The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025461	Klebsiella pneumoniae strain F44 chromosome, complete genome	5460465	1098195	1109847	5460465	integrase	Enterobacteria_phage(66.67%)	12	1086329:1086343	1109384:1109398
1086329:1086343	attL	AGCGCGGAGAGATTG	NA	NA	NA	NA
WP_002889890.1|1098195_1100529_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
WP_002889897.1|1100540_1100861_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889911.1|1100857_1101085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940872.1|1101081_1101639_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889915.1|1101635_1101902_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_004152203.1|1103176_1103422_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|1103439_1104006_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152979.1|1104573_1104999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152029.1|1104998_1105949_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_002889938.1|1105936_1107127_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_002889940.1|1107479_1108733_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_004144574.1|1108743_1109847_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
1109384:1109398	attR	AGCGCGGAGAGATTG	NA	NA	NA	NA
>prophage 2
NZ_CP025461	Klebsiella pneumoniae strain F44 chromosome, complete genome	5460465	1761437	1800683	5460465	integrase,terminase,portal,plate,tail,capsid,lysis,head	Salmonella_phage(82.5%)	47	1761345:1761363	1800755:1800773
1761345:1761363	attL	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_004151720.1|1761437_1762490_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
WP_004152765.1|1762908_1764393_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004150866.1|1764491_1765436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|1765447_1766326_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_000188448.1|1766471_1766693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|1766725_1767235_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956179.1|1767242_1767443_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000963473.1|1767406_1767748_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_004150864.1|1767815_1768049_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000752622.1|1768048_1768276_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150863.1|1768272_1769130_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_004150862.1|1769126_1771541_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004152765.1|1772019_1773504_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_001154434.1|1773604_1773793_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|1773803_1774037_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000700647.1|1774151_1774829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199124.1|1775104_1776847_+	AIPR family protein	NA	NA	NA	NA	NA
WP_002895959.1|1776908_1777934_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004150858.1|1777933_1779700_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895967.1|1779842_1780676_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_002895972.1|1780692_1781751_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_000059191.1|1781754_1782405_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002896151.1|1782500_1782965_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_002896155.1|1782964_1783168_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896158.1|1783171_1783387_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896161.1|1783367_1783877_+	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896163.1|1783881_1784265_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896168.1|1784261_1784690_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896172.1|1784785_1785217_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896175.1|1785209_1785656_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_004150857.1|1785652_1786345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896177.1|1786439_1787012_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_032441567.1|1787008_1787371_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	4.9e-48
WP_002896182.1|1787357_1788266_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_004150856.1|1788258_1788858_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_004152882.1|1788859_1791811_+	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_002896186.1|1791814_1792546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896188.1|1792542_1792746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896191.1|1792775_1793852_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896193.1|1793990_1795163_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896201.1|1795172_1795688_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896204.1|1795740_1796040_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896220.1|1796054_1796174_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896222.1|1796166_1798794_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896224.1|1798790_1799276_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896225.1|1799272_1800373_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_000972391.1|1800464_1800683_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
1800755:1800773	attR	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
>prophage 3
NZ_CP025461	Klebsiella pneumoniae strain F44 chromosome, complete genome	5460465	1835099	1844563	5460465	protease,tRNA	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|1835099_1836215_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|1836211_1838152_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|1838228_1838450_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|1838775_1839093_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|1839123_1841403_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|1841523_1841742_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|1842095_1842797_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004150847.1|1842841_1844563_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 4
NZ_CP025461	Klebsiella pneumoniae strain F44 chromosome, complete genome	5460465	2072594	2160436	5460465	integrase,terminase,portal,tail,tRNA,capsid,lysis,head	Klebsiella_phage(44.19%)	93	2068892:2068906	2127012:2127026
2068892:2068906	attL	GGTGACGCAGCAGGG	NA	NA	NA	NA
WP_004150803.1|2072594_2073701_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004150802.1|2073757_2074216_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150801.1|2074232_2074883_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004150800.1|2075123_2076374_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_032418030.1|2076491_2077619_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.4	4.4e-119
WP_012542206.1|2077599_2077845_-	excisionase	NA	NA	NA	NA	NA
WP_062954978.1|2077897_2080036_-	exodeoxyribonuclease VIII	NA	S4TNL0	Salmonella_phage	42.7	5.6e-99
WP_014228879.1|2080177_2080522_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_023279538.1|2080564_2080759_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_040234937.1|2081149_2081464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077257742.1|2081785_2082223_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	62.2	1.3e-39
WP_071561166.1|2082311_2082536_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	62.5	1.3e-19
WP_046622349.1|2082538_2083093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077265602.1|2083152_2084157_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	40.0	1.0e-31
WP_047667474.1|2084149_2084614_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	72.2	4.1e-63
WP_032443841.1|2084627_2085068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062954977.1|2085416_2086808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062954989.1|2086896_2087766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062954976.1|2088117_2088831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062954975.1|2089004_2090366_+	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_004152765.1|2091206_2092691_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_025368263.1|2092769_2093003_+	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	3.7e-25
WP_077255782.1|2093014_2093305_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	8.0e-17
WP_025861428.1|2093345_2093738_+	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	8.0e-12
WP_062955112.1|2093937_2094969_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	4.7e-96
WP_025861432.1|2094985_2095588_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.6	1.1e-76
WP_004147997.1|2095831_2096035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004147999.1|2096772_2096922_-	small membrane protein	NA	NA	NA	NA	NA
WP_016160648.1|2097839_2098055_+|lysis	phage S lysis protein	lysis	A5LH82	Enterobacteria_phage	88.7	2.7e-30
WP_032432826.1|2098054_2098552_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.6	1.1e-77
WP_016160650.1|2098548_2098899_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
WP_049115059.1|2099848_2100286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032749552.1|2100324_2100549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032428746.1|2100875_2101238_+	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
WP_023297386.1|2101189_2101513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014907818.1|2101509_2101941_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.6	1.8e-41
WP_012542168.1|2102189_2102624_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_021462603.1|2102623_2104345_+|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.5e-190
WP_017898992.1|2104338_2104518_+	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
WP_023279520.1|2104517_2105777_+|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	1.8e-222
WP_014907815.1|2105813_2106734_+	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
WP_023328094.1|2106811_2108098_+|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.0	9.8e-216
WP_049010370.1|2108156_2108417_+	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	60.5	7.4e-22
WP_020317538.1|2108397_2108715_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_023328092.1|2108711_2109050_+|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	90.2	2.8e-53
WP_017880258.1|2109030_2109420_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_023328091.1|2109416_2109818_+	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	2.3e-62
WP_023328090.1|2109849_2110311_+	hypothetical protein	NA	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_014228914.1|2110368_2110734_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_023328089.1|2110966_2114302_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.3	0.0e+00
WP_023328088.1|2114301_2114640_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	1.4e-57
WP_023328087.1|2114636_2115392_+|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.5	4.6e-125
WP_047666389.1|2115393_2116104_+	peptidase P60	NA	Q6UAW4	Klebsiella_phage	90.3	1.9e-136
WP_047666390.1|2116145_2116568_+	hypothetical protein	NA	J9Q806	Salmonella_phage	50.0	5.9e-29
WP_023328085.1|2116594_2117188_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	76.6	8.0e-80
WP_062955111.1|2117250_2129955_+	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	47.1	0.0e+00
2127012:2127026	attR	GGTGACGCAGCAGGG	NA	NA	NA	NA
WP_023328083.1|2130023_2131520_+|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	63.7	1.4e-125
WP_004892953.1|2131674_2131827_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_004150799.1|2132099_2132813_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004150798.1|2132809_2133202_-	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004150797.1|2133194_2133518_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004140530.1|2133954_2134182_-	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_004140529.1|2134294_2135488_-	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004150795.1|2136109_2136295_+	general stress protein	NA	NA	NA	NA	NA
WP_004150794.1|2136385_2136880_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004140514.1|2136906_2137413_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004140512.1|2137429_2138317_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004150793.1|2138372_2139779_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140509.1|2139775_2140786_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004140506.1|2140901_2141099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|2141665_2142298_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_158208744.1|2142276_2142432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150790.1|2142914_2143601_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004140497.1|2143911_2145420_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150788.1|2145540_2146431_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004150787.1|2146437_2148222_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004150785.1|2148295_2149504_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004150784.1|2149806_2150850_+	type II asparaginase	NA	NA	NA	NA	NA
WP_004148038.1|2151511_2152426_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150783.1|2152515_2153154_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004140489.1|2153284_2153548_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004140488.1|2153607_2153733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099119317.1|2153850_2153925_-	protein YoaJ	NA	NA	NA	NA	NA
WP_004150782.1|2153924_2154026_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004150781.1|2154083_2155097_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.4e-12
WP_004150780.1|2155397_2155637_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004150779.1|2155626_2155983_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004150778.1|2155969_2156479_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004140471.1|2156624_2157317_+	CTP synthase	NA	NA	NA	NA	NA
WP_004150777.1|2157348_2158533_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_002901073.1|2158634_2159426_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002901080.1|2159409_2159856_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901088.1|2159935_2160436_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP025461	Klebsiella pneumoniae strain F44 chromosome, complete genome	5460465	2288137	2304740	5460465	transposase,integrase	Enterobacteria_phage(33.33%)	21	2290817:2290832	2311866:2311881
WP_004140269.1|2288137_2288947_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004140266.1|2288948_2289941_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004151901.1|2289940_2290831_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
2290817:2290832	attL	GCTATCGTAGGGCATA	NA	NA	NA	NA
WP_004153574.1|2291007_2292195_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
WP_004151899.1|2292402_2293065_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004151898.1|2293061_2293490_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004201102.1|2293486_2294167_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_088224434.1|2294168_2294456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201103.1|2294452_2295298_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_004201105.1|2295313_2295598_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004135674.1|2295686_2295881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201108.1|2296309_2296513_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004201109.1|2296594_2297671_-	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_019405077.1|2298593_2298713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201113.1|2298735_2299434_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_004201115.1|2299545_2299773_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_001548453.1|2299813_2300035_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_001067855.1|2300431_2301136_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001261740.1|2302117_2302909_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|2303072_2303420_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001067855.1|2304035_2304740_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
2311866:2311881	attR	GCTATCGTAGGGCATA	NA	NA	NA	NA
>prophage 6
NZ_CP025461	Klebsiella pneumoniae strain F44 chromosome, complete genome	5460465	2344452	2382918	5460465	integrase,terminase	uncultured_Caudovirales_phage(34.04%)	56	2342533:2342547	2351473:2351487
2342533:2342547	attL	AGTTGATCCTCTGGC	NA	NA	NA	NA
WP_004152144.1|2344452_2345214_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152145.1|2345430_2346963_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_016197745.1|2347161_2347710_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004152147.1|2347906_2349088_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_004152148.1|2349068_2349311_-	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152149.1|2349489_2349969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152150.1|2349965_2350178_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152151.1|2350174_2350399_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004154298.1|2350388_2351099_-	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152153.1|2351104_2351623_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
2351473:2351487	attR	GCCAGAGGATCAACT	NA	NA	NA	NA
WP_004152154.1|2351727_2352555_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152155.1|2352551_2352746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152156.1|2352742_2353168_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004177208.1|2353164_2353383_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_004152157.1|2353354_2353609_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004152158.1|2353601_2353967_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152159.1|2354136_2354325_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152160.1|2354317_2354632_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152161.1|2354802_2355471_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152162.1|2355568_2355790_+	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004198228.1|2356366_2358025_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004198233.1|2358026_2358989_+	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198239.1|2358985_2359462_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004152167.1|2359458_2360241_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004146526.1|2360646_2360895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152169.1|2360897_2361428_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004153952.1|2361424_2361814_+	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152170.1|2362048_2362369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152171.1|2362470_2363223_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152172.1|2363173_2364574_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152173.1|2364811_2366263_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152174.1|2366318_2366867_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004199270.1|2366918_2368121_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_000528476.1|2368124_2368619_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_001132269.1|2368630_2369572_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000725700.1|2369611_2369893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|2369861_2370281_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000834982.1|2370277_2370784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001116156.1|2370783_2371170_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_004152176.1|2371264_2371705_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_004152177.1|2371708_2372854_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004199809.1|2372864_2373305_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152564.1|2373308_2373734_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004152565.1|2373769_2373922_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152566.1|2373911_2375915_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152567.1|2375914_2376514_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152568.1|2376514_2376817_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152569.1|2376819_2377842_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152570.1|2377841_2378183_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004199301.1|2378232_2378415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152571.1|2378457_2379024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152572.1|2379077_2379731_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152573.1|2379732_2380086_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152574.1|2380085_2381282_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152575.1|2381278_2382052_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152576.1|2382051_2382918_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
>prophage 7
NZ_CP025461	Klebsiella pneumoniae strain F44 chromosome, complete genome	5460465	2610410	2616838	5460465		Escherichia_phage(100.0%)	6	NA	NA
WP_002210516.1|2610410_2611031_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004151609.1|2611023_2612289_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210513.1|2613462_2614224_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|2614244_2615105_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002904006.1|2615402_2615663_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_001620097.1|2615749_2616838_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
>prophage 8
NZ_CP025461	Klebsiella pneumoniae strain F44 chromosome, complete genome	5460465	3263482	3346390	5460465	integrase,terminase,holin,plate,tail,head	Enterobacteria_phage(31.48%)	99	3292280:3292295	3342282:3342297
WP_004175538.1|3263482_3263926_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004189400.1|3263928_3264471_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_025403903.1|3264445_3265492_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004200296.1|3265491_3267255_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004200298.1|3267312_3270801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004198077.1|3270784_3271942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|3271945_3272212_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_062955036.1|3272454_3272964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062955037.1|3272960_3273281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020802731.1|3273277_3273469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062955038.1|3273465_3273975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062955039.1|3274068_3274437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153085.1|3274433_3274763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021464429.1|3274759_3274942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004175505.1|3274942_3276298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910586.1|3276591_3277101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|3277337_3277844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910593.1|3277840_3278350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073547072.1|3278350_3279274_-	S-type Pyocin	NA	NA	NA	NA	NA
WP_063048274.1|3280081_3280483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099143948.1|3281276_3281792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004184628.1|3281792_3283148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062955013.1|3283171_3285658_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_062955014.1|3286116_3287814_-	OmpA family protein	NA	NA	NA	NA	NA
WP_062955015.1|3287817_3288471_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004200314.1|3288467_3289808_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004200315.1|3290045_3290312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910650.1|3290375_3290705_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_004899028.1|3290774_3291359_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_014907357.1|3291384_3292083_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_002910657.1|3292273_3292756_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
3292280:3292295	attL	ATGAACGGAACAATCA	NA	NA	NA	NA
WP_094819165.1|3293730_3294048_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.0	2.4e-22
WP_094819166.1|3294047_3294287_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	49.4	1.4e-14
WP_000797449.1|3294393_3295704_-	right-handed parallel beta-helix repeat-containing protein	NA	A0A0K2FI18	Enterobacter_phage	32.0	3.8e-34
WP_094937835.1|3295841_3297104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094937837.1|3297185_3297953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094819137.1|3300254_3301385_-|tail	phage tail protein	tail	Q8HAM8	Burkholderia_phage	40.1	5.3e-40
WP_101992375.1|3301386_3301974_-	DUF2612 domain-containing protein	NA	A0A077K9U8	Edwardsiella_phage	42.9	1.1e-33
WP_094819139.1|3301966_3303199_-	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	50.5	1.5e-104
WP_001518114.1|3303206_3303563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094819140.1|3304017_3304608_-	hypothetical protein	NA	A0A077KAY0	Edwardsiella_phage	35.3	1.2e-24
WP_094819141.1|3304597_3305467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019725008.1|3305463_3305769_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	48.5	3.6e-20
WP_094819142.1|3305770_3306610_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	33.5	2.6e-28
WP_094819143.1|3306613_3308572_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	38.4	3.4e-42
WP_094819144.1|3308776_3309253_-	hypothetical protein	NA	A0A068CGG2	Acinetobacter_phage	29.1	1.2e-06
WP_019724823.1|3309304_3309559_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	74.6	2.3e-20
WP_094819145.1|3309561_3310317_-	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.4	6.2e-61
WP_009308049.1|3310498_3310942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094819146.1|3310941_3312423_-	DUF3383 domain-containing protein	NA	Q2NPD0	Xanthomonas_phage	34.2	5.6e-58
WP_094819147.1|3312426_3312978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029497286.1|3312959_3313328_-	hypothetical protein	NA	Q6UJ26	Burkholderia_virus	29.8	1.2e-06
WP_094819148.1|3313324_3313888_-	hypothetical protein	NA	H9C0W2	Aeromonas_phage	32.4	1.8e-17
WP_041937856.1|3313890_3314334_-	DUF4054 domain-containing protein	NA	A0A1X9SF97	Acinetobacter_phage	38.2	1.1e-12
WP_094819149.1|3314333_3314660_-	hypothetical protein	NA	H9C0V9	Aeromonas_phage	41.6	3.6e-10
WP_019724831.1|3314661_3315699_-	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	50.0	1.9e-84
WP_001518133.1|3315698_3316181_-	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	50.3	4.5e-33
WP_094819150.1|3316182_3317352_-	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.5	2.6e-58
WP_025713735.1|3317355_3318054_-|head	head morphogenesis protein	head	H9C0V1	Aeromonas_phage	50.4	8.3e-60
WP_094819151.1|3318106_3319627_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	45.4	6.7e-107
WP_094819152.1|3319627_3321304_-|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	74.1	1.5e-248
WP_072040663.1|3321305_3321938_-	hypothetical protein	NA	A0A2I7RHH8	Vibrio_phage	48.5	5.4e-42
WP_001064347.1|3322263_3322782_-	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	100.0	2.9e-94
WP_094819153.1|3323066_3323456_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	49.2	1.5e-23
WP_094819158.1|3323452_3323950_-	lysozyme	NA	K7P7Q3	Enterobacteria_phage	83.0	2.4e-77
WP_012542609.1|3323927_3324197_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	78.3	2.8e-32
WP_094819154.1|3324793_3325603_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	77.3	2.0e-121
WP_094819155.1|3325599_3325740_-	YlcG family protein	NA	NA	NA	NA	NA
WP_094819156.1|3325736_3326099_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	80.7	4.7e-51
WP_004141687.1|3326095_3326386_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	88.5	5.3e-45
WP_004884194.1|3326378_3326549_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	65.5	7.2e-10
WP_004151288.1|3326548_3327004_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_023283338.1|3328580_3328793_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	43.9	2.4e-10
WP_032419573.1|3329216_3329465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151294.1|3329461_3329968_-	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_004151295.1|3329964_3330258_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_094819157.1|3330254_3331124_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	70.1	5.2e-96
WP_101307363.1|3331108_3331963_-	replication protein	NA	K7PGT1	Enterobacteria_phage	54.5	3.1e-61
WP_040182097.1|3332322_3332544_-	helix-turn-helix domain-containing protein	NA	Q716D6	Shigella_phage	55.1	1.8e-13
WP_029363661.1|3332646_3333342_+	helix-turn-helix transcriptional regulator	NA	K7P7I4	Enterobacteria_phage	62.4	8.2e-76
WP_129111273.1|3333361_3333796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008807814.1|3334258_3334465_+	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_094819107.1|3334544_3335516_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	91.0	1.8e-65
WP_004135670.1|3335523_3335721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158225006.1|3335717_3335876_+	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	57.8	4.5e-06
WP_094819108.1|3335872_3336526_+	single-stranded DNA-binding protein	NA	A0A1W6JP21	Morganella_phage	61.8	3.3e-63
WP_064179354.1|3336509_3336800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024622733.1|3336796_3337102_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094819109.1|3337098_3337626_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.6	4.9e-57
WP_094819110.1|3337622_3338393_+	dcm methylase	NA	D5LH17	Escherichia_phage	52.0	4.2e-65
WP_004151314.1|3338389_3338608_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_094819111.1|3338609_3338825_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	48.1	1.9e-07
WP_016244760.1|3338984_3339230_+	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	93.4	3.8e-36
WP_021312745.1|3339272_3340535_+|integrase	site-specific integrase	integrase	A0A286S1S8	Klebsiella_phage	95.0	1.7e-233
WP_004152314.1|3340775_3341582_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004175494.1|3341596_3342892_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	9.6e-62
3342282:3342297	attR	ATGAACGGAACAATCA	NA	NA	NA	NA
WP_004189341.1|3343195_3344122_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004189338.1|3344220_3344697_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004148802.1|3344746_3346390_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
>prophage 9
NZ_CP025461	Klebsiella pneumoniae strain F44 chromosome, complete genome	5460465	3618387	3630819	5460465	transposase	Escherichia_phage(44.44%)	12	NA	NA
WP_062955125.1|3618387_3619719_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.1	6.9e-15
WP_062955124.1|3619708_3620542_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000019473.1|3621245_3622226_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_094940778.1|3622271_3622601_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_015958693.1|3622687_3623242_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
WP_048996045.1|3623256_3624147_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	3.7e-28
WP_063002077.1|3624178_3625048_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
WP_073547076.1|3625061_3626126_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	2.6e-105
WP_062955151.1|3626965_3627970_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.2	4.0e-31
WP_016947628.1|3628370_3628490_+	small membrane protein	NA	NA	NA	NA	NA
WP_000704907.1|3628918_3630085_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_004175260.1|3630264_3630819_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
>prophage 10
NZ_CP025461	Klebsiella pneumoniae strain F44 chromosome, complete genome	5460465	3676022	3682928	5460465	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_062955084.1|3676022_3677501_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
WP_004175198.1|3677497_3678220_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004144192.1|3678538_3679900_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_002912636.1|3680145_3681039_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004899467.1|3681280_3682054_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004175147.1|3682064_3682928_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 11
NZ_CP025461	Klebsiella pneumoniae strain F44 chromosome, complete genome	5460465	3985377	4067068	5460465	transposase,integrase,terminase,holin,tail,tRNA,protease	Salmonella_phage(35.71%)	82	3991019:3991036	4066057:4066074
WP_004152006.1|3985377_3987381_-|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
WP_002913800.1|3987390_3988266_-	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
WP_002913801.1|3988385_3989099_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	1.1e-38
WP_002913802.1|3989314_3990349_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_002913803.1|3990365_3991244_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
3991019:3991036	attL	CAGCGATAACCGGAATAC	NA	NA	NA	NA
WP_004145648.1|3991331_3991964_+	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
WP_002913805.1|3991967_3992438_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_002913806.1|3992499_3993561_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002913807.1|3993783_3995247_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
WP_002913810.1|3995256_3995616_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_002913812.1|3995743_3996655_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
WP_020947395.1|3996651_3997353_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_002913824.1|3997451_3998738_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
WP_002913827.1|3998833_3999460_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002913829.1|3999677_4001111_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002913833.1|4001120_4002014_-	ROK family protein	NA	NA	NA	NA	NA
WP_002913836.1|4002277_4003315_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
WP_004152007.1|4003311_4003953_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	1.2e-28
WP_002913838.1|4004133_4006194_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_002913839.1|4006197_4007730_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_002913841.1|4007783_4010012_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_002913843.1|4010364_4010556_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	79.3	3.3e-19
WP_002913846.1|4010652_4011540_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002913847.1|4011637_4012870_+	MFS transporter	NA	NA	NA	NA	NA
WP_004162150.1|4013163_4014342_+	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_004152009.1|4014325_4016194_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
WP_062955008.1|4016380_4016881_-	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	76.9	1.3e-59
WP_062955009.1|4016877_4017507_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.9	1.8e-90
WP_023339240.1|4017496_4017802_-|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	2.7e-39
WP_062955010.1|4017788_4018193_-	hypothetical protein	NA	T1SA79	Salmonella_phage	81.1	8.7e-54
WP_077265603.1|4018279_4019596_-	right-handed parallel beta-helix repeat-containing protein	NA	A0A0K2FI18	Enterobacter_phage	32.3	2.3e-34
WP_000608644.1|4020704_4021967_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_073547080.1|4022835_4023816_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.5e-184
WP_153233543.1|4023797_4025063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062955131.1|4025103_4025367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062955133.1|4028194_4028491_+	hypothetical protein	NA	T1SA06	Salmonella_phage	63.9	6.9e-24
WP_062955135.1|4028967_4031724_-	hypothetical protein	NA	Q858F8	Salmonella_phage	95.4	0.0e+00
WP_062955136.1|4031723_4033634_-	hypothetical protein	NA	Q858F9	Salmonella_phage	82.7	5.4e-287
WP_062955137.1|4033633_4036168_-	hypothetical protein	NA	Q858G0	Salmonella_phage	84.1	0.0e+00
WP_032447858.1|4036178_4036718_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	8.0e-71
WP_004152438.1|4036717_4037182_-	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
WP_062955138.1|4037181_4039659_-	hypothetical protein	NA	Q858G3	Salmonella_phage	84.4	0.0e+00
WP_062955139.1|4039658_4040264_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	77.0	4.0e-87
WP_004152441.1|4040263_4040587_-	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
WP_062955141.1|4040637_4040979_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	2.4e-36
WP_020953461.1|4040989_4041427_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.7	1.3e-66
WP_004200546.1|4041480_4042467_-	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	94.2	2.5e-179
WP_032441397.1|4042481_4043162_-	peptidase	NA	G9L6C4	Escherichia_phage	84.0	6.1e-76
WP_004152446.1|4043164_4043461_-	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
WP_032441398.1|4043457_4045140_-|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.4	1.5e-264
WP_004141368.1|4045154_4045361_-	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_004200550.1|4046114_4046486_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	91.9	3.7e-59
WP_062955142.1|4046529_4048005_-	hypothetical protein	NA	Q858H3	Salmonella_phage	93.1	6.4e-280
WP_032441400.1|4048001_4048586_-|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	2.2e-90
WP_032418540.1|4048663_4048921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|4049324_4050809_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_023339258.1|4050905_4051244_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	1.8e-44
WP_032441458.1|4051236_4051440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050491799.1|4051439_4052060_-	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	40.7	1.0e-29
WP_029602865.1|4052056_4052350_-	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	86.6	2.7e-44
WP_072200041.1|4052349_4052817_-	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	51.7	1.3e-37
WP_032441401.1|4053110_4053755_-	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	79.3	8.0e-110
WP_032441402.1|4053751_4053943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062955107.1|4053926_4054337_-	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	45.1	4.3e-16
WP_048328152.1|4054529_4054877_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	6.5e-50
WP_032418532.1|4054996_4055782_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
WP_004207253.1|4055778_4056546_-	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_004152537.1|4056545_4056755_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004152538.1|4056901_4057135_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004144290.1|4057289_4057871_+	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
WP_004164029.1|4058237_4058537_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_062955106.1|4058533_4059355_+	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	80.2	1.8e-130
WP_062955105.1|4059351_4060233_+	recombinase RecT	NA	T1SBJ5	Salmonella_phage	84.3	8.9e-136
WP_062955104.1|4060281_4060530_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	76.8	4.9e-31
WP_009485475.1|4060639_4060933_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
WP_048264082.1|4060925_4061084_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.1e-17
WP_062955103.1|4061080_4061743_+	hypothetical protein	NA	A0A059VF56	Pseudomonas_phage	46.6	1.2e-47
WP_004197356.1|4061739_4062333_+	MT-A70 family protein	NA	T1SA14	Salmonella_phage	91.9	6.3e-109
WP_063002073.1|4062329_4062572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062955102.1|4062514_4063765_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	84.4	5.8e-205
WP_004151979.1|4063956_4065534_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004151980.1|4065601_4067068_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
4066057:4066074	attR	CAGCGATAACCGGAATAC	NA	NA	NA	NA
>prophage 12
NZ_CP025461	Klebsiella pneumoniae strain F44 chromosome, complete genome	5460465	4138418	4220920	5460465	transposase,integrase,coat,terminase,portal,plate,tail,tRNA,capsid,lysis,head	Salmonella_phage(70.0%)	87	4183107:4183153	4221460:4221506
WP_002914079.1|4138418_4139156_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_002914082.1|4139287_4140619_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
WP_002914084.1|4140664_4141048_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_002914088.1|4141361_4142051_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
WP_002914089.1|4142108_4143194_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914091.1|4143397_4143823_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_002914092.1|4143892_4144591_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_004188841.1|4144625_4147277_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_002914094.1|4147397_4148753_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002914095.1|4148794_4149118_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_002914097.1|4149121_4150420_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
WP_004150973.1|4156379_4158953_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
WP_002914109.1|4159082_4159814_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_002914110.1|4159810_4160791_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_004145664.1|4160922_4161660_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002914111.1|4161930_4162266_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100250063.1|4162372_4162420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150975.1|4162520_4163681_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_002914112.1|4163677_4164550_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_002914113.1|4164612_4165734_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002914114.1|4165743_4166814_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
WP_004174804.1|4167156_4167666_+	YfiR family protein	NA	NA	NA	NA	NA
WP_002914116.1|4167658_4168882_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_002914117.1|4168895_4169378_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002914118.1|4169386_4170757_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_002914119.1|4170813_4171272_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914145.1|4171391_4171739_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002914147.1|4171778_4172546_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004150977.1|4172577_4173126_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914149.1|4173144_4173393_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002914152.1|4173652_4175017_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914153.1|4175180_4175972_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004149392.1|4175991_4177278_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914155.1|4177397_4177988_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002914158.1|4178112_4178991_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914159.1|4179077_4180739_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914160.1|4180886_4181228_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914161.1|4181294_4181585_-	RnfH family protein	NA	NA	NA	NA	NA
WP_004188817.1|4181574_4182051_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914164.1|4182161_4182644_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
4183107:4183153	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
WP_004150980.1|4183247_4183625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150981.1|4183652_4183871_-	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150982.1|4183937_4185032_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150983.1|4185028_4185514_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150984.1|4185510_4188141_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
WP_002896220.1|4188133_4188253_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150985.1|4188267_4188567_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_004150986.1|4188619_4189135_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150987.1|4189144_4190317_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150988.1|4190465_4191539_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004200602.1|4191590_4192709_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150990.1|4192718_4194668_-|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004152935.1|4194669_4195341_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150992.1|4195333_4196242_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004150993.1|4196228_4196591_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150994.1|4196587_4197160_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150995.1|4197254_4198121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150996.1|4198143_4198590_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150997.1|4198582_4199005_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150998.1|4199100_4199529_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_004150999.1|4199525_4199909_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004151000.1|4199913_4200423_-	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004134639.1|4200403_4200619_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151001.1|4200622_4200826_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004151002.1|4200825_4201290_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004134644.1|4201385_4202039_-|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151003.1|4202042_4203095_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004151004.1|4203111_4203945_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_019405037.1|4204085_4205849_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151006.1|4205848_4206892_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_024940854.1|4206948_4207218_-	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151007.1|4207739_4208741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|4208740_4209820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151009.1|4209806_4210490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151010.1|4210585_4210819_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151011.1|4210830_4211019_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151012.1|4213089_4215474_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004151013.1|4215470_4216322_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151014.1|4216318_4216546_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151016.1|4216545_4216779_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004144796.1|4216846_4217185_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151017.1|4217148_4217349_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004151018.1|4217356_4217866_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_001397669.1|4217898_4218141_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151019.1|4218263_4218893_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_062955148.1|4218895_4219894_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	94.5	2.2e-183
WP_000019473.1|4219939_4220920_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
4221460:4221506	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
>prophage 13
NZ_CP025461	Klebsiella pneumoniae strain F44 chromosome, complete genome	5460465	4940735	4989578	5460465	terminase,portal,tail,protease,tRNA,capsid,head	uncultured_Caudovirales_phage(66.67%)	55	NA	NA
WP_002918465.1|4940735_4941230_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
WP_002918467.1|4941233_4941872_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_135801240.1|4941841_4942126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000829818.1|4942183_4942576_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002918559.1|4942591_4943020_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004144945.1|4943285_4944413_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918565.1|4944603_4945002_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_062954970.1|4945175_4946543_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918568.1|4946630_4947689_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_002918570.1|4947825_4948764_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918625.1|4949178_4949649_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002918626.1|4950024_4950288_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918627.1|4950386_4950653_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918629.1|4950703_4950979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918632.1|4951058_4953026_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918639.1|4953031_4953964_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918640.1|4953971_4954175_-	AaeX family protein	NA	NA	NA	NA	NA
WP_002918641.1|4954306_4955236_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002918642.1|4955271_4956717_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_004150952.1|4956805_4960603_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_002918644.1|4960640_4962110_-	ribonuclease G	NA	NA	NA	NA	NA
WP_002918646.1|4962112_4962694_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918648.1|4962701_4963190_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004149974.1|4963189_4964182_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918653.1|4964252_4965296_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_002918686.1|4965601_4967542_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002918687.1|4967621_4967813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918688.1|4968041_4969043_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_002918689.1|4969042_4969651_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_002918732.1|4969874_4970327_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_002918736.1|4970349_4970817_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002918738.1|4970827_4972177_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918740.1|4972287_4972530_+	YhdT family protein	NA	NA	NA	NA	NA
WP_002918742.1|4972519_4973971_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_002918745.1|4973982_4974864_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_004144972.1|4975221_4976187_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|4976211_4976508_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_004150954.1|4976661_4976853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150955.1|4976855_4978517_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_000113647.1|4978500_4978857_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150959.1|4979132_4979576_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_001547824.1|4979575_4979875_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150961.1|4979871_4980207_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_004150962.1|4980203_4981445_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_001547826.1|4981446_4982007_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_001549743.1|4982058_4983225_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_004150963.1|4983488_4984001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150964.1|4984049_4984385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|4984727_4986863_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_001549749.1|4986862_4987228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|4987224_4987593_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_004150967.1|4987589_4987904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549752.1|4987896_4988085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918304.1|4988077_4988347_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_004150969.1|4988798_4989578_-	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
>prophage 1
NZ_CP025462	Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence	261706	0	24926	261706		Clostridioides_phage(100.0%)	15	NA	NA
WP_004196338.1|1974_2331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181922.1|3219_3525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196345.1|3575_7544_-	traG-like region family protein	NA	NA	NA	NA	NA
WP_004181920.1|7545_8901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196361.1|8944_9982_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_004196331.1|10347_10890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032438005.1|10906_11431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071528223.1|11623_12037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026319.1|12976_13441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196318.1|13440_14229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032438004.1|14242_17191_+	conjugal transfer protein TraI	NA	NA	NA	NA	NA
WP_032438003.1|17180_19307_+	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_004181912.1|19309_20407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181910.1|20419_21094_+	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_004181907.1|24152_24926_+	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	48.0	5.1e-10
>prophage 2
NZ_CP025462	Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence	261706	30832	33278	261706	transposase	uncultured_Caudovirales_phage(66.67%)	4	NA	NA
WP_000323025.1|30832_31120_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|31119_31359_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_100280317.1|31383_31578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085929673.1|32110_33278_+|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.1	1.9e-178
>prophage 3
NZ_CP025462	Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence	261706	38641	41905	261706		Cronobacter_phage(33.33%)	3	NA	NA
WP_004181894.1|38641_39913_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	58.3	3.9e-140
WP_004181893.1|39912_40335_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.3	6.3e-31
WP_004152765.1|40420_41905_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
>prophage 4
NZ_CP025462	Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence	261706	44922	46797	261706		Bacillus_phage(100.0%)	1	NA	NA
WP_016947078.1|44922_46797_-	DEAD/DEAH box helicase	NA	A0A127AW80	Bacillus_phage	27.1	5.2e-08
>prophage 5
NZ_CP025462	Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence	261706	50960	63265	261706		Escherichia_phage(30.77%)	18	NA	NA
WP_065953872.1|50960_52202_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	28.9	6.7e-12
WP_014386579.1|53086_53542_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_004026394.1|53829_54438_-	hypothetical protein	NA	K4JV11	Caulobacter_phage	42.2	1.5e-25
WP_004026395.1|54507_54957_-	hypothetical protein	NA	A0A1I9KFG8	Aeromonas_phage	45.2	2.9e-18
WP_004026399.1|55724_55997_-	hypothetical protein	NA	I7B2L9	Escherichia_phage	50.0	2.5e-12
WP_016947069.1|56266_56452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099743439.1|56451_57054_-	DUF551 domain-containing protein	NA	A0A1V0E5M5	Salmonella_phage	31.1	2.1e-19
WP_016947068.1|57137_57620_-	hypothetical protein	NA	A0A077SLK5	Escherichia_phage	58.3	4.4e-12
WP_153236429.1|57956_58292_-	hypothetical protein	NA	J9Q804	Salmonella_phage	51.4	3.3e-14
WP_004197183.1|58375_58591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197228.1|58870_59257_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	85.1	3.7e-17
WP_101992385.1|59673_60318_-	hypothetical protein	NA	A0A0U4JEF1	Pseudomonas_phage	38.3	6.3e-06
WP_004026413.1|61019_61208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016947066.1|61204_61702_-	hypothetical protein	NA	A0A076G835	Escherichia_phage	55.9	6.3e-22
WP_004026415.1|61794_62013_-	hypothetical protein	NA	R9TRD3	Aeromonas_phage	66.7	4.4e-20
WP_004197205.1|62178_62430_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	76.7	1.9e-22
WP_004026416.1|62550_62865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026417.1|62944_63265_-	hypothetical protein	NA	J9Q750	Salmonella_phage	50.9	2.2e-28
>prophage 6
NZ_CP025462	Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence	261706	69970	72822	261706		Salmonella_phage(50.0%)	2	NA	NA
WP_004181841.1|69970_71059_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	41.4	4.4e-60
WP_014386487.1|72030_72822_-	hypothetical protein	NA	A0A219UQS0	Bacillus_phage	32.5	1.4e-10
>prophage 7
NZ_CP025462	Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence	261706	76558	84921	261706		Burkholderia_phage(28.57%)	12	NA	NA
WP_004181829.1|76558_76876_-	DUF3846 domain-containing protein	NA	A0A2H4P7A4	Pseudomonas_phage	46.5	6.0e-10
WP_004181828.1|76903_77152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026461.1|77729_78932_+	type II restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.1	1.1e-35
WP_004026463.1|79021_80437_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	3.1e-106
WP_004026464.1|80563_81307_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	49.6	1.8e-60
WP_004026465.1|81303_81738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026466.1|81770_82031_-	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	41.0	5.9e-11
WP_101850617.1|82284_82728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196726.1|82958_83318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048995652.1|83502_83913_-	hypothetical protein	NA	Q71TH9	Escherichia_phage	60.0	1.0e-41
WP_004181824.1|84037_84352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101850616.1|84342_84921_-	HNH endonuclease	NA	W0LI46	Edwardsiella_phage	57.6	1.2e-40
>prophage 8
NZ_CP025462	Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence	261706	97176	98424	261706		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004181813.1|97176_98424_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	23.0	1.4e-12
>prophage 9
NZ_CP025462	Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence	261706	106349	107528	261706		Salmonella_phage(100.0%)	1	NA	NA
WP_004196657.1|106349_107528_-	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	33.0	9.1e-19
>prophage 10
NZ_CP025462	Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence	261706	137576	175918	261706	transposase,integrase	Enterobacteria_phage(25.0%)	38	132382:132397	180909:180924
132382:132397	attL	CGAGAAAGGATTCATT	NA	NA	NA	NA
WP_040209642.1|137576_138764_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	78.0	3.5e-143
WP_077257669.1|138799_139228_+|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	54.6	1.6e-34
WP_040209639.1|139801_141028_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	76.9	1.7e-153
WP_004181778.1|141181_141466_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	59.1	4.7e-22
WP_004181777.1|141455_141704_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_004181776.1|141994_143794_+	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	23.1	1.8e-26
WP_101992392.1|144127_145114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181774.1|145258_145612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181772.1|145673_146495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181771.1|146522_147575_+	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_004026538.1|147671_148748_+	DUF3150 domain-containing protein	NA	NA	NA	NA	NA
WP_004181768.1|152153_152384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181767.1|152494_153739_+	topoisomerase	NA	A0A0H5AWB1	Pseudomonas_phage	25.5	1.8e-09
WP_004181766.1|153807_154347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181765.1|154491_154710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181763.1|155297_155540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181762.1|155587_156052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032409750.1|156061_156469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014386528.1|156511_157471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181760.1|157467_158226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016946351.1|158222_158552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026552.1|158696_159014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014386529.1|159079_160216_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_101992394.1|160301_161378_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_158295209.1|161289_161793_-	maturase	NA	NA	NA	NA	NA
WP_016946352.1|162305_162560_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_014386530.1|162645_163713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136537796.1|163931_164216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101992395.1|165112_165997_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	42.8	7.5e-50
WP_000429836.1|167996_168431_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|168502_168853_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|168866_169142_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|169177_169600_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_001277456.1|171365_171728_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|171724_171961_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000204520.1|171957_172665_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|174055_174760_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_101992396.1|174871_175918_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
180909:180924	attR	CGAGAAAGGATTCATT	NA	NA	NA	NA
>prophage 11
NZ_CP025462	Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence	261706	179197	205616	261706	transposase	Escherichia_phage(44.44%)	19	NA	NA
WP_001389365.1|179197_179962_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000130000.1|180188_180494_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|180504_181710_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000427619.1|181937_182942_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|183467_184328_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000971921.1|185148_186519_-|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
WP_000080861.1|186633_187770_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_001330846.1|187820_188066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|188071_188263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587837.1|188744_189287_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|189299_190160_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001067855.1|190392_191097_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002903955.1|192730_193633_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_001067855.1|195670_196375_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004144375.1|198082_198943_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	21.7	9.0e-08
WP_077274495.1|199784_202748_-|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	22.7	5.1e-50
WP_004210220.1|202761_203289_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_004210218.1|203401_204415_+	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	26.0	5.8e-06
WP_004225018.1|204620_205616_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.7	3.1e-20
>prophage 12
NZ_CP025462	Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence	261706	221125	221386	261706		Erwinia_phage(100.0%)	1	NA	NA
WP_004213925.1|221125_221386_-	DUF1471 domain-containing protein	NA	A0A1B2IE60	Erwinia_phage	51.0	1.1e-06
>prophage 13
NZ_CP025462	Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence	261706	233130	233640	261706		Synechococcus_phage(100.0%)	1	NA	NA
WP_004145290.1|233130_233640_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	8.8e-19
>prophage 14
NZ_CP025462	Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence	261706	238535	241737	261706		Vibrio_phage(50.0%)	3	NA	NA
WP_004214541.1|238535_239465_+	hypothetical protein	NA	A0A140B3P3	Vibrio_phage	25.2	1.5e-11
WP_004214540.1|239481_240306_-	DUF1460 domain-containing protein	NA	NA	NA	NA	NA
WP_011251272.1|240735_241737_+	TGS domain-containing protein	NA	A0A2K9L6B6	Tupanvirus	41.5	9.7e-54
>prophage 15
NZ_CP025462	Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence	261706	249498	250983	261706		Pseudomonas_phage(100.0%)	1	NA	NA
WP_004194318.1|249498_250983_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.1	1.1e-29
>prophage 1
NZ_CP025463	Klebsiella pneumoniae strain F44 plasmid p44-2, complete sequence	161580	10889	63707	161580	transposase,integrase	Escherichia_phage(27.27%)	58	19486:19501	53839:53854
WP_013609528.1|10889_11963_+|transposase	IS481-like element ISKpn28 family transposase	transposase	NA	NA	NA	NA
WP_014343510.1|12146_12521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013023807.1|12576_12903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568058.1|12899_13628_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001568057.1|13624_14056_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_015493064.1|14100_16158_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.4	1.2e-21
WP_001568055.1|16227_16476_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_014343512.1|16524_17067_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	4.6e-50
WP_014343514.1|17899_18463_-	methyltransferase	NA	A0A2I7RHK4	Vibrio_phage	34.3	7.4e-19
WP_014343515.1|18510_19866_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
19486:19501	attL	CGGCTGTCCCAGCGGG	NA	NA	NA	NA
WP_001568051.1|19917_20148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568050.1|20239_20467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568049.1|21146_21467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977779.1|21501_21756_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	48.8	4.0e-12
WP_001568047.1|21943_22135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013214014.1|22177_22684_-	antirestriction protein	NA	G9FHQ1	Rhodococcus_virus	31.4	1.2e-07
WP_013023797.1|22726_23392_-	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_013214013.1|23835_24603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568043.1|24656_25076_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001568042.1|25085_25307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568041.1|25306_26008_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
WP_001568040.1|26444_26675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013214012.1|26737_27409_-	mediator of plasmid stability	NA	NA	NA	NA	NA
WP_004152353.1|27411_28383_-	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_004152765.1|28631_30116_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_001568036.1|30525_30957_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_013214011.1|30956_32228_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	7.5e-152
WP_086523286.1|32309_33287_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.8	1.4e-86
WP_011977818.1|33283_34489_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	5.3e-163
WP_004118283.1|35598_36465_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_013214010.1|37242_37500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013214009.1|37545_38325_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.4e-52
WP_011977814.1|38508_39513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977813.1|39542_39746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013214008.1|39791_40313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032738650.1|40370_40721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977810.1|40799_41744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261282.1|42322_42553_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044770.1|42549_42966_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_004206609.1|43039_44602_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000361404.1|44586_45609_+	helicase UvrD	NA	NA	NA	NA	NA
WP_000427619.1|47142_48147_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000429836.1|48225_48660_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|48731_49082_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|49095_49371_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|49406_49829_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|49880_51575_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|51592_51955_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|51951_52188_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000204520.1|52184_52892_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|54203_54908_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
53839:53854	attR	CCCGCTGGGACAGCCG	NA	NA	NA	NA
WP_014343468.1|54947_55421_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	99.3	3.3e-76
WP_013213985.1|55543_56524_+|transposase	IS481-like element ISKpn27 family transposase	transposase	A8RHK4	Spiroplasma_virus	27.4	2.9e-10
WP_004199234.1|56799_57681_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_013213989.1|59540_59966_-	antirestriction protein	NA	A0A2D0W8Z5	Bordetella_virus	37.3	5.3e-17
WP_013213990.1|60076_60355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001161490.1|61897_62458_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001067855.1|63002_63707_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
NZ_CP025463	Klebsiella pneumoniae strain F44 plasmid p44-2, complete sequence	161580	70943	122706	161580	protease,transposase	Escherichia_phage(42.86%)	55	NA	NA
WP_001067855.1|70943_71648_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|72061_72766_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_015059014.1|73176_73698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000412447.1|73760_74069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830838.1|74095_75088_-	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_001203735.1|75084_75717_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_015059013.1|75713_76100_-	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
WP_015059012.1|76096_78724_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_001278692.1|78883_79105_-	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	39.4	4.4e-07
WP_062955122.1|79239_79755_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_001038341.1|79751_80003_-	conjugal transfer protein TrbG	NA	NA	NA	NA	NA
WP_001352845.1|80014_80245_-	conjugal transfer protein TrbD	NA	NA	NA	NA	NA
WP_000002778.1|80198_80789_-	conjugal transfer protein TraP	NA	NA	NA	NA	NA
WP_032297072.1|80778_82206_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_072095570.1|82205_82910_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_000399794.1|82920_83487_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_000012106.1|83508_83820_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_021519752.1|83834_84200_-	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_001254386.1|84233_84461_-	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_015059009.1|84554_85241_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_000124981.1|85431_85815_-	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_015059008.1|86091_86739_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_001234445.1|87035_87857_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	3.4e-44
WP_001272251.1|87967_88264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312861.1|89178_89337_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001276217.1|89616_90336_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845953.1|90332_90767_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_000006003.1|92919_93153_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000290834.1|93210_93738_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	6.0e-47
WP_015059007.1|94580_95144_-	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	6.1e-21
WP_000170695.1|95190_96552_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_000218642.1|96603_96834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012372796.1|98233_99901_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.3	1.7e-164
WP_001027493.1|100214_100406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271762.1|100402_100825_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001198928.1|100871_101297_-	antirestriction protein	NA	NA	NA	NA	NA
WP_011161242.1|101269_101842_-	YubH family protein	NA	NA	NA	NA	NA
WP_000274503.1|102541_102976_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104881.1|102989_103211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000085883.1|103211_103895_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	5.6e-29
WP_032146011.1|103971_104265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000959884.1|104411_105374_+	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
WP_000361389.1|105376_105727_+	protein stbB	NA	NA	NA	NA	NA
WP_001333089.1|105849_106131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071557810.1|107941_108082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|108072_108777_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_012372818.1|109226_109982_-	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_064441864.1|111195_111732_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	2.8e-84
WP_000957857.1|111823_112012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012579081.1|116964_117888_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
WP_013188475.1|117967_118843_-	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_001067855.1|119353_120058_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001398199.1|121368_121770_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|121702_121960_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|122052_122706_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP025463	Klebsiella pneumoniae strain F44 plasmid p44-2, complete sequence	161580	140638	154444	161580	transposase	Enterobacteria_phage(18.18%)	18	NA	NA
WP_000019445.1|140638_141619_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_015493087.1|142132_142528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493086.1|142524_143136_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_015493085.1|143132_144083_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.6	6.6e-76
WP_040219232.1|144229_144430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022652286.1|144483_145116_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.9	2.5e-07
WP_015493083.1|145478_146684_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.2	1.1e-205
WP_016479949.1|146680_147652_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.9	1.4e-113
WP_015493081.1|147787_149059_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.0	6.1e-154
WP_015493080.1|149058_149481_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
WP_015493079.1|149660_150332_-	Gifsy-2 prophage protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.7	5.1e-83
WP_002211749.1|150690_151368_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
WP_015493077.1|151367_151589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493076.1|151599_152019_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_015493075.1|152072_152852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493074.1|153256_153763_+	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	31.8	4.8e-09
WP_015493073.1|153805_153997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032072906.1|154183_154444_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	46.2	4.1e-12
