|123516_123873_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002344896.1|123862_124129_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002344895.1|124287_125289_+	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_008271463.1|126512_126758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311006.1|126855_127077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002319325.1|128140_128758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300314.1|129777_130947_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
131028:131044	attL	AAAATATTAATAAAAAT	NA	NA	NA	NA
WP_002290383.1|131419_131974_+|integrase	tyrosine-type recombinase/integrase	integrase	W8CYP1	Bacillus_phage	46.1	8.6e-36
WP_002290382.1|132146_132620_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A097PAS9	Streptococcus_pyogenes_phage	44.2	2.3e-13
WP_002342357.1|132631_133168_+	glyoxalase	NA	NA	NA	NA	NA
WP_002290380.1|133207_133579_+	glyoxalase	NA	NA	NA	NA	NA
WP_002290379.1|133862_135134_+	substrate-binding domain-containing protein	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	45.0	4.1e-17
WP_002338088.1|135378_136404_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_101699766.1|136697_137807_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002350071.1|138801_139626_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002329911.1|139657_140968_+	alpha-glucosidase/alpha-galactosidase	NA	NA	NA	NA	NA
139809:139825	attR	AAAATATTAATAAAAAT	NA	NA	NA	NA
WP_002290371.1|141115_142375_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002290370.1|142384_143257_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002290368.1|143268_144099_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002290367.1|144138_146322_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_002342361.1|146382_147603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002335326.1|147599_149060_+	sucrose phosphorylase	NA	NA	NA	NA	NA
WP_002290357.1|150564_150774_+	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
WP_002290356.1|150766_150916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002290352.1|152018_153104_-	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_002290351.1|153437_153671_+	addiction module antitoxin	NA	NA	NA	NA	NA
WP_002329899.1|153667_154075_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A0N9SKD8	Staphylococcus_phage	38.9	4.0e-14
WP_002287870.1|155211_155730_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_086956687.1|156847_158009_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002300328.1|158507_158984_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002289252.1|158996_160499_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002289253.1|160512_161202_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_002289254.1|161362_162181_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289255.1|162410_162641_+	resolvase	NA	NA	NA	NA	NA
WP_002301718.1|163226_163682_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.6	1.3e-13
WP_086953894.1|163924_165350_+|transposase	IS3-like element ISEfa10 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.2	2.3e-48
WP_002302077.1|165520_166483_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.8	2.3e-20
WP_002302078.1|166484_167924_-	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.1	1.4e-16
WP_002292418.1|171456_172329_+	ROK family protein	NA	NA	NA	NA	NA
WP_101699768.1|172624_173578_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	29.0	9.7e-11
>prophage 1
NZ_CP025427	Enterococcus faecium strain SC4 plasmid p2, complete sequence	142988	74126	113095	142988	protease,transposase	Streptococcus_phage(58.62%)	51	NA	NA
WP_002347460.1|74126_74726_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_002347461.1|74741_75218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347462.1|75234_76137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002320847.1|76209_76401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347463.1|76564_77152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347464.1|77151_78051_+	RusA family crossover junction endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_002347465.1|78050_78965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347466.1|79016_79232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101699790.1|79417_79630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002354485.1|79677_80364_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002347171.1|80419_80677_+	hypothetical protein	NA	A0A1X9I765	Streptococcus_phage	98.8	9.1e-41
WP_001835296.1|80768_80984_+	peptide-binding protein	NA	A0A1X9I6D5	Streptococcus_phage	97.1	4.2e-31
WP_000301765.1|81000_81273_+	antitoxin	NA	A0A1X9I6E5	Streptococcus_phage	100.0	5.0e-05
WP_001284311.1|81274_82138_+	toxin zeta	NA	NA	NA	NA	NA
WP_023843711.1|82315_82456_-	hypothetical protein	NA	E4ZFP9	Streptococcus_phage	93.0	8.0e-15
WP_001038796.1|82400_83138_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	2.4e-134
WP_031929417.1|83262_83346_-	23S rRNA methyltransferase attenuator leader peptide ErmL	NA	NA	NA	NA	NA
WP_001096887.1|83887_84682_-	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
WP_002297218.1|85270_86566_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.1	1.0e-42
WP_002324522.1|86666_87575_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002347175.1|87577_87826_-	hypothetical protein	NA	A0A1B0RXL7	Streptococcus_phage	96.1	9.5e-27
WP_001255866.1|87822_88731_-	aminoglycoside nucleotidyltransferase ANT(6)-Ia	NA	E4ZFP8	Streptococcus_phage	100.0	2.8e-177
WP_000662263.1|88763_89498_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	100.0	1.5e-141
WP_002303392.1|89478_90348_-	hypothetical protein	NA	A0A1X9I6C9	Streptococcus_phage	90.3	5.7e-151
WP_002303393.1|90362_90587_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002354485.1|90741_91428_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002349227.1|91630_91843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000357244.1|92004_92523_+	YfbU family protein	NA	NA	NA	NA	NA
WP_000774078.1|92529_93042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288897.1|93312_93936_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	30.1	1.8e-13
WP_002354485.1|94025_94712_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_000599739.1|94909_95515_+	cell filamentation protein	NA	NA	NA	NA	NA
WP_002303206.1|95530_96103_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	46.0	6.8e-36
WP_002302440.1|96398_97700_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_073120187.1|98076_98649_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	57.1	5.0e-55
WP_086953888.1|98749_99912_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002322130.1|99952_100207_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	50.0	4.1e-09
WP_000199136.1|100317_100572_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	47.6	2.1e-13
WP_001196543.1|100764_101040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000429439.1|101011_101965_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	26.1	7.7e-16
WP_000947691.1|102576_104070_+	replication protein RepR	NA	NA	NA	NA	NA
WP_002347145.1|104204_104519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002354485.1|104550_105237_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_001226076.1|105463_106039_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	34.8	9.0e-20
WP_002323245.1|106260_107433_-|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_001280781.1|107584_108280_+	VanA-type vancomycin resistance DNA-binding response regulator VanR	NA	W8CYM9	Bacillus_phage	37.7	4.9e-36
WP_002305818.1|108257_109412_+	VanA-type vancomycin resistance histidine kinase VanS	NA	W8CYF6	Bacillus_phage	23.3	1.5e-13
WP_001059542.1|109626_110595_+	D-lactate dehydrogenase VanH-A	NA	M1HUW8	Acanthocystis_turfacea_Chlorella_virus	33.1	3.5e-40
WP_001079845.1|110587_111619_+	D-alanine--(R)-lactate ligase VanA	NA	NA	NA	NA	NA
WP_000402347.1|111624_112233_+	D-Ala-D-Ala dipeptidase VanX-A	NA	NA	NA	NA	NA
WP_002354485.1|112408_113095_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
