The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016491	Lactobacillus pentosus strain BGM48 chromosome, complete genome	3591251	371489	415600	3591251	bacteriocin,transposase,protease	Lactococcus_phage(40.0%)	37	NA	NA
WP_101872747.1|371489_372053_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_021338166.1|372246_372915_+	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_021338165.1|373260_374766_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_101872748.1|375059_375428_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_003637580.1|375670_376180_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_101872749.1|376210_377407_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_088770144.1|377517_377988_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_101872750.1|378595_379204_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_021338160.1|379466_380387_-	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_101872751.1|380523_381435_+	oxidoreductase	NA	NA	NA	NA	NA
WP_101872752.1|381492_381939_-	ribonuclease H	NA	NA	NA	NA	NA
WP_065674456.1|383053_384580_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_050337792.1|384579_385551_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	3.3e-22
WP_050337791.1|385647_386979_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_158296953.1|387525_387693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088770138.1|388412_389930_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_050337788.1|389944_391774_+	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_081484832.1|391788_392511_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	32.3	4.1e-30
WP_003637596.1|392644_393262_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_101872753.1|393265_394411_-	MFS transporter	NA	NA	NA	NA	NA
WP_050337783.1|394414_395206_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_101872754.1|395275_396148_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_101872755.1|396307_397123_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_101872756.1|397609_398983_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_050337780.1|399025_400210_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_101872757.1|401220_401376_+|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_101872760.1|402870_404199_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_101872761.1|404199_404946_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_101872677.1|405630_406845_+|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	52.8	7.0e-115
WP_101872676.1|406849_407662_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	50.6	6.0e-62
WP_003637613.1|408139_409306_+	MFS transporter	NA	NA	NA	NA	NA
WP_101872762.1|409697_410849_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_101872763.1|410853_412074_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_158296954.1|412170_412383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101872764.1|412379_413153_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_004271307.1|413244_414168_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	6.7e-33
WP_101872765.1|414931_415600_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP016491	Lactobacillus pentosus strain BGM48 chromosome, complete genome	3591251	932834	941345	3591251		Synechococcus_phage(50.0%)	9	NA	NA
WP_050339689.1|932834_933317_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.4	1.7e-16
WP_101873046.1|933300_934431_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_101873047.1|934433_935165_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	39.9	4.9e-39
WP_101873048.1|935166_935421_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_088770896.1|935420_936101_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_088770897.1|936093_938313_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.0	9.1e-145
WP_088770898.1|938297_939752_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.2	1.1e-50
WP_101873049.1|939748_940774_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.0	3.2e-60
WP_101873050.1|940766_941345_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.4	3.1e-20
>prophage 3
NZ_CP016491	Lactobacillus pentosus strain BGM48 chromosome, complete genome	3591251	1188682	1218297	3591251	portal,head,tail,integrase,capsid,terminase,protease	Lactobacillus_phage(40.62%)	49	1187053:1187068	1226478:1226493
1187053:1187068	attL	TTTGAACAGTTTCTAA	NA	NA	NA	NA
WP_101873176.1|1188682_1189804_-|integrase	site-specific integrase	integrase	D6PSS4	Lactobacillus_phage	33.5	5.6e-50
WP_101873177.1|1190093_1191188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082606657.1|1191544_1191721_-	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	53.4	7.0e-08
WP_021732649.1|1191861_1192581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101873178.1|1193408_1193972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101873179.1|1193998_1195078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041153389.1|1195205_1195628_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	35.1	1.7e-12
WP_063204180.1|1195642_1196161_-	helix-turn-helix domain-containing protein	NA	S6C481	Thermus_phage	34.1	3.5e-15
WP_033608054.1|1196302_1196557_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JFN1	uncultured_Caudovirales_phage	41.3	1.5e-06
WP_101873180.1|1196553_1196751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101873181.1|1196747_1197020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101873182.1|1197191_1197401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063485773.1|1197430_1197661_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CNE2	Brevibacillus_phage	36.8	8.5e-06
WP_046811052.1|1197803_1198010_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_063485774.1|1198009_1198309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101873183.1|1198515_1198821_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_101873184.1|1198887_1199400_+	helix-turn-helix transcriptional regulator	NA	D6PST4	Lactobacillus_phage	42.9	4.0e-27
WP_162255282.1|1199500_1199638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_191982632.1|1199719_1200217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101873185.1|1200219_1201107_+	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	47.4	8.6e-62
WP_191982633.1|1201138_1201891_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	51.4	5.4e-73
WP_101873187.1|1202890_1203391_+	hypothetical protein	NA	O03915	Lactobacillus_phage	75.2	9.7e-71
WP_101873188.1|1203387_1203762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053267117.1|1203764_1204076_+	hypothetical protein	NA	A0A2P0ZLB4	Lactobacillus_phage	91.3	3.2e-48
WP_101873189.1|1204079_1204247_+	hypothetical protein	NA	A0A2P0ZLB5	Lactobacillus_phage	89.1	2.0e-17
WP_101874298.1|1204339_1204561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101873190.1|1204553_1204985_+	hypothetical protein	NA	K4I239	Lactobacillus_phage	55.8	1.4e-33
WP_101873191.1|1204981_1205449_+	DUF1642 domain-containing protein	NA	A0A2K9VCG9	Lactobacillus_phage	39.1	8.9e-18
WP_101873192.1|1205451_1205631_+	hypothetical protein	NA	A0A1S5RCW8	Lactobacillus_phage	94.5	3.0e-22
WP_063722325.1|1205812_1206280_+	hypothetical protein	NA	B4XYT9	Lactobacillus_phage	40.0	1.9e-15
WP_152705360.1|1206514_1206682_+	BC1881 family protein	NA	NA	NA	NA	NA
WP_101873193.1|1206678_1206888_-	KTSC domain-containing protein	NA	D2IZW7	Enterococcus_phage	49.3	5.2e-10
WP_101873194.1|1207230_1207488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021732633.1|1207702_1207972_+	DUF2829 domain-containing protein	NA	A0A0K2FLC4	Brevibacillus_phage	45.5	2.5e-12
WP_024002530.1|1208013_1208541_+|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	73.4	3.5e-55
WP_050339937.1|1208530_1209769_+|terminase	PBSX family phage terminase large subunit	terminase	M1PG09	Streptococcus_phage	61.5	4.9e-140
WP_101873195.1|1209780_1211289_+|portal	phage portal protein	portal	V5US18	Oenococcus_phage	51.4	1.5e-135
WP_033609661.1|1211218_1211515_+|protease	ribosomal-processing cysteine protease Prp	protease	D2J003	Enterococcus_phage	40.2	1.1e-10
WP_101873196.1|1213059_1213737_+	DUF4355 domain-containing protein	NA	Q6SE80	Lactobacillus_prophage	31.2	8.7e-14
WP_021732628.1|1213751_1214102_+	hypothetical protein	NA	V5UTH9	Oenococcus_phage	63.8	4.5e-30
WP_003642819.1|1214121_1215144_+|capsid	major capsid protein	capsid	V5US24	Oenococcus_phage	62.5	3.7e-117
WP_003642820.1|1215156_1215333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024971556.1|1215344_1215677_+|head,tail	phage head-tail connector protein	head,tail	V9QJ97	Oenococcus_phage	45.3	1.8e-12
WP_003642822.1|1215676_1216024_+	hypothetical protein	NA	V5US85	Oenococcus_phage	62.3	3.2e-36
WP_101873197.1|1216025_1216574_+	HK97 gp10 family phage protein	NA	V5URV0	Oenococcus_phage	62.4	1.9e-64
WP_050339942.1|1216577_1216943_+	hypothetical protein	NA	V5UQS4	Oenococcus_phage	54.2	3.6e-30
WP_101873198.1|1216951_1217428_+|tail	phage tail protein	tail	Q6SE73	Lactobacillus_prophage	59.4	2.3e-45
WP_033608825.1|1217527_1217926_+	hypothetical protein	NA	V9QJA0	Oenococcus_phage	74.0	6.6e-46
WP_031275283.1|1218033_1218297_+	hypothetical protein	NA	V9QKH3	Oenococcus_phage	65.4	2.3e-23
1226478:1226493	attR	TTAGAAACTGTTCAAA	NA	NA	NA	NA
>prophage 4
NZ_CP016491	Lactobacillus pentosus strain BGM48 chromosome, complete genome	3591251	1224075	1239784	3591251	holin	Lactobacillus_phage(55.56%)	13	NA	NA
WP_046947688.1|1224075_1224438_+	hypothetical protein	NA	V5UQS8	Oenococcus_phage	71.2	1.9e-44
WP_101873199.1|1224452_1229819_+	hypothetical protein	NA	Q6SE68	Lactobacillus_prophage	59.1	8.4e-144
WP_063964067.1|1229821_1230277_+	DUF1617 family protein	NA	A0A2P0ZLE0	Lactobacillus_phage	39.9	9.9e-22
WP_101873200.1|1230273_1230708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101874299.1|1230886_1232002_+	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	65.8	4.9e-30
WP_046811035.1|1232002_1232299_+	hypothetical protein	NA	A0A2H4PBA4	Lactobacillus_phage	75.5	1.3e-38
WP_101873201.1|1232285_1232663_+|holin	holin	holin	A0A2K9VCG4	Lactobacillus_phage	67.5	2.3e-16
WP_101873202.1|1233330_1233561_+	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	81.5	2.5e-05
WP_101873203.1|1233667_1234348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101873204.1|1234353_1235493_+	ImmA/IrrE family metallo-endopeptidase	NA	B6SBZ6	Clostridium_virus	27.7	1.8e-27
WP_003639245.1|1236071_1236278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050339411.1|1236682_1237543_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_050339410.1|1238053_1239784_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.0	7.6e-46
>prophage 5
NZ_CP016491	Lactobacillus pentosus strain BGM48 chromosome, complete genome	3591251	1555393	1643579	3591251	portal,tRNA,head,tail,integrase,capsid,terminase,transposase,protease	Lactobacillus_phage(79.25%)	97	1550630:1550648	1639889:1639907
1550630:1550648	attL	AACGTGCTGGTCACGGATG	NA	NA	NA	NA
WP_101873334.1|1555393_1555882_+	DUF2321 domain-containing protein	NA	Q6SEF3	Lactobacillus_prophage	42.5	1.1e-34
WP_101873335.1|1556009_1556216_-	transcriptional regulator	NA	A0A2P0ZL97	Lactobacillus_phage	89.7	1.8e-26
WP_101873336.1|1556530_1556908_+	helix-turn-helix transcriptional regulator	NA	A0A2P0ZLA1	Lactobacillus_phage	65.3	1.4e-42
WP_101873337.1|1557565_1558246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101873338.1|1558365_1558962_+|integrase	site-specific integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	53.2	5.6e-49
WP_016510998.1|1559314_1560478_-|integrase	site-specific integrase	integrase	B4XYR4	Lactobacillus_phage	36.5	9.2e-56
WP_003641358.1|1560937_1561138_-	hypothetical protein	NA	E9LUS6	Lactobacillus_phage	100.0	4.9e-26
WP_101873339.1|1561143_1561719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063489717.1|1561844_1562510_-	LexA family transcriptional regulator	NA	D7RWF2	Brochothrix_phage	48.2	9.3e-53
WP_063485462.1|1562665_1562890_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_101873340.1|1562903_1563674_+	phage antirepressor KilAC domain-containing protein	NA	E9LUT0	Lactobacillus_phage	96.5	2.9e-58
WP_069137014.1|1563687_1563915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025015699.1|1563930_1564152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101873341.1|1564209_1564470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065674473.1|1564612_1564852_+	tagatose-bisphosphate aldolase	NA	E9LUT6	Lactobacillus_phage	83.5	5.9e-34
WP_065674474.1|1564863_1565064_+	hypothetical protein	NA	E9LUT7	Lactobacillus_phage	87.9	1.1e-25
WP_101873342.1|1565075_1565303_+	hypothetical protein	NA	E9LUT9	Lactobacillus_phage	64.4	1.4e-08
WP_101873343.1|1565402_1565813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101873344.1|1565812_1566469_+	ERF family protein	NA	H9A0Y7	Staphylococcus_phage	32.8	8.4e-22
WP_101873345.1|1566469_1566874_+	single-stranded DNA-binding protein	NA	D6PSU2	Lactobacillus_phage	64.9	6.5e-41
WP_101873346.1|1566888_1567581_+	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	92.6	9.5e-125
WP_101874306.1|1567619_1568348_+	conserved phage C-terminal domain-containing protein	NA	A0A1P8BKE9	Lactococcus_phage	50.6	6.0e-61
WP_101873347.1|1568347_1569133_+	ATP-binding protein	NA	E9LUN6	Lactobacillus_phage	88.9	8.5e-130
WP_101873348.1|1569268_1569571_+	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	86.0	1.5e-42
WP_101873349.1|1569573_1569885_+	hypothetical protein	NA	A0A2P0ZLB4	Lactobacillus_phage	88.3	1.0e-46
WP_101873189.1|1569888_1570056_+	hypothetical protein	NA	A0A2P0ZLB5	Lactobacillus_phage	89.1	2.0e-17
WP_101874298.1|1570148_1570370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101873350.1|1570362_1570788_+	hypothetical protein	NA	K4I239	Lactobacillus_phage	57.8	1.5e-35
WP_101873351.1|1570869_1571037_+	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	87.2	8.1e-14
WP_054519274.1|1571102_1571540_+	transcriptional regulator	NA	E9LUP5	Lactobacillus_phage	45.8	2.1e-29
WP_013355638.1|1572009_1572180_+	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	96.4	3.3e-23
WP_191982638.1|1572190_1572661_+	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	91.7	1.3e-80
WP_056988427.1|1572878_1573337_+|terminase	phage terminase small subunit P27 family	terminase	E9LUP8	Lactobacillus_phage	96.7	6.1e-80
WP_101873353.1|1573339_1575238_+|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	96.8	0.0e+00
WP_003644528.1|1575227_1575422_+	DUF1056 family protein	NA	E9LUQ0	Lactobacillus_phage	98.4	7.4e-27
WP_033608487.1|1575424_1576618_+|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	98.7	9.0e-224
WP_101873354.1|1576595_1577354_+|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	94.0	6.1e-125
WP_101873355.1|1577353_1578586_+|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	92.1	6.5e-209
WP_101873356.1|1578658_1578991_+|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	89.8	3.8e-47
WP_101873357.1|1578980_1579328_+|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	73.0	1.6e-43
WP_101873358.1|1579330_1579738_+	HK97 gp10 family phage protein	NA	A0A2P0ZLE6	Lactobacillus_phage	92.4	1.3e-65
WP_101873359.1|1579737_1580118_+	DUF806 family protein	NA	A0A2P0ZLF4	Lactobacillus_phage	92.9	2.0e-60
WP_101873360.1|1580133_1580787_+|tail	phage tail protein	tail	A0A2P0ZLH1	Lactobacillus_phage	93.1	2.5e-111
WP_021336808.1|1580859_1581234_+|tail	phage tail assembly chaperone	tail	A0A2P0ZLH4	Lactobacillus_phage	94.4	1.6e-57
WP_021336809.1|1581272_1581464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101873361.1|1581495_1586286_+	peptidase M23	NA	A0A2P0ZLG0	Lactobacillus_phage	55.6	0.0e+00
WP_101873362.1|1586358_1588065_+|tail	phage tail family protein	tail	E9LUR2	Lactobacillus_phage	63.3	2.5e-219
WP_101873363.1|1588131_1590507_+|tail	phage tail protein	tail	E9LUR3	Lactobacillus_phage	69.3	0.0e+00
WP_101873364.1|1593449_1593773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162985027.1|1593776_1593938_+	hypothetical protein	NA	A0A2P0ZLG1	Lactobacillus_phage	94.3	6.1e-19
WP_101873365.1|1593921_1594983_+	hypothetical protein	NA	A0A2P0ZLF6	Lactobacillus_phage	87.8	2.1e-62
WP_101873366.1|1594979_1595192_+	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	75.4	1.2e-17
WP_101873367.1|1595203_1596376_+	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	86.9	2.8e-193
WP_003644510.1|1596375_1596639_+	hemolysin XhlA family protein	NA	E9LUR9	Lactobacillus_phage	100.0	2.0e-38
WP_021732300.1|1596650_1597028_+	prophage Lp2 protein 58	NA	A0A2K9VCG4	Lactobacillus_phage	63.8	2.8e-14
WP_101872676.1|1597656_1598469_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	50.6	6.0e-62
WP_101872677.1|1598473_1599688_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	52.8	7.0e-115
WP_158296982.1|1600186_1600348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158296983.1|1600690_1600852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088771296.1|1601093_1601288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101873368.1|1601419_1602361_-	glycosyltransferase family 2 protein	NA	V9QJB1	Oenococcus_phage	47.8	2.6e-77
WP_101873369.1|1602800_1603196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088771153.1|1603368_1603761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101873370.1|1603797_1604967_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_088771155.1|1605015_1605648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003638977.1|1605923_1606556_-	transcriptional repressor LexA	NA	B8R672	Lactobacillus_phage	32.8	4.8e-06
WP_031267439.1|1606687_1606945_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_021336711.1|1607042_1607279_+	YneF family protein	NA	NA	NA	NA	NA
WP_101873371.1|1607335_1607965_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_101873372.1|1608076_1608838_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_101874307.1|1609052_1609364_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_050338482.1|1609448_1610447_+	D-2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	34.5	3.9e-47
WP_101873373.1|1611912_1612110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050338484.1|1613079_1613802_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003638969.1|1614026_1614830_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_003638968.1|1614932_1615811_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_101872633.1|1615926_1617189_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_003638967.1|1617451_1618174_+	UMP kinase	NA	NA	NA	NA	NA
WP_003638966.1|1618175_1618739_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_101873374.1|1618858_1619638_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.1	4.0e-23
WP_050338486.1|1619653_1620439_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_088771159.1|1620475_1621753_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_101873375.1|1621791_1623501_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_050338488.1|1623876_1628190_+	PolC-type DNA polymerase III	NA	A0A1X9SH08	Bradyrhizobium_phage	33.5	7.7e-15
WP_050338489.1|1628665_1629142_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_056952311.1|1629162_1630425_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003638958.1|1630466_1630766_+	YlxR family protein	NA	NA	NA	NA	NA
WP_003638957.1|1630755_1631061_+	ribosomal L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_101873376.1|1631075_1633667_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.3	2.5e-21
WP_003638955.1|1633689_1634043_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_050338493.1|1635160_1636612_+	MFS transporter	NA	NA	NA	NA	NA
WP_101873377.1|1636604_1637774_+	chorismate synthase	NA	NA	NA	NA	NA
WP_101873378.1|1637783_1638311_+	amino acid biosynthesis protein	NA	NA	NA	NA	NA
WP_101873379.1|1638323_1639628_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_101873380.1|1639624_1640722_+	prephenate dehydrogenase	NA	NA	NA	NA	NA
1639889:1639907	attR	AACGTGCTGGTCACGGATG	NA	NA	NA	NA
WP_101874308.1|1640728_1641253_+	shikimate kinase	NA	NA	NA	NA	NA
WP_101873381.1|1642655_1643579_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP016491	Lactobacillus pentosus strain BGM48 chromosome, complete genome	3591251	2236090	2245345	3591251		Lactobacillus_phage(85.71%)	7	NA	NA
WP_101873701.1|2236090_2237086_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	40.5	4.6e-56
WP_101873703.1|2237658_2238219_-	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	84.9	1.3e-84
WP_101873704.1|2238316_2240755_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	89.5	0.0e+00
WP_101873705.1|2240759_2241374_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	94.1	1.0e-106
WP_101873706.1|2241664_2242612_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	86.0	2.4e-155
WP_101873707.1|2242980_2243964_+	peptidase S41	NA	A0A2P0ZL68	Lactobacillus_phage	60.7	4.4e-99
WP_191982641.1|2244187_2245345_-	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	61.5	1.3e-131
>prophage 7
NZ_CP016491	Lactobacillus pentosus strain BGM48 chromosome, complete genome	3591251	2265527	2372992	3591251	tRNA,portal,holin,head,tail,integrase,terminase,transposase,protease	Lactobacillus_phage(78.57%)	90	2287601:2287625	2326554:2326578
WP_101873721.1|2265527_2267216_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.7	3.4e-75
WP_101873722.1|2267489_2267936_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003638418.1|2268351_2268597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088769709.1|2268723_2270115_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_101874324.1|2270583_2272359_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_101873723.1|2272820_2274560_-	aryl-sulfate sulfotransferase	NA	NA	NA	NA	NA
WP_101873724.1|2274605_2275574_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_003638413.1|2275563_2276187_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	40.7	2.8e-27
WP_003638412.1|2276190_2277366_-	sulfate adenylyltransferase	NA	A0A2P1ELS9	Moumouvirus	32.5	1.2e-50
WP_101873725.1|2277343_2278975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101873726.1|2280474_2282781_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_101873727.1|2282795_2284652_+	bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_101873728.1|2284724_2285084_+	YisL family protein	NA	NA	NA	NA	NA
WP_101873729.1|2285197_2285677_-	GtrA family protein	NA	NA	NA	NA	NA
WP_050339988.1|2285823_2286837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088769716.1|2286996_2287422_+	hypothetical protein	NA	NA	NA	NA	NA
2287601:2287625	attL	CCCCAGGCAGGATTCGAACCTGTAC	NA	NA	NA	NA
WP_101873730.1|2288087_2288618_-|holin	holin	holin	E9LUS0	Lactobacillus_phage	98.8	6.3e-36
WP_101873731.1|2288629_2288893_-	hemolysin XhlA family protein	NA	E9LUR9	Lactobacillus_phage	94.3	1.2e-35
WP_101873732.1|2288892_2290074_-	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	88.5	5.5e-197
WP_164886062.1|2290835_2290997_-	hypothetical protein	NA	A0A2P0ZLG1	Lactobacillus_phage	96.2	2.3e-18
WP_101873733.1|2291000_2291243_-	hypothetical protein	NA	A0A2P0ZLG3	Lactobacillus_phage	97.1	6.4e-28
WP_191982612.1|2291235_2293962_-	hypothetical protein	NA	A0A2P0ZLG5	Lactobacillus_phage	89.4	1.1e-189
WP_101873734.1|2293978_2296393_-	hypothetical protein	NA	A0A2P0ZLF8	Lactobacillus_phage	91.9	0.0e+00
WP_101873735.1|2296459_2298232_-|tail	phage tail family protein	tail	A0A2P0ZLH2	Lactobacillus_phage	92.7	1.4e-308
WP_003561820.1|2301764_2302643_+|transposase	IS982-like element ISLpl4 family transposase	transposase	NA	NA	NA	NA
WP_101873736.1|2304240_2304426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101873737.1|2304470_2304845_-|tail	phage tail assembly chaperone	tail	A0A2P0ZLH4	Lactobacillus_phage	93.5	5.0e-56
WP_101873738.1|2304920_2305577_-|tail	phage tail protein	tail	A0A2P0ZLH1	Lactobacillus_phage	90.9	3.9e-104
WP_101873739.1|2305592_2305973_-	DUF806 family protein	NA	A0A2P0ZLF4	Lactobacillus_phage	88.1	3.6e-57
WP_101873740.1|2305972_2306380_-	HK97 gp10 family phage protein	NA	A0A2P0ZLE6	Lactobacillus_phage	89.4	2.7e-63
WP_101873741.1|2306382_2306730_-|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	73.0	3.5e-43
WP_101873742.1|2306716_2307052_-|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	86.1	1.6e-45
WP_101873743.1|2308370_2309111_-|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	92.3	1.3e-119
WP_101873744.1|2309088_2310282_-|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	99.7	7.4e-226
WP_099746036.1|2310284_2310479_-	DUF1056 family protein	NA	E9LUQ0	Lactobacillus_phage	96.9	9.7e-27
WP_101873745.1|2310468_2312367_-|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	94.0	0.0e+00
WP_101873746.1|2312376_2312832_-|terminase	phage terminase small subunit P27 family	terminase	E9LUP8	Lactobacillus_phage	96.7	4.0e-79
WP_175365133.1|2313030_2313498_-	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	92.2	5.7e-81
WP_050339246.1|2313508_2313679_-	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	91.1	1.8e-21
WP_003638317.1|2314511_2314940_-	transcriptional regulator	NA	E9LUP5	Lactobacillus_phage	73.8	8.3e-55
WP_050339247.1|2315185_2315419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162985048.1|2315685_2315862_-	hypothetical protein	NA	E9LUP2	Lactobacillus_phage	62.1	3.0e-11
WP_101809556.1|2315942_2316110_-	hypothetical protein	NA	A0A2P0ZLB5	Lactobacillus_phage	83.6	1.1e-15
WP_101873747.1|2316102_2316288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101873748.1|2316284_2316590_-	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	90.9	1.6e-44
WP_101873749.1|2316725_2317511_-	ATP-binding protein	NA	E9LUN6	Lactobacillus_phage	91.6	1.8e-132
WP_060677856.1|2319040_2319346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_181185811.1|2319346_2319517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088770051.1|2319565_2319790_-	hypothetical protein	NA	E9LUT8	Lactobacillus_phage	84.9	1.3e-27
WP_065674474.1|2319801_2320002_-	hypothetical protein	NA	E9LUT7	Lactobacillus_phage	87.9	1.1e-25
WP_065674473.1|2320013_2320253_-	tagatose-bisphosphate aldolase	NA	E9LUT6	Lactobacillus_phage	83.5	5.9e-34
WP_101873750.1|2320395_2320656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101873751.1|2320713_2320923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158296994.1|2320919_2321081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_191982613.1|2321093_2321792_-	Rha family transcriptional regulator	NA	D2IYT0	Enterococcus_phage	63.5	3.0e-70
WP_044431044.1|2321826_2322015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065674472.1|2322277_2322610_+	helix-turn-helix transcriptional regulator	NA	A0A1B0Y3N1	Lactobacillus_phage	58.1	6.7e-28
WP_063204243.1|2322602_2323010_+	toxin	NA	A0A1B0Y2S4	Lactobacillus_phage	47.8	5.2e-30
WP_101873753.1|2323572_2323755_+	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	63.8	3.3e-13
WP_101873754.1|2325211_2326363_+|integrase	site-specific integrase	integrase	E9LUS1	Lactobacillus_phage	38.7	5.5e-69
WP_101873755.1|2326895_2336576_-	bacterial Ig-like domain-containing protein	NA	NA	NA	NA	NA
2326554:2326578	attR	CCCCAGGCAGGATTCGAACCTGTAC	NA	NA	NA	NA
WP_101873756.1|2337121_2339389_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	30.7	2.2e-117
WP_050340250.1|2339442_2339730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101873757.1|2339848_2340361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050340248.1|2340474_2340951_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_101873758.1|2341481_2342168_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_101873759.1|2342289_2342493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088769722.1|2342767_2343136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003638396.1|2343408_2343747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101873760.1|2343907_2344675_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_101873761.1|2344680_2345943_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_101873762.1|2346242_2346851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101873763.1|2346980_2347802_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_101873764.1|2348223_2349027_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_158296995.1|2349244_2351644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101873766.1|2352039_2354994_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_101873767.1|2355417_2355801_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_003638386.1|2355905_2356553_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	46.6	2.0e-44
WP_050340234.1|2356683_2357370_-	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	24.7	1.6e-10
WP_101873768.1|2357390_2358755_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_101873769.1|2358751_2359594_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_101873770.1|2359593_2360559_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_101873771.1|2360533_2361643_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.8	2.5e-26
WP_101872633.1|2362010_2363273_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_101873772.1|2363391_2363898_-	universal stress protein	NA	NA	NA	NA	NA
WP_101873773.1|2363987_2365391_-	dipeptidase PepV	NA	NA	NA	NA	NA
WP_101873774.1|2365645_2366488_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_003638377.1|2366735_2367476_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_003638376.1|2367483_2369154_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_101873775.1|2370565_2372992_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	68.2	0.0e+00
>prophage 8
NZ_CP016491	Lactobacillus pentosus strain BGM48 chromosome, complete genome	3591251	2987974	3077213	3591251	tRNA,portal,holin,head,tail,integrase,capsid,terminase,transposase,protease	Lactobacillus_phage(88.64%)	99	3036582:3036597	3077364:3077379
WP_101873465.1|2987974_2988765_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_191982622.1|2988726_2989248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101874014.1|2989259_2990234_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_101874015.1|2990317_2991250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050339186.1|2992675_2993440_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_003637775.1|2993677_2994046_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_003637774.1|2994105_2994609_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_050339187.1|2994807_2995497_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_003637772.1|2995597_2996023_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_050339188.1|2996124_2997012_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003637770.1|2997046_2997595_-	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_003637769.1|2997700_2997886_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_003637768.1|2997897_2998047_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_050339189.1|2998108_2998672_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_050339190.1|2999059_2999605_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_050546761.1|2999606_3000392_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_003637764.1|3000363_3000774_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_088770020.1|3000775_3002191_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	29.9	6.8e-45
WP_088771263.1|3003373_3004864_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_050339193.1|3005915_3007121_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_050339194.1|3007139_3008519_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_050339195.1|3008655_3009192_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	45.3	9.2e-35
WP_101874016.1|3009789_3010086_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_088770021.1|3010095_3010779_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_101874017.1|3010854_3012186_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	33.8	4.9e-69
WP_050339198.1|3013385_3014078_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_101874018.1|3015444_3016122_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_101874019.1|3016326_3017361_-	EamA family transporter	NA	NA	NA	NA	NA
WP_050339201.1|3017672_3018635_-	AEC family transporter	NA	NA	NA	NA	NA
WP_088770025.1|3018942_3020136_+	LCP family protein	NA	NA	NA	NA	NA
WP_101874021.1|3021345_3022119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050339204.1|3022111_3022915_-	acetyl-CoA carboxyl transferase	NA	NA	NA	NA	NA
WP_088770028.1|3022911_3024234_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_101874022.1|3024236_3024713_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_101874023.1|3024728_3025700_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_101874024.1|3025942_3026476_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003637743.1|3026472_3026892_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_101874025.1|3030097_3030484_-	DUF956 family protein	NA	NA	NA	NA	NA
WP_050339212.1|3030617_3031550_-	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_101874026.1|3031568_3032378_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_003637738.1|3032413_3033388_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_101874027.1|3033680_3034547_-	C39 family peptidase	NA	NA	NA	NA	NA
WP_050339214.1|3035083_3035281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101874028.1|3035614_3036433_-	hypothetical protein	NA	NA	NA	NA	NA
3036582:3036597	attL	TGCGGCCAAGAAGATT	NA	NA	NA	NA
WP_050339216.1|3037300_3037717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050339217.1|3037735_3038239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050339218.1|3038259_3038826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101874029.1|3039137_3039512_-|holin	holin	holin	A0A2K9VCG4	Lactobacillus_phage	67.5	3.0e-16
WP_054519162.1|3039521_3039785_-	hemolysin XhlA family protein	NA	E9LUR9	Lactobacillus_phage	89.7	1.0e-34
WP_101874030.1|3039784_3040963_-	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	87.0	5.6e-194
WP_101874031.1|3040974_3041493_-	hypothetical protein	NA	A0A2P0ZLH0	Lactobacillus_phage	36.8	1.5e-13
WP_187329199.1|3042120_3042282_-	hypothetical protein	NA	A0A2P0ZLG1	Lactobacillus_phage	96.2	2.1e-19
WP_101874032.1|3042285_3042525_-	hypothetical protein	NA	A0A2K9VDF6	Lactobacillus_phage	96.1	4.2e-32
WP_101874033.1|3042517_3045274_-|tail	phage tail protein	tail	A0A2K9V5E9	Lactobacillus_phage	64.6	1.6e-210
WP_101874034.1|3045289_3047701_-|tail	phage tail protein	tail	A0A2P0ZLF8	Lactobacillus_phage	94.6	0.0e+00
WP_101874035.1|3047767_3049540_-|tail	phage tail family protein	tail	A0A2P0ZLH2	Lactobacillus_phage	92.6	3.0e-308
WP_101874036.1|3049613_3054401_-	peptidase M23	NA	A0A2P0ZLG0	Lactobacillus_phage	55.1	0.0e+00
WP_065674490.1|3054442_3054628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088770043.1|3054672_3055047_-|tail	phage tail assembly chaperone	tail	A0A2P0ZLH4	Lactobacillus_phage	92.7	6.6e-56
WP_065674488.1|3055119_3055767_-|tail	phage tail protein	tail	A0A2P0ZLH1	Lactobacillus_phage	91.9	1.9e-106
WP_065674487.1|3055782_3056163_-	DUF806 family protein	NA	A0A2P0ZLF4	Lactobacillus_phage	92.9	1.5e-60
WP_101874037.1|3056162_3056570_-	HK97 gp10 family phage protein	NA	A0A2P0ZLE6	Lactobacillus_phage	91.7	2.5e-64
WP_063488418.1|3056572_3056920_-|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	73.9	7.0e-44
WP_065674485.1|3056906_3057242_-|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	86.1	1.6e-45
WP_065674484.1|3057321_3058554_-|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	42.0	5.2e-73
WP_065674483.1|3058568_3059312_-|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	93.1	1.1e-121
WP_088770045.1|3059289_3060483_-|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	98.7	1.4e-224
WP_003644528.1|3060485_3060680_-	DUF1056 family protein	NA	E9LUQ0	Lactobacillus_phage	98.4	7.4e-27
WP_101874038.1|3060669_3062568_-|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	97.3	0.0e+00
WP_065674480.1|3062570_3063029_-|terminase	phage terminase small subunit P27 family	terminase	E9LUP8	Lactobacillus_phage	97.4	1.6e-80
WP_101874039.1|3063189_3063471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101874040.1|3063491_3063758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101874041.1|3063763_3064234_-	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	94.2	4.7e-83
WP_101874042.1|3064244_3064424_-	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	62.7	8.1e-12
WP_022638818.1|3064636_3065062_-	phage transcriptional activator RinA	NA	E9LUP5	Lactobacillus_phage	81.6	3.1e-62
WP_076638150.1|3065042_3065213_-	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	91.1	1.3e-19
WP_101873350.1|3065294_3065720_-	hypothetical protein	NA	K4I239	Lactobacillus_phage	57.8	1.5e-35
WP_101874329.1|3065712_3065934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101873189.1|3066026_3066194_-	hypothetical protein	NA	A0A2P0ZLB5	Lactobacillus_phage	89.1	2.0e-17
WP_056953070.1|3066197_3066509_-	hypothetical protein	NA	A0A2P0ZLB4	Lactobacillus_phage	90.3	7.2e-48
WP_101874043.1|3066511_3066814_-	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	85.0	2.6e-42
WP_101874044.1|3066970_3067846_-	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	41.2	1.1e-48
WP_050339250.1|3067839_3068643_-	hypothetical protein	NA	E9LUM6	Lactobacillus_phage	56.9	6.4e-40
WP_101874045.1|3068692_3069385_-	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	88.7	2.5e-117
WP_060677856.1|3069404_3069710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162985047.1|3069710_3069881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050339253.1|3069923_3070154_-	hypothetical protein	NA	E9LUT8	Lactobacillus_phage	86.3	1.6e-28
WP_101874046.1|3070165_3070366_-	hypothetical protein	NA	E9LUT7	Lactobacillus_phage	92.4	2.0e-27
WP_101874047.1|3070368_3070623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027823021.1|3070765_3071026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101874048.1|3071083_3071371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101874049.1|3071347_3071707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050339258.1|3071719_3072418_-	Rha family transcriptional regulator	NA	D2IYT0	Enterococcus_phage	61.7	2.0e-69
WP_015380504.1|3072432_3072654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050339259.1|3072912_3073239_+	helix-turn-helix transcriptional regulator	NA	E3W8B9	Leuconostoc_phage	46.1	2.1e-18
WP_003641360.1|3073269_3073659_+	ImmA/IrrE family metallo-endopeptidase	NA	D6PSS8	Lactobacillus_phage	54.3	4.6e-36
WP_050339260.1|3073723_3073930_+	hypothetical protein	NA	E9LUS6	Lactobacillus_phage	100.0	5.1e-26
WP_050339261.1|3074416_3074599_+	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	65.5	6.7e-14
WP_050339263.1|3076055_3077213_+|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	96.1	1.8e-213
3077364:3077379	attR	TGCGGCCAAGAAGATT	NA	NA	NA	NA
>prophage 9
NZ_CP016491	Lactobacillus pentosus strain BGM48 chromosome, complete genome	3591251	3256347	3266206	3591251		Streptococcus_phage(14.29%)	7	NA	NA
WP_101874122.1|3256347_3257466_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.1	7.6e-39
WP_101874123.1|3257602_3258937_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.5	2.1e-27
WP_050339902.1|3260034_3261333_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.6	3.8e-18
WP_003639882.1|3261649_3262939_+	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	37.0	4.6e-72
WP_162937100.1|3262988_3263960_+	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	70.9	9.8e-136
WP_088770574.1|3264177_3265125_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.5	1.7e-20
WP_101874124.1|3265114_3266206_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.9	6.9e-13
