The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019085	Xanthomonas oryzae pv. oryzae strain MAI68 chromosome, complete genome	4703782	7440	60863	4703782	transposase,protease	Leptospira_phage(28.57%)	39	NA	NA
WP_024744592.1|7440_8277_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_024744593.1|8461_9268_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_024744594.1|9544_10738_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_053513954.1|10891_11560_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_014501265.1|11644_12406_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010364790.1|12452_12875_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_024743315.1|12878_13292_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_024743314.1|13587_14355_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_024743313.1|14365_14635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743312.1|14709_16170_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_158525106.1|16991_17141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807019.1|17315_18692_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	4.1e-63
WP_101807304.1|18920_19805_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	2.0e-87
WP_107490060.1|19821_20923_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	1.1e-42
WP_024744007.1|21183_22311_-	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_024744008.1|23381_24722_-	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_010364746.1|24939_25632_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_008572943.1|25748_26069_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_024744009.1|27366_28890_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	29.2	1.0e-25
WP_033003570.1|28994_30230_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_024744011.1|30390_31047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053512972.1|31209_33021_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_024744014.1|33168_33519_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_024744015.1|33825_34956_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_033003577.1|35738_36791_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_033003579.1|37491_38565_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_024744018.1|38873_39932_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.9e-77
WP_101807021.1|42339_42969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107490044.1|43018_44050_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_024744291.1|44131_45613_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024744290.1|45807_50280_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_024744289.1|50481_50862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324081.1|51008_52196_+	DNA topoisomerase IB	NA	A0A0U2TSJ7	Niemeyer_virus	35.3	1.3e-41
WP_024744287.1|52398_52704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324376.1|53890_55030_+	saccharopine dehydrogenase	NA	NA	NA	NA	NA
WP_024744284.1|55343_56129_-	DUF1868 domain-containing protein	NA	NA	NA	NA	NA
WP_033003662.1|56139_58728_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024744282.1|58900_60058_+	ROK family protein	NA	NA	NA	NA	NA
WP_101807022.1|60100_60863_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP019085	Xanthomonas oryzae pv. oryzae strain MAI68 chromosome, complete genome	4703782	322093	388805	4703782	transposase	Leptospira_phage(37.5%)	50	NA	NA
WP_107490044.1|322093_323125_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_101807309.1|323160_324600_-	HpaF protein	NA	NA	NA	NA	NA
WP_024744915.1|325664_328073_-	serine kinase	NA	NA	NA	NA	NA
WP_107490032.1|329539_330642_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	3.8e-43
WP_082324345.1|331508_331955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513734.1|331951_333952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744340.1|334725_335196_-	4-hydroxyphenylacetate 3-monooxygenase	NA	NA	NA	NA	NA
WP_069959664.1|335250_335481_-	serine kinase	NA	NA	NA	NA	NA
WP_024744341.1|335612_335855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744342.1|335864_336803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744343.1|336799_337627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744344.1|337623_337884_-	EscS/YscS/HrcS family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_024744345.1|337888_338533_-	EscR/YscR/HrcR family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_024744346.1|338519_339473_-	YscQ/HrcQ family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_053513737.1|339565_340207_-	type III secretion protein HpaP	NA	NA	NA	NA	NA
WP_053513739.1|340206_342129_-	hypersensitivity response secretion protein hrcV	NA	NA	NA	NA	NA
WP_024744349.1|342137_343211_-	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_011257083.1|343426_343882_+	HrpB1 family type III secretion system apparatus protein	NA	NA	NA	NA	NA
WP_011407211.1|343915_344308_+	type III secretion protein HrpB2	NA	NA	NA	NA	NA
WP_024744351.1|344309_345074_+	EscJ/YscJ/HrcJ family type III secretion inner membrane ring protein	NA	NA	NA	NA	NA
WP_024744352.1|345081_345711_+	type III secretion protein HrpB4	NA	NA	NA	NA	NA
WP_024744353.1|345695_346397_+	HrpE/YscL family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_024744354.1|346386_347715_+	EscN/YscN/HrcN family type III secretion system ATPase	NA	NA	NA	NA	NA
WP_053513741.1|347707_348217_+	type III secretion protein HrpB7	NA	NA	NA	NA	NA
WP_024744356.1|348213_349044_+	EscT/YscT/HrcT family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_053513743.1|349126_350950_+	EscC/YscC/HrcC family type III secretion system outer membrane ring protein	NA	NA	NA	NA	NA
WP_053513745.1|351689_352121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053513747.1|352517_353081_+	lytic transglycosylase domain-containing protein	NA	A0A0K2QQJ4	Ralstonia_phage	39.4	5.2e-12
WP_024744361.1|353544_355098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744362.1|356364_356706_-	HPF/RaiA family ribosome-associated protein	NA	NA	NA	NA	NA
WP_053513751.1|356890_359449_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_053513749.1|359467_359728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807032.1|359807_360776_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.6e-98
WP_033003076.1|360901_362626_-	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.7	3.0e-34
WP_024742976.1|362866_363808_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_107490044.1|365364_366396_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_101807033.1|366443_368078_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_050587979.1|368615_370145_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_024742979.1|370141_372373_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_024742980.1|372375_374133_+	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_082324554.1|374189_376079_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_024742982.1|376075_378679_+	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_011407199.1|378701_378887_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_024742983.1|379000_381163_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_024742984.1|381179_381812_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_101807034.1|382177_383554_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.5	2.0e-78
WP_024743402.1|383635_384391_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_024743401.1|384768_386178_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024743400.1|386526_386958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419058.1|387428_388805_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	3.2e-63
>prophage 3
NZ_CP019085	Xanthomonas oryzae pv. oryzae strain MAI68 chromosome, complete genome	4703782	492700	602321	4703782	head,tRNA,holin,capsid,transposase,terminase,integrase,tail,plate,portal	Stenotrophomonas_phage(40.82%)	94	518327:518371	561310:561354
WP_053513464.1|492700_493264_-|tRNA	tRNA threonylcarbamoyladenosine biosynthesis protein RimN	tRNA	NA	NA	NA	NA
WP_024745936.1|493274_495767_-	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.3	1.9e-114
WP_101807039.1|495949_497224_-	RDD family protein	NA	NA	NA	NA	NA
WP_101807040.1|497265_497988_-	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_024745938.1|498028_498502_-	DUF494 family protein	NA	NA	NA	NA	NA
WP_101807041.1|498544_499687_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_101807042.1|499758_500895_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
WP_024745941.1|501027_501540_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
WP_024745942.1|501940_502864_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_024745943.1|502863_504177_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_053513456.1|506127_507405_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_024745946.1|507602_508427_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_024745947.1|508427_509486_+	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
WP_024745948.1|509652_511158_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_053513469.1|511154_511664_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_019302641.1|511773_512907_-	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.1e-28
WP_014504872.1|513149_513671_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_033004404.1|513869_514784_-	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_024745951.1|514884_515325_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_014504870.1|515433_517308_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
WP_024745952.1|517500_517821_+	hypothetical protein	NA	NA	NA	NA	NA
518327:518371	attL	CTCATAATCCTTTGGTTGAAGGTTCGAATCCTTCTGGGCCCACCA	NA	NA	NA	NA
WP_082330806.1|518440_519715_-|integrase	tyrosine-type recombinase/integrase	integrase	V9IQN0	Stenotrophomonas_phage	50.5	1.1e-110
WP_011257520.1|519848_520055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075243253.1|520051_520324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745956.1|520320_520566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745957.1|520562_520838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745958.1|520999_521410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258448.1|521635_521914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408133.1|521910_522129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082330809.1|522437_525110_-	toprim domain-containing protein	NA	V9IQW5	Stenotrophomonas_phage	69.7	0.0e+00
WP_011258450.1|525143_525356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408135.1|525352_525631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745959.1|525641_525962_-	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	56.5	6.3e-23
WP_053503015.1|525964_526222_-	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	46.4	6.6e-07
WP_011258452.1|526293_526731_+	transcriptional regulator	NA	E5E3P4	Burkholderia_phage	32.0	5.4e-09
WP_011258453.1|527391_528378_-	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	54.8	2.5e-94
WP_011258454.1|528374_528776_-|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	62.3	6.0e-39
WP_024745960.1|528788_531659_-|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	47.5	6.2e-194
WP_011258456.1|531691_531805_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
WP_011258457.1|531813_532116_-|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	62.6	6.3e-25
WP_011258458.1|532161_532671_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	79.9	1.8e-72
WP_011258459.1|532701_533868_-|tail	tail sheath protein	tail	E5FFG9	Burkholderia_phage	62.4	4.6e-132
WP_024745961.1|533879_534239_-|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	66.1	4.3e-36
WP_024745962.1|534235_534799_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	43.7	3.1e-25
WP_024745963.1|534859_535438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745964.1|535445_536951_-|tail	tail fiber protein	tail	V9IQX0	Stenotrophomonas_phage	47.0	2.1e-52
WP_024745965.1|536960_537506_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.7	3.5e-50
WP_024745966.1|537498_538389_-|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	53.7	7.2e-85
WP_024745967.1|538470_538920_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	54.7	1.8e-36
WP_024745968.1|538907_539327_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	65.2	2.0e-40
WP_011258470.1|539800_540442_-	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	60.9	7.9e-49
WP_024745970.1|540438_540714_-|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	59.8	3.0e-21
WP_024745971.1|540706_541063_-	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	4.5e-22
WP_024745972.1|541067_541277_-|tail	tail protein	tail	K4PAW7	Burkholderia_phage	59.4	5.4e-15
WP_012445486.1|541276_541744_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.7	9.2e-31
WP_011258475.1|541843_542563_-|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	63.4	2.0e-69
WP_024745974.1|542566_543586_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	70.9	2.1e-136
WP_024745975.1|543632_544475_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	52.6	1.7e-67
WP_033004409.1|544596_546381_+|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	75.1	1.2e-267
WP_024745977.1|546380_547400_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	72.5	4.1e-140
WP_082330810.1|547420_547651_+	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	54.8	1.9e-13
WP_024745978.1|547583_548288_+	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	77.8	3.3e-109
WP_033004412.1|548319_548787_-	DUF4411 family protein	NA	NA	NA	NA	NA
WP_024745980.1|548786_549965_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_101807043.1|550695_553455_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.3	1.8e-41
WP_024745590.1|553463_554390_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_101807044.1|554386_557221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743124.1|557248_557980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807045.1|558006_560349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101836529.1|560916_561117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324338.1|561421_561655_-	hypothetical protein	NA	V9IQN0	Stenotrophomonas_phage	53.1	4.1e-16
561310:561354	attR	CTCATAATCCTTTGGTTGAAGGTTCGAATCCTTCTGGGCCCACCA	NA	NA	NA	NA
WP_024743230.1|563531_565421_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_011260615.1|565637_565979_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	44.4	2.3e-15
WP_053513444.1|566177_567902_+	ATP-dependent RNA helicase RhlB	NA	A0A1V0SBR7	Catovirus	29.4	1.1e-47
WP_024743228.1|567977_568664_+	cell division ATP-binding protein FtsE	NA	NA	NA	NA	NA
WP_024743227.1|568660_569611_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_082324547.1|569667_570462_+	response regulator	NA	NA	NA	NA	NA
WP_053513446.1|570458_571184_+	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	44.3	4.7e-50
WP_024743224.1|571400_572276_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	39.5	3.6e-44
WP_053513448.1|572354_572969_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_053513449.1|573021_574314_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003483210.1|576604_576892_+	co-chaperone GroES	NA	A0A221S331	uncultured_virus	40.0	5.1e-16
WP_011260602.1|577035_578676_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	63.5	5.1e-177
WP_053513452.1|578976_581253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058419179.1|582360_583329_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_058419036.1|585714_586683_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_024745526.1|587614_588688_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	47.9	4.3e-84
WP_053513971.1|589204_591382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513973.1|591475_593893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513975.1|594156_595077_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_024745528.1|595076_595595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053513977.1|595756_598582_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_053513979.1|598677_599238_-	VUT family protein	NA	A0A2I7SAW6	Vibrio_phage	30.2	1.4e-12
WP_058419055.1|600944_602321_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
>prophage 4
NZ_CP019085	Xanthomonas oryzae pv. oryzae strain MAI68 chromosome, complete genome	4703782	616280	710189	4703782	transposase,protease	Acidithiobacillus_phage(26.67%)	55	NA	NA
WP_101807047.1|616280_617657_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	7.1e-63
WP_130625305.1|617836_618397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419175.1|618715_620092_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	7.1e-63
WP_053513412.1|620402_623132_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.7	3.8e-68
WP_082324544.1|623200_624376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324336.1|624422_626300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807048.1|626313_627888_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
WP_053513416.1|628020_628983_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_058419060.1|629270_630647_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_058419174.1|631652_635477_+	avirulence protein	NA	NA	NA	NA	NA
WP_024745997.1|636546_638130_-	SDR family oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
WP_082324335.1|638520_638712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745996.1|641212_643537_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_024745994.1|645440_646532_-	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_024745993.1|647496_648375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324334.1|648563_649448_+	DMT family transporter	NA	NA	NA	NA	NA
WP_024745991.1|649725_651498_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_050588046.1|651895_653596_-	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
WP_033004419.1|654750_656127_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_024745988.1|656213_657209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745987.1|657454_658366_+	magnesium transporter	NA	NA	NA	NA	NA
WP_024745985.1|658900_659185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745984.1|659514_659961_+	autotransporter	NA	NA	NA	NA	NA
WP_101807049.1|660272_661374_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	5.0e-43
WP_058419060.1|662083_663460_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_024743083.1|664632_666324_-	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_024743082.1|666576_667362_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_024743081.1|668605_669610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743080.1|669648_670578_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_024743079.1|671113_674002_-	insulinase family protein	NA	NA	NA	NA	NA
WP_024743078.1|674254_676837_+	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	29.2	3.2e-08
WP_101807050.1|677414_678213_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024745720.1|680816_682271_-	cellulase family glycosylhydrolase	NA	H2DE45	Erwinia_phage	32.6	5.2e-48
WP_024745721.1|682478_683966_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	57.1	2.4e-125
WP_082324540.1|684245_685199_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	38.0	1.7e-15
WP_024745723.1|685367_687017_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_033004321.1|688008_689946_+	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_024745725.1|690097_690766_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024745726.1|690770_691823_+	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.6	1.4e-18
WP_024745727.1|691853_692591_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024745728.1|692621_693536_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_024745729.1|694098_694899_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_024745730.1|695460_696426_+	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_024745731.1|696534_697104_-	lipocalin family protein	NA	NA	NA	NA	NA
WP_024745732.1|697488_697800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745733.1|697867_699961_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_053513809.1|700555_701740_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_024745735.1|701849_703985_+	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	26.1	1.8e-28
WP_024745736.1|704328_704727_+	YbaN family protein	NA	NA	NA	NA	NA
WP_024745737.1|704784_705027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745738.1|705016_705871_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_082324332.1|705858_706539_+	DUF484 family protein	NA	NA	NA	NA	NA
WP_024745740.1|706732_707650_+	tyrosine recombinase XerC	NA	A0A142F2H8	Mycobacterium_phage	28.1	1.7e-12
WP_024745741.1|708165_708717_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_024745742.1|708821_710189_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.5	4.7e-43
>prophage 5
NZ_CP019085	Xanthomonas oryzae pv. oryzae strain MAI68 chromosome, complete genome	4703782	761913	832828	4703782	transposase	Ralstonia_phage(20.0%)	55	NA	NA
WP_101867666.1|761913_762882_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
WP_107490082.1|762933_763032_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024743525.1|763910_766619_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_158525109.1|766615_766783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050587990.1|766769_769664_+	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	25.2	2.0e-22
WP_053513077.1|769660_772057_+	alpha-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_024743528.1|772190_773357_+	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_050587991.1|773571_774339_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743530.1|774383_775661_+	sugar MFS transporter	NA	NA	NA	NA	NA
WP_024743531.1|775701_776769_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743532.1|776775_777804_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_024743533.1|777806_778961_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_024743534.1|779465_780071_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_024743535.1|780067_781321_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_024743536.1|781322_783221_-	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_024743537.1|783222_785265_-	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_024743539.1|786478_787711_-	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	41.5	2.3e-73
WP_058419068.1|787931_788900_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_101807052.1|794264_795002_-	endonuclease	NA	NA	NA	NA	NA
WP_053513041.1|795051_795867_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_101807053.1|795958_796609_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_082324537.1|796702_797443_-	cytochrome c4	NA	NA	NA	NA	NA
WP_024744861.1|797644_798268_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_024744862.1|798361_799057_-	VIT family protein	NA	NA	NA	NA	NA
WP_024744863.1|799272_800637_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_058419060.1|802428_803805_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_024712624.1|804579_805065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744626.1|806007_806928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513043.1|806960_808460_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.1	3.6e-12
WP_082324328.1|808456_809176_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024744866.1|809314_810415_+	glycosyltransferase	NA	A0A142BZU7	Faustovirus	28.5	9.8e-15
WP_024744868.1|811550_811826_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_024744869.1|811890_813000_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.4	3.8e-35
WP_024744870.1|813068_813644_+	S-(hydroxymethyl)glutathione synthase	NA	NA	NA	NA	NA
WP_024744871.1|813703_814534_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_024744872.1|814663_814873_+	DUF4386 family protein	NA	NA	NA	NA	NA
WP_058419036.1|814924_815893_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_082324327.1|816066_816543_+	DUF4386 domain-containing protein	NA	NA	NA	NA	NA
WP_082324326.1|816539_816884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743416.1|817059_818721_-	energy-dependent translational throttle protein EttA	NA	A0A1B0RXA0	Streptococcus_phage	28.6	1.3e-39
WP_024743415.1|818946_819444_+	RcnB family protein	NA	NA	NA	NA	NA
WP_154221260.1|819624_819906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807054.1|820114_822445_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024712241.1|822630_823884_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	1.6e-101
WP_024743412.1|823897_824413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743411.1|824412_824937_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_024743410.1|824933_825419_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_101807310.1|825430_826525_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.8e-45
WP_024743408.1|826580_827204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743407.1|827764_828367_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	36.0	3.9e-26
WP_024743406.1|828363_829503_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	34.3	1.6e-52
WP_024743405.1|829816_830281_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	40.3	2.2e-24
WP_024743404.1|830277_830748_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_024743403.1|830968_831943_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_101807055.1|832030_832828_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP019085	Xanthomonas oryzae pv. oryzae strain MAI68 chromosome, complete genome	4703782	1073134	1135559	4703782	transposase,protease	Leptospira_phage(16.67%)	44	NA	NA
WP_107490031.1|1073134_1074166_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.3e-74
WP_058419168.1|1075226_1076195_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	2.8e-98
WP_082324317.1|1078097_1079471_-	MFS transporter	NA	NA	NA	NA	NA
WP_024745685.1|1079569_1081609_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_024745686.1|1081816_1082839_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_024745687.1|1083254_1084352_+	OmpA family protein	NA	NA	NA	NA	NA
WP_024745688.1|1084544_1085054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513257.1|1085073_1085934_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_024745690.1|1085884_1086277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745691.1|1086279_1087488_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.5	2.9e-20
WP_053513259.1|1087578_1088676_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024745693.1|1088679_1089540_+	sulfate ABC transporter permease subunit CysT	NA	NA	NA	NA	NA
WP_024745694.1|1089536_1090490_+	sulfate ABC transporter permease subunit CysW	NA	NA	NA	NA	NA
WP_024745695.1|1090497_1091532_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	2.0e-25
WP_024745696.1|1091891_1092605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033004302.1|1092674_1093697_-	L-threonine 3-dehydrogenase	NA	NA	NA	NA	NA
WP_024745698.1|1093928_1094216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033004295.1|1094212_1096546_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_033004296.1|1098960_1101111_+	S46 family peptidase	NA	NA	NA	NA	NA
WP_024745700.1|1101203_1101848_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_024745701.1|1102818_1104117_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_024745702.1|1104184_1105267_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_033004297.1|1105481_1106222_+	CvpA family protein	NA	NA	NA	NA	NA
WP_024745703.1|1106258_1107725_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.1	8.3e-86
WP_024745704.1|1107863_1108688_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_101807070.1|1109407_1110206_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024745844.1|1110668_1111088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513157.1|1111267_1112011_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_024745846.1|1112645_1113188_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_053513155.1|1113168_1114305_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_033004364.1|1114509_1116036_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_024745848.1|1116207_1118310_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_082324316.1|1118413_1119757_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	33.8	5.0e-29
WP_024745850.1|1119814_1120504_-	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	35.7	5.9e-34
WP_082324528.1|1120678_1122325_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_024745852.1|1122474_1122783_+	glutaredoxin 3	NA	A0A2L0UZG6	Agrobacterium_phage	43.2	4.7e-07
WP_024745853.1|1122779_1123175_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_014502224.1|1123389_1124397_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_014502225.1|1124537_1125299_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_058419165.1|1126505_1127564_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.6e-73
WP_058419103.1|1128880_1129849_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
WP_024745448.1|1132136_1133429_+	trigger factor	NA	NA	NA	NA	NA
WP_002806026.1|1133521_1134148_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_011257881.1|1134272_1135559_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
>prophage 8
NZ_CP019085	Xanthomonas oryzae pv. oryzae strain MAI68 chromosome, complete genome	4703782	1243059	1394488	4703782	plate,transposase,protease	Ralstonia_phage(15.38%)	108	NA	NA
WP_101807076.1|1243059_1244457_-|protease	serine protease	protease	NA	NA	NA	NA
WP_053513692.1|1244884_1246855_+	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_024744518.1|1247699_1248545_+	transporter	NA	NA	NA	NA	NA
WP_024744517.1|1248833_1250954_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_024744516.1|1251230_1251692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744515.1|1251823_1252549_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_053513688.1|1253366_1255508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513686.1|1255624_1257760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807077.1|1257922_1258728_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	37.1	5.3e-10
WP_024745783.1|1259830_1261069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745784.1|1261894_1264000_-	catalase	NA	A0A2K9L0T1	Tupanvirus	47.7	1.9e-136
WP_050588043.1|1265649_1266297_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	45.5	6.5e-35
WP_024745785.1|1266293_1266845_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_101807315.1|1267210_1270144_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	49.9	8.9e-257
WP_024745787.1|1270611_1270803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745788.1|1271233_1272037_+	sulfotransferase	NA	M4QPS9	Synechococcus_phage	27.7	9.0e-26
WP_033004344.1|1272125_1273337_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_024745790.1|1273333_1275493_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	28.0	2.2e-34
WP_024745792.1|1276301_1276706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745793.1|1276787_1278806_-	M2 family metallopeptidase	NA	NA	NA	NA	NA
WP_024745794.1|1278917_1280588_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_024745795.1|1280584_1281349_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_024745796.1|1281448_1283182_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_024745797.1|1283401_1284118_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.4	2.8e-23
WP_024745798.1|1284110_1285403_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_024745799.1|1285554_1286046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745800.1|1286114_1286372_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_024745801.1|1286374_1287184_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_024745802.1|1287219_1287960_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_014502368.1|1287964_1288564_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024745803.1|1288808_1290005_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_008574699.1|1290004_1290646_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024745804.1|1290996_1292193_+	polyketide cyclase	NA	NA	NA	NA	NA
WP_024745805.1|1292274_1292661_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_024745806.1|1292663_1293338_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_024745807.1|1293401_1294199_-	D-alanyl-D-alanine carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_024745808.1|1294329_1294509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745809.1|1294505_1294790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745812.1|1295405_1296608_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_131112933.1|1296704_1296917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807079.1|1297012_1297429_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024745813.1|1297584_1298316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745814.1|1298515_1299394_+	M15 family metallopeptidase	NA	A8ATW4	Listeria_phage	34.5	3.9e-06
WP_024745815.1|1299501_1299762_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_024745816.1|1299821_1301303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745817.1|1301318_1305056_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_101807080.1|1305052_1306036_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_053513252.1|1306032_1306827_+	OmpA family protein	NA	NA	NA	NA	NA
WP_024745820.1|1306879_1307950_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_107490031.1|1308880_1309912_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.3e-74
WP_101807081.1|1309983_1312806_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.4	1.0e-52
WP_101807316.1|1313311_1314328_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.3	7.3e-49
WP_058419153.1|1315435_1316812_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	3.0e-77
WP_058419152.1|1316955_1318332_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.6	5.1e-61
WP_058419050.1|1318996_1319965_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_024744031.1|1320378_1320891_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_033003115.1|1323440_1324229_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_011259947.1|1324228_1325563_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_024743027.1|1325714_1326323_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_033003111.1|1326708_1327197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003467601.1|1327243_1327744_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011409204.1|1327747_1329244_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003467612.1|1329385_1329883_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011409203.1|1330030_1330519_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_024743026.1|1330521_1332357_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_024743025.1|1332320_1333412_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_053513684.1|1333497_1336230_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.6	7.1e-91
WP_014502423.1|1336260_1336614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807082.1|1336706_1339493_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.3	6.9e-41
WP_053513217.1|1339467_1340340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107490046.1|1342376_1343479_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.9e-43
WP_024743437.1|1345987_1347052_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_024743436.1|1347066_1347318_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_024743435.1|1347617_1348730_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_024743434.1|1348726_1349269_-	shikimate kinase	NA	NA	NA	NA	NA
WP_024743433.1|1349435_1350035_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_012445807.1|1350215_1350632_+	YjfI family protein	NA	NA	NA	NA	NA
WP_024743432.1|1350644_1351418_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_024743431.1|1351443_1352526_+	potassium channel protein	NA	NA	NA	NA	NA
WP_082324520.1|1352528_1353200_+	YjfK family protein	NA	NA	NA	NA	NA
WP_024743429.1|1353237_1353642_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_024743428.1|1353654_1354227_+	DUF1190 domain-containing protein	NA	A0A191ZBZ0	Erwinia_phage	28.1	6.4e-10
WP_024743427.1|1354228_1355395_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	41.6	6.4e-73
WP_050587989.1|1355757_1356219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743426.1|1358016_1360023_+	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_082324305.1|1361072_1364219_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024743423.1|1364550_1365303_+	SapC family protein	NA	NA	NA	NA	NA
WP_101807084.1|1365313_1366360_+	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_024743421.1|1366400_1367918_+	tryptophan 7-halogenase	NA	A0A1D7SF58	Cyanophage	31.8	5.8e-50
WP_024743420.1|1367955_1368960_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_024743419.1|1369104_1369503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807085.1|1369634_1371011_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	6.0e-78
WP_024745604.1|1371599_1372997_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_024745603.1|1373438_1374821_-	APC family permease	NA	NA	NA	NA	NA
WP_024745602.1|1375013_1375778_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024745601.1|1376091_1377033_+	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_053513783.1|1377788_1379177_+	amino acid permease	NA	NA	NA	NA	NA
WP_101807086.1|1381126_1382581_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	41.0	9.0e-93
WP_033004264.1|1382537_1383440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050588037.1|1383439_1384681_-	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	34.7	3.2e-54
WP_101807087.1|1384913_1385882_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.6e-98
WP_024744440.1|1387002_1388019_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_082324517.1|1388079_1388874_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_024744438.1|1389033_1390395_-	magnesium transporter	NA	NA	NA	NA	NA
WP_024744437.1|1390682_1392413_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	24.1	1.0e-10
WP_005913389.1|1392471_1392741_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_003487850.1|1392733_1393126_-	PTS fructose IIA component family protein	NA	NA	NA	NA	NA
WP_058419145.1|1393519_1394488_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
>prophage 9
NZ_CP019085	Xanthomonas oryzae pv. oryzae strain MAI68 chromosome, complete genome	4703782	1419911	1527193	4703782	tRNA,transposase,protease	Ralstonia_phage(18.75%)	87	NA	NA
WP_107490044.1|1419911_1420943_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_058419036.1|1421009_1421978_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_011258205.1|1422281_1422611_-	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_024743872.1|1422607_1423147_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_058419057.1|1423356_1424325_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
WP_024743209.1|1424438_1425683_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.7	5.0e-92
WP_024743208.1|1425679_1426942_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_024743207.1|1426941_1427706_-	Fe-S cluster assembly ATPase SufC	NA	W5SAS9	Pithovirus	28.5	2.0e-11
WP_024743206.1|1427963_1429421_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_024743205.1|1429436_1429895_-	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_003487757.1|1430066_1430534_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_033003226.1|1430638_1430857_+	peptidase	NA	NA	NA	NA	NA
WP_024743204.1|1431463_1432060_-	DUF1439 domain-containing protein	NA	NA	NA	NA	NA
WP_033003224.1|1432115_1432658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743203.1|1432715_1433057_-	DUF3861 domain-containing protein	NA	NA	NA	NA	NA
WP_024743202.1|1433114_1433756_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_024743201.1|1433860_1434286_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_024743200.1|1434841_1435702_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_024743199.1|1435745_1436438_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_101807090.1|1436503_1437269_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024743682.1|1437619_1438657_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_024743681.1|1438770_1439901_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_082324514.1|1440190_1440847_+	YitT family protein	NA	NA	NA	NA	NA
WP_024743679.1|1441949_1442522_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_024743678.1|1442518_1442953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033003404.1|1442949_1443831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743677.1|1443798_1444365_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_024743676.1|1444357_1444825_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_024743675.1|1444838_1445786_+	aspartate carbamoyltransferase catalytic subunit	NA	NA	NA	NA	NA
WP_024743674.1|1446222_1446657_+	OsmC family protein	NA	NA	NA	NA	NA
WP_024743673.1|1446809_1447409_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_024743672.1|1447706_1448588_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_024743669.1|1449680_1452290_+	bifunctional aspartate kinase/diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_024743668.1|1452273_1452732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743667.1|1452728_1454084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743666.1|1454064_1455471_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_053512934.1|1455787_1456609_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_058419088.1|1456703_1457672_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.5e-99
WP_024743020.1|1457926_1458925_-	octaprenyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_024743021.1|1459200_1459734_+	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	60.9	1.9e-32
WP_024743022.1|1460016_1461501_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.5	5.0e-14
WP_024743023.1|1461794_1462502_+	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_154221304.1|1463110_1463272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324511.1|1465013_1465691_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_158500229.1|1465812_1466259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016904074.1|1466227_1466452_-	putative selenoprotein	NA	NA	NA	NA	NA
WP_024745822.1|1466451_1468524_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_050588044.1|1468807_1469614_+	pirin family protein	NA	NA	NA	NA	NA
WP_101807093.1|1469700_1470072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419141.1|1470475_1473292_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.6	4.7e-53
WP_024745912.1|1473291_1474188_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_024745911.1|1474184_1474649_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_082324298.1|1474672_1475152_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_082324297.1|1475301_1475781_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_082324296.1|1475867_1477604_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_082324203.1|1478384_1479761_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
WP_024743650.1|1480411_1481008_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_058419169.1|1481433_1482810_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.0e-77
WP_024712501.1|1485713_1486175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130625317.1|1487490_1488147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024742990.1|1488414_1489128_-	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_024742991.1|1489231_1489981_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_082324510.1|1491422_1492544_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_082324295.1|1492558_1493386_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_024743606.1|1493369_1494653_-	EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_024743605.1|1494679_1495195_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_024743604.1|1495205_1497362_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.5	1.4e-09
WP_024743603.1|1497430_1499434_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011258268.1|1499452_1499782_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_131091743.1|1499812_1500040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743602.1|1500271_1503736_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_014502625.1|1504129_1504672_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_033003388.1|1505096_1506005_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_024743600.1|1507535_1508348_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_024743598.1|1509293_1509905_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_024743597.1|1510023_1510908_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_024743596.1|1510929_1512021_+	DUF3616 domain-containing protein	NA	NA	NA	NA	NA
WP_024743595.1|1512089_1513493_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_019302800.1|1513506_1514013_+	Fur family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743594.1|1514415_1514874_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_024743593.1|1515651_1515855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807094.1|1516018_1517162_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.9	1.2e-84
WP_101807095.1|1517271_1518288_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
WP_101807096.1|1518573_1519950_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	53.7	8.9e-74
WP_033004102.1|1519977_1520868_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_024743817.1|1521554_1522151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131112934.1|1526161_1527193_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	8.7e-74
>prophage 10
NZ_CP019085	Xanthomonas oryzae pv. oryzae strain MAI68 chromosome, complete genome	4703782	1569883	1637850	4703782	tRNA,transposase,protease	Ralstonia_phage(33.33%)	56	NA	NA
WP_058419068.1|1569883_1570852_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_024744656.1|1571175_1571469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324504.1|1571547_1571961_-	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_033003771.1|1572652_1573639_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_053513278.1|1573689_1573923_-	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_024744651.1|1574396_1574690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807099.1|1575582_1576032_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_053513279.1|1576297_1577155_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.0e-11
WP_024744648.1|1577359_1577971_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_024744647.1|1578069_1580712_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	40.0	4.7e-172
WP_024744646.1|1581225_1581861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807100.1|1581883_1582912_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_101807101.1|1582908_1583808_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_011259822.1|1583864_1584281_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_053513280.1|1584292_1585408_+	J domain-containing protein	NA	NA	NA	NA	NA
WP_024744641.1|1586497_1586968_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_033003769.1|1587405_1588080_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_024744639.1|1588390_1591501_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024744638.1|1591967_1592702_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_024744637.1|1592840_1593413_+	Maf-like protein	NA	NA	NA	NA	NA
WP_024744636.1|1593412_1594912_+	ribonuclease G	NA	NA	NA	NA	NA
WP_024744635.1|1595052_1598973_+	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_024744634.1|1598978_1599731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744633.1|1599829_1601275_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_024744632.1|1601531_1602113_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_024744631.1|1602258_1603626_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_082324502.1|1603700_1604105_+	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_024744630.1|1604156_1604618_+	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_024744629.1|1604687_1605785_-|protease	protease	protease	NA	NA	NA	NA
WP_101807075.1|1606191_1606989_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024745348.1|1607101_1607977_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_024745349.1|1607978_1608239_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_024745350.1|1608270_1609575_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_101807102.1|1609608_1611315_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_024745352.1|1611457_1612798_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_024745353.1|1612807_1613644_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_024745354.1|1613890_1614382_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_024745355.1|1614589_1615339_-	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
WP_024745356.1|1615448_1615985_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
WP_024745357.1|1616095_1616575_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_024745358.1|1616803_1618048_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_024745359.1|1618055_1619306_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_053514015.1|1619302_1620673_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.8	2.4e-34
WP_024744748.1|1622230_1622527_+	cysteine methyltransferase	NA	NA	NA	NA	NA
WP_024744749.1|1622567_1623266_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_058419134.1|1623516_1624485_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
WP_101807103.1|1625068_1626094_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.9e-49
WP_130625326.1|1627211_1627673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743076.1|1628489_1630505_-	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_101807317.1|1631174_1632191_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	9.6e-49
WP_058419036.1|1632587_1633556_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_154221280.1|1633639_1634209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744531.1|1634574_1635426_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_024744530.1|1635521_1636091_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	74.9	4.5e-72
WP_024744529.1|1636125_1636311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058419036.1|1636881_1637850_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
>prophage 11
NZ_CP019085	Xanthomonas oryzae pv. oryzae strain MAI68 chromosome, complete genome	4703782	1698484	1768145	4703782	tRNA,transposase,integrase	Leptospira_phage(20.0%)	54	1696875:1696891	1771658:1771674
1696875:1696891	attL	TGGCCGAAGGCCGCGCC	NA	NA	NA	NA
WP_024743628.1|1698484_1699411_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_003485583.1|1699567_1699828_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_024743627.1|1699994_1702109_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_024743626.1|1702482_1703523_-	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_101807108.1|1703586_1704462_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_024743624.1|1704458_1704728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743623.1|1704786_1705290_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	38.7	3.6e-17
WP_024743622.1|1705286_1706432_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_024743621.1|1706573_1707152_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	39.6	8.4e-34
WP_024743620.1|1707273_1707594_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_053513476.1|1707590_1708334_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024743618.1|1708330_1708930_+	YhgN family NAAT transporter	NA	NA	NA	NA	NA
WP_024743617.1|1709699_1712894_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024743616.1|1713000_1714386_+	LOG family protein	NA	NA	NA	NA	NA
WP_024743615.1|1714555_1715071_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	A0A1W6JT76	Pseudomonas_phage	42.5	1.1e-05
WP_024743614.1|1715067_1715544_+	type IV pilus modification protein PilV	NA	NA	NA	NA	NA
WP_024743613.1|1715540_1716707_+	PilW family protein	NA	NA	NA	NA	NA
WP_024743612.1|1716710_1717220_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_024743610.1|1718139_1721178_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_024743609.1|1721184_1721640_+	type IV pilin protein	NA	NA	NA	NA	NA
WP_019299933.1|1721816_1722359_-	fimbrial protein	NA	NA	NA	NA	NA
WP_024743608.1|1722497_1724519_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_024744187.1|1726313_1727042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744188.1|1727171_1728266_-	acyltransferase	NA	NA	NA	NA	NA
WP_024744189.1|1728693_1730361_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_024744190.1|1730377_1731235_-	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_024744191.1|1731419_1732961_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	42.8	2.7e-79
WP_024744192.1|1732974_1734180_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_024744193.1|1734240_1735611_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_101807109.1|1735932_1736670_+	histidine utilization repressor	NA	NA	NA	NA	NA
WP_024744195.1|1736826_1737837_-	membrane protein	NA	NA	NA	NA	NA
WP_024744196.1|1738403_1738967_-	phasin family protein	NA	NA	NA	NA	NA
WP_024744197.1|1739128_1739404_-	polyhydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_101807318.1|1739644_1740454_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_024744199.1|1740395_1741052_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_024744200.1|1741353_1742322_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_053513270.1|1742496_1743582_+	phosphoserine transaminase	NA	M1Q1P2	Streptococcus_phage	43.6	1.7e-75
WP_053513272.1|1743664_1744873_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_024744202.1|1744994_1746308_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_101807110.1|1746349_1747147_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_107490046.1|1747342_1748444_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.9e-43
WP_024744617.1|1748864_1749332_-	TonB family protein	NA	NA	NA	NA	NA
WP_058419031.1|1749762_1750731_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
WP_082324283.1|1750852_1751620_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_024743448.1|1751626_1753018_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	49.6	1.0e-93
WP_024743447.1|1753478_1754063_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_024743446.1|1754162_1755179_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_082324494.1|1755802_1757221_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_017154976.1|1757316_1757559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324282.1|1757552_1757894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107490965.1|1758446_1759547_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	7.2e-42
WP_101807112.1|1759604_1763198_-	avirulence protein	NA	NA	NA	NA	NA
WP_024743886.1|1764572_1766684_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.2	1.3e-15
WP_107490049.1|1767179_1768145_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
1771658:1771674	attR	TGGCCGAAGGCCGCGCC	NA	NA	NA	NA
>prophage 12
NZ_CP019085	Xanthomonas oryzae pv. oryzae strain MAI68 chromosome, complete genome	4703782	1839095	1848983	4703782	tRNA	Micromonas_sp._RCC1109_virus(16.67%)	7	NA	NA
WP_053513920.1|1839095_1840772_+	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.3	2.1e-37
WP_011408885.1|1840860_1841502_+	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_019300309.1|1841674_1842709_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.0	1.6e-112
WP_024745487.1|1843010_1843499_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_024745486.1|1843600_1846249_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.8	2.4e-83
WP_003481884.1|1846388_1846601_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_101807119.1|1848491_1848983_+	glycoside hydrolase family 104 protein	NA	D5LH07	Escherichia_phage	67.7	4.6e-57
>prophage 13
NZ_CP019085	Xanthomonas oryzae pv. oryzae strain MAI68 chromosome, complete genome	4703782	1974584	2061190	4703782	tRNA,transposase	uncultured_Caudovirales_phage(34.78%)	53	NA	NA
WP_024745402.1|1974584_1976102_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.5	8.6e-86
WP_024745401.1|1976243_1977380_+	two-component system response regulator	NA	NA	NA	NA	NA
WP_024745399.1|1977744_1979922_+	response regulator	NA	A0A1V0SGX0	Hokovirus	33.1	1.3e-47
WP_019299970.1|1979933_1980803_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_024745398.1|1980979_1982662_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.2	2.1e-32
WP_024745396.1|1983311_1986080_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_003486316.1|1986227_1986476_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011259444.1|1986472_1986883_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_024745395.1|1986948_1989540_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_101807129.1|1989893_1990709_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_101807130.1|1991364_1993608_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_024745392.1|1993716_1994793_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_010365269.1|1994789_1995386_-	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_019302811.1|1995382_1996249_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_082324264.1|1996494_1998885_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	58.3	3.9e-08
WP_082324486.1|1998963_1999308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002806488.1|1999662_2000145_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_082324263.1|2000280_2001078_-	flagellar brake protein	NA	NA	NA	NA	NA
WP_053513169.1|2002119_2004381_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.5	1.3e-10
WP_053513167.1|2004792_2007054_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.7	2.5e-12
WP_024742986.1|2007645_2010120_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	47.4	1.9e-10
WP_107490044.1|2010165_2011197_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_053514012.1|2014224_2016468_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.8	3.4e-14
WP_082324099.1|2016726_2018103_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_053513639.1|2018384_2020598_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.2	1.9e-09
WP_053513641.1|2020795_2023165_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.7	2.7e-09
WP_024744836.1|2023178_2023940_-	transporter	NA	NA	NA	NA	NA
WP_101807131.1|2029447_2031709_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.4	2.8e-08
WP_158525110.1|2032130_2032295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743066.1|2032607_2034617_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_002806565.1|2034650_2035016_-	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
WP_010375641.1|2035012_2035321_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_101807132.1|2035421_2036444_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_024743068.1|2036440_2037223_-	ParA family protein	NA	Q8JL10	Natrialba_phage	35.7	1.7e-13
WP_024743069.1|2037224_2038199_-	flagellar motor protein MotD	NA	NA	NA	NA	NA
WP_014503259.1|2038205_2038946_-	flagellar motor protein	NA	NA	NA	NA	NA
WP_024743070.1|2039034_2039388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033003138.1|2041674_2042382_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	1.4e-51
WP_082330725.1|2042384_2043329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130625354.1|2042961_2043897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743072.1|2043898_2046118_-	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	28.6	3.7e-05
WP_024743073.1|2046372_2046825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324484.1|2047716_2050758_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_082324483.1|2051002_2051281_-	hypothetical protein	NA	A0A0P0ZG22	Escherichia_phage	70.3	9.0e-34
WP_058419068.1|2051436_2052405_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_024744204.1|2052888_2053323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807133.1|2054717_2055939_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	67.7	2.1e-103
WP_082324260.1|2056035_2056437_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_024745516.1|2056433_2056943_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	36.0	1.3e-09
WP_024745515.1|2056923_2057265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324259.1|2057278_2057875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419060.1|2057980_2059357_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_058419060.1|2059813_2061190_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
>prophage 14
NZ_CP019085	Xanthomonas oryzae pv. oryzae strain MAI68 chromosome, complete genome	4703782	2139430	2201871	4703782	tRNA,transposase,protease	Ralstonia_phage(25.0%)	48	NA	NA
WP_101807140.1|2139430_2140567_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_024744409.1|2140563_2141022_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_024744410.1|2141272_2141593_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.3e-12
WP_024744411.1|2141735_2144018_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.6	5.1e-175
WP_002813418.1|2144225_2144444_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_024744412.1|2144524_2145277_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_024744413.1|2145410_2146040_-	cinnamoyl-CoA reductase	NA	NA	NA	NA	NA
WP_154221278.1|2146231_2146453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744414.1|2146715_2147837_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_101807141.1|2147894_2148863_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	2.0e-64
WP_101807142.1|2149146_2151504_+	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
WP_024744416.1|2151666_2153595_+	DUF3857 domain-containing protein	NA	NA	NA	NA	NA
WP_082324480.1|2153701_2154331_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_033003706.1|2154443_2158610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744419.1|2158846_2160223_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.3	4.0e-74
WP_024744420.1|2160254_2160581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324256.1|2160577_2160985_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	7.5e-21
WP_024744422.1|2161016_2161367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744423.1|2161363_2162695_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	4.3e-41
WP_024744424.1|2163015_2164221_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_024744425.1|2164385_2166758_-	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_053513574.1|2166782_2167415_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002812972.1|2167633_2168059_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
WP_024744427.1|2168077_2169283_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_024744428.1|2169293_2170082_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_024744429.1|2170078_2170939_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024744430.1|2171009_2171648_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_082324255.1|2171644_2172865_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_024744432.1|2172875_2174273_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_024744433.1|2174587_2175808_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_082330762.1|2176299_2177460_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_101807324.1|2178308_2179325_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.3	3.3e-49
WP_101807143.1|2179662_2180262_-	DUF1264 domain-containing protein	NA	NA	NA	NA	NA
WP_101807144.1|2180407_2181376_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	2.8e-98
WP_082324479.1|2181524_2181914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744965.1|2181852_2182230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033003964.1|2182435_2183689_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_101807145.1|2183726_2184296_+	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_024744963.1|2184279_2184642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744960.1|2187016_2187994_-	siroheme synthase	NA	NA	NA	NA	NA
WP_024744957.1|2189315_2189504_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024744956.1|2189516_2189792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019302775.1|2190436_2190694_+	stress-induced protein	NA	NA	NA	NA	NA
WP_101807146.1|2190919_2191888_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.1e-99
WP_024744883.1|2192529_2193015_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_101807147.1|2193121_2194042_+	M14 family metallocarboxypeptidase	NA	NA	NA	NA	NA
WP_024744881.1|2195231_2197043_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_058419089.1|2200902_2201871_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	5.6e-99
>prophage 15
NZ_CP019085	Xanthomonas oryzae pv. oryzae strain MAI68 chromosome, complete genome	4703782	2220806	2366819	4703782	plate,transposase	Tupanvirus(42.86%)	51	NA	NA
WP_107490085.1|2220806_2221907_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	3.2e-42
WP_101807325.1|2222246_2222609_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_101807151.1|2222665_2226559_+	avirulence protein	NA	NA	NA	NA	NA
WP_101807152.1|2226690_2229777_+	avirulence protein	NA	NA	NA	NA	NA
WP_101867667.1|2229908_2234012_+	avirulence protein	NA	NA	NA	NA	NA
WP_024743648.1|2235943_2236837_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024743647.1|2237090_2238743_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	27.5	9.1e-41
WP_082324252.1|2238836_2239796_-|transposase	transposase	transposase	A0A0M5M147	Mycobacterium_phage	33.8	5.7e-11
WP_131112935.1|2239848_2243847_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	25.7	4.6e-54
WP_130625348.1|2243850_2244333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743561.1|2244243_2246883_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	24.9	4.1e-67
WP_024743560.1|2246810_2247518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101836533.1|2247748_2267230_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.1	9.2e-132
WP_101807157.1|2267235_2289648_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.0	1.1e-133
WP_101807158.1|2289644_2304131_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	24.9	1.4e-124
WP_024744003.1|2304662_2305757_+	type III polyketide synthase	NA	NA	NA	NA	NA
WP_024744002.1|2305796_2306540_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_024744001.1|2306536_2307814_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_024744000.1|2307801_2309157_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_024743999.1|2309153_2309951_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_024743998.1|2310027_2311734_+	cyclic peptide export ABC transporter	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	22.4	2.0e-06
WP_003468470.1|2311832_2312051_+	MbtH family NRPS accessory protein	NA	NA	NA	NA	NA
WP_101807326.1|2312433_2314017_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_024743719.1|2317660_2320786_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_024743718.1|2320837_2321950_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_053513440.1|2322073_2322652_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053512987.1|2325206_2327294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743837.1|2329231_2332321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033007312.1|2334605_2335313_+	response regulator	NA	NA	NA	NA	NA
WP_101807160.1|2335309_2336302_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_033003485.1|2336298_2338758_+	two-component system VirA-like sensor kinase	NA	NA	NA	NA	NA
WP_033003483.1|2338871_2339852_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_101807161.1|2339860_2340889_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_024743830.1|2341061_2341388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053513001.1|2341384_2344288_-	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	1.9e-09
WP_024743828.1|2344284_2345007_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_053513003.1|2345003_2345651_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_053513005.1|2345647_2349106_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_024743825.1|2349109_2350426_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_024743824.1|2350427_2351765_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_024743823.1|2351761_2353150_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_024743822.1|2353146_2353686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743821.1|2353694_2355632_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.6	7.7e-39
WP_024743820.1|2355895_2356357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743819.1|2356459_2356663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324173.1|2357707_2359084_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
WP_058419068.1|2359246_2360215_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_024743894.1|2360656_2363428_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.3	1.2e-77
WP_024743895.1|2363460_2364471_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_024743896.1|2364434_2366312_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_024743897.1|2366315_2366819_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 16
NZ_CP019085	Xanthomonas oryzae pv. oryzae strain MAI68 chromosome, complete genome	4703782	2616952	2707769	4703782	tRNA,transposase,protease	Ralstonia_phage(14.29%)	53	NA	NA
WP_014503014.1|2616952_2617393_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.0	7.1e-25
WP_024744763.1|2617471_2618107_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_082324468.1|2618503_2619247_-	cytochrome c1	NA	NA	NA	NA	NA
WP_024744765.1|2619254_2620514_-	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_024744766.1|2620513_2621158_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_024744767.1|2621685_2622672_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	56.0	1.3e-29
WP_050588012.1|2624024_2624318_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_024744770.1|2624613_2626068_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_024744771.1|2626491_2627478_+	PhoH family protein	NA	A0A1B2ICF6	Erwinia_phage	47.7	4.8e-45
WP_033003832.1|2627908_2628553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744772.1|2628607_2629093_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_024744773.1|2629092_2629611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744774.1|2629705_2630584_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_024744775.1|2630580_2631861_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_024744776.1|2631876_2632878_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_033003835.1|2633029_2634394_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_101807173.1|2634868_2635717_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_024744779.1|2635713_2636625_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_024744780.1|2636753_2637887_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	7.4e-26
WP_082324228.1|2638032_2639544_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_024744782.1|2639530_2641117_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_024744783.1|2641113_2642316_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_058419102.1|2643164_2644133_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	3.6e-98
WP_024743152.1|2646752_2648138_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_024743150.1|2648784_2650164_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_033003186.1|2650163_2651480_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_082330729.1|2651616_2652861_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.4	1.9e-19
WP_024743147.1|2653166_2654447_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_082324226.1|2654748_2655057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743145.1|2655016_2657365_-	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_024743144.1|2657361_2658207_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_024743143.1|2658213_2659893_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_024743142.1|2660421_2661774_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_024743141.1|2661834_2664966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743140.1|2665130_2665985_+	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	38.7	3.2e-13
WP_101807174.1|2666155_2667460_+	DUF445 family protein	NA	NA	NA	NA	NA
WP_024743138.1|2667601_2671696_+	response regulator	NA	A0A1V0SGX0	Hokovirus	28.4	5.0e-56
WP_058419204.1|2672788_2673757_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
WP_024743589.1|2674243_2679253_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_101807175.1|2679530_2680190_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743591.1|2680204_2681512_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_101807176.1|2681524_2684695_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_024744846.1|2687386_2688382_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_024744845.1|2688542_2691059_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
WP_024744844.1|2691055_2692012_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_024744843.1|2692170_2693913_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_082324465.1|2694231_2695368_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_058419101.1|2695762_2698525_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.4	3.6e-42
WP_024712661.1|2698795_2699521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324130.1|2699999_2701016_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
WP_101807177.1|2703591_2704335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807178.1|2704951_2706328_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_101807049.1|2706667_2707769_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	5.0e-43
>prophage 17
NZ_CP019085	Xanthomonas oryzae pv. oryzae strain MAI68 chromosome, complete genome	4703782	2901761	3018271	4703782	tRNA,transposase,protease	Ralstonia_phage(13.33%)	84	NA	NA
WP_058419096.1|2901761_2902730_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
WP_082324130.1|2904121_2905138_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
WP_101807194.1|2905310_2906213_-	CAP domain-containing protein	NA	NA	NA	NA	NA
WP_101807195.1|2906410_2907778_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.9	1.6e-112
WP_024743338.1|2908029_2908542_+	DUF3060 domain-containing protein	NA	NA	NA	NA	NA
WP_082324207.1|2908471_2908711_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_024743337.1|2909053_2910553_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_024743336.1|2910549_2911482_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024743335.1|2911662_2914491_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_024743334.1|2914533_2915736_+	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_014502759.1|2915977_2917414_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.8	3.7e-38
WP_024743333.1|2917612_2918206_+	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	2.1e-11
WP_082324453.1|2918470_2919064_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	8.1e-16
WP_024743331.1|2919060_2920830_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.5	5.2e-58
WP_024743330.1|2921072_2921927_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743329.1|2921923_2923327_+	TolC family protein	NA	NA	NA	NA	NA
WP_024743328.1|2923678_2923873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743327.1|2924152_2925274_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_024743326.1|2925270_2926188_-	pyridoxal kinase	NA	NA	NA	NA	NA
WP_101807196.1|2926715_2927846_-	molecular chaperone DnaJ	NA	Q8QNB4	Ectocarpus_siliculosus_virus	30.0	1.4e-24
WP_024743324.1|2928005_2929931_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	2.2e-147
WP_011258741.1|2930072_2930591_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_101807197.1|2930691_2931744_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_024743322.1|2931860_2933525_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_082324204.1|2933967_2934393_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_011258737.1|2934482_2934878_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_024743320.1|2935224_2935500_-	RnfH family protein	NA	NA	NA	NA	NA
WP_024743319.1|2935513_2935945_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_010366344.1|2936005_2936509_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	41.9	5.8e-23
WP_024743318.1|2936673_2939121_-	S8 family serine peptidase	NA	A0A218KC60	Bacillus_phage	26.7	2.6e-15
WP_058419096.1|2940870_2941839_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
WP_101807198.1|2942061_2943438_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.3	7.3e-60
WP_033003395.1|2944206_2944899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130625332.1|2945017_2945443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807049.1|2945590_2946692_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	5.0e-43
WP_033003338.1|2947671_2947920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082330739.1|2948196_2949351_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_024743456.1|2949350_2950673_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_024743457.1|2950699_2951740_+	fatty acid desaturase family protein	NA	NA	NA	NA	NA
WP_082324452.1|2951757_2952618_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_101807199.1|2952653_2953253_+	LysE family translocator	NA	NA	NA	NA	NA
WP_082324200.1|2953319_2954255_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_082324199.1|2954320_2955673_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_058419055.1|2956221_2957598_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_158525112.1|2957594_2958692_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.1	1.5e-76
WP_101807049.1|2958740_2959842_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	5.0e-43
WP_024743394.1|2963192_2964167_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.0	2.6e-19
WP_024743393.1|2966029_2966755_-	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.8e-09
WP_101807075.1|2967217_2968015_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082324197.1|2968023_2969478_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.5	4.4e-47
WP_024743064.1|2969544_2970975_-	replicative DNA helicase	NA	O80281	Escherichia_phage	53.6	3.8e-120
WP_024743063.1|2971196_2971751_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	34.1	1.2e-18
WP_024743062.1|2971967_2973908_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.8	2.6e-26
WP_024743061.1|2974083_2974722_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_012444392.1|2978788_2979580_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_024743060.1|2979725_2979941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743059.1|2979940_2980708_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_024743058.1|2980769_2981600_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_024743057.1|2981672_2982101_+	cytochrome c	NA	NA	NA	NA	NA
WP_024743056.1|2982232_2982712_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011258294.1|2982962_2983178_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
WP_024743055.1|2983405_2983891_+	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_024744839.1|2986509_2988741_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	59.7	1.5e-09
WP_058419090.1|2988884_2990261_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
WP_058419089.1|2991379_2992348_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	5.6e-99
WP_101836935.1|2992669_2993743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807200.1|2993915_2994884_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
WP_033004173.1|2995974_2996610_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_053513872.1|2996745_2998263_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_024745369.1|2998597_3000478_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.9	5.2e-24
WP_024745370.1|3000666_3001446_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_011259009.1|3001527_3002013_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	36.2	2.8e-14
WP_082330790.1|3004470_3004710_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_024745371.1|3004959_3005673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745372.1|3007186_3007693_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_024745373.1|3007854_3008433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745374.1|3008524_3009025_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_101807203.1|3009091_3009937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050588027.1|3009987_3010266_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_024745377.1|3010485_3010674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014503886.1|3011087_3011696_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_024745379.1|3012892_3014710_+	M14 family metallopeptidase	NA	NA	NA	NA	NA
WP_024745380.1|3014838_3017028_+	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_101807204.1|3017473_3018271_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP019085	Xanthomonas oryzae pv. oryzae strain MAI68 chromosome, complete genome	4703782	3409481	3463966	4703782	tRNA,transposase	Acidithiobacillus_phage(33.33%)	36	NA	NA
WP_107490063.1|3409481_3410584_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	1.9e-42
WP_024744212.1|3410895_3411807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744213.1|3411931_3414517_-	ATP-dependent chaperone ClpB	NA	A0A1C3S747	Escherichia_phage	35.4	3.8e-126
WP_024744214.1|3414962_3415268_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_024744215.1|3415648_3418264_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.5	2.8e-28
WP_024744216.1|3418564_3419179_+	DUF937 domain-containing protein	NA	NA	NA	NA	NA
WP_024744217.1|3419611_3421858_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_024744218.1|3421981_3422389_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_024744219.1|3422729_3424220_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_005989873.1|3424838_3425246_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_024744220.1|3425390_3426149_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_024744221.1|3426213_3426726_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_011258141.1|3426769_3427027_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_024744222.1|3427136_3427934_-	aminotransferase class IV family protein	NA	NA	NA	NA	NA
WP_050588001.1|3429173_3430409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744223.1|3430557_3431934_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_011407903.1|3432318_3433110_+	membrane protein	NA	NA	NA	NA	NA
WP_024744224.1|3433396_3434446_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_024744225.1|3434685_3436269_+	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
WP_101807217.1|3436456_3437255_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_033003517.1|3438349_3440311_-	response regulator	NA	NA	NA	NA	NA
WP_024743903.1|3440294_3441182_-	histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	33.0	9.3e-24
WP_024743904.1|3441178_3442189_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_024743905.1|3442179_3442575_-	anti-sigma regulatory factor	NA	NA	NA	NA	NA
WP_014504248.1|3442571_3442934_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_024743906.1|3442935_3443778_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_024743907.1|3444452_3446777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324164.1|3446801_3448772_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	21.2	3.5e-15
WP_053513725.1|3448883_3450314_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_053513727.1|3451074_3451866_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_101836534.1|3452083_3452365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807218.1|3453172_3454567_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_101807336.1|3454874_3455977_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	3.8e-43
WP_101807219.1|3456154_3457531_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
WP_058419060.1|3460371_3461748_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_158525114.1|3462853_3463966_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	59.9	6.5e-59
>prophage 19
NZ_CP019085	Xanthomonas oryzae pv. oryzae strain MAI68 chromosome, complete genome	4703782	3552905	3573671	4703782	tRNA,transposase	Ralstonia_phage(60.0%)	15	NA	NA
WP_058419069.1|3552905_3553874_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.6e-98
WP_130625388.1|3553968_3554160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745347.1|3554232_3554625_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_130625389.1|3556410_3557301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419068.1|3557768_3558737_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_082324099.1|3558981_3560358_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_107490060.1|3561360_3562463_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	1.1e-42
WP_101807338.1|3563323_3564326_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	4.2e-97
WP_024744854.1|3567410_3567611_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_024744855.1|3567973_3568768_+	thiazole synthase	NA	NA	NA	NA	NA
WP_014504352.1|3569069_3569828_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_014504353.1|3569903_3571766_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_024744856.1|3571823_3572165_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_014504356.1|3572423_3572699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807223.1|3572872_3573671_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP019085	Xanthomonas oryzae pv. oryzae strain MAI68 chromosome, complete genome	4703782	3818819	3885489	4703782	tRNA,transposase,protease	Staphylococcus_phage(14.29%)	46	NA	NA
WP_058419057.1|3818819_3819788_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
WP_024744620.1|3819989_3820412_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	62.2	1.0e-41
WP_024744619.1|3821004_3821394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744618.1|3821386_3823039_+|protease	serine protease	protease	NA	NA	NA	NA
WP_101807233.1|3823490_3824297_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	37.1	9.1e-10
WP_024745219.1|3824349_3825528_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	33.3	6.9e-51
WP_050588023.1|3825914_3826844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324136.1|3827008_3828409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745216.1|3828356_3830264_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_101807234.1|3830276_3831299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745214.1|3831428_3832268_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_024745213.1|3832878_3834036_+	phosphotransferase	NA	NA	NA	NA	NA
WP_053513843.1|3834071_3836234_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_053513841.1|3836608_3837184_+	nicotinamide mononucleotide transporter	NA	NA	NA	NA	NA
WP_024745210.1|3837289_3838018_+	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_024745209.1|3838448_3839288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745208.1|3839284_3841588_-	type II secretion system secretin GspD	NA	A7BJX1	Enterobacteria_phage	24.4	1.5e-09
WP_101807235.1|3841584_3842415_-	general secretion pathway protein GspN	NA	NA	NA	NA	NA
WP_024745206.1|3842404_3843058_-	general secretion pathway protein GspM	NA	NA	NA	NA	NA
WP_024745205.1|3843041_3844163_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011407644.1|3844159_3845011_-	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_024745204.1|3845007_3845643_-	type II secretion system protein J	NA	NA	NA	NA	NA
WP_024745203.1|3845639_3846056_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_024745202.1|3846052_3846562_-	type II secretion system protein GspH	NA	NA	NA	NA	NA
WP_011407642.1|3846571_3847003_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_011257722.1|3847270_3848488_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_082324135.1|3848487_3848667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324134.1|3848663_3850403_-	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_024745200.1|3850520_3852404_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.7	7.0e-21
WP_053513836.1|3852624_3858705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745197.1|3859682_3863735_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	56.9	5.8e-121
WP_024745196.1|3864150_3864948_-	DsbC family protein	NA	NA	NA	NA	NA
WP_024745195.1|3865431_3866403_-	site-specific tyrosine recombinase XerD	NA	A0A0K0N6I5	Gordonia_phage	30.3	1.9e-14
WP_024745194.1|3866828_3867296_+	RDD family protein	NA	NA	NA	NA	NA
WP_082324133.1|3867393_3867705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745193.1|3867709_3868816_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_053513834.1|3868812_3869895_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_024745191.1|3870002_3871475_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.5	9.0e-48
WP_024745189.1|3871830_3872256_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_082324132.1|3872266_3873499_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_082324131.1|3873501_3874149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745188.1|3874277_3877220_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	34.2	2.2e-130
WP_053513831.1|3877942_3879916_+	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	36.7	1.3e-14
WP_101807236.1|3880372_3881749_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	9.2e-63
WP_082324130.1|3882102_3883119_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
WP_082324130.1|3884472_3885489_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
>prophage 21
NZ_CP019085	Xanthomonas oryzae pv. oryzae strain MAI68 chromosome, complete genome	4703782	3905289	3911659	4703782		Enterobacteria_phage(50.0%)	6	NA	NA
WP_011407616.1|3905289_3906636_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
WP_024743259.1|3906681_3908085_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	28.8	1.6e-41
WP_024743260.1|3908201_3909110_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	33.8	5.4e-27
WP_024743261.1|3909106_3909664_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.1	1.7e-44
WP_011407613.1|3909660_3910548_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
WP_011407612.1|3910603_3911659_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
>prophage 22
NZ_CP019085	Xanthomonas oryzae pv. oryzae strain MAI68 chromosome, complete genome	4703782	4259943	4336723	4703782	transposase	Acidithiobacillus_phage(21.43%)	57	NA	NA
WP_058419036.1|4259943_4260912_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_154221287.1|4261201_4261366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050588016.1|4261355_4261826_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_024744929.1|4262510_4264643_-	ATP-dependent DNA helicase DinG	NA	NA	NA	NA	NA
WP_082324401.1|4265129_4265492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744927.1|4265493_4266345_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_024744926.1|4266397_4267279_+	TolB-like protein	NA	NA	NA	NA	NA
WP_024744925.1|4267944_4270506_-	iron-uptake factor	NA	NA	NA	NA	NA
WP_101807267.1|4270738_4271491_+	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	33.3	2.8e-21
WP_053513030.1|4271618_4272533_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024744922.1|4272625_4273603_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_014505063.1|4273790_4274783_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_033003934.1|4275003_4275252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744920.1|4275457_4275928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744919.1|4276028_4277819_-	DUF885 domain-containing protein	NA	NA	NA	NA	NA
WP_024744918.1|4278023_4280261_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_101807344.1|4281854_4282871_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	3.3e-49
WP_082324203.1|4283041_4284418_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
WP_024743126.1|4286836_4287847_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_024743127.1|4288247_4289441_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024712051.1|4289437_4290184_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	5.2e-20
WP_024743128.1|4290215_4291817_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011257320.1|4291877_4292078_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024743129.1|4292074_4292662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743130.1|4293110_4293383_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_024743131.1|4293448_4294438_+	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_082324107.1|4294507_4295269_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_024743133.1|4295371_4296367_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.2	8.5e-26
WP_033003179.1|4296384_4297176_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_024743135.1|4297177_4297762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033003181.1|4297880_4298819_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_101807269.1|4298932_4299136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807049.1|4299175_4300277_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	5.0e-43
WP_058419060.1|4300705_4302082_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_024744975.1|4302662_4303211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053512924.1|4303698_4303983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744977.1|4304567_4305845_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_011257407.1|4306124_4306451_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_024744978.1|4306422_4306917_-	flavodoxin	NA	A0A068CFW0	Listeria_phage	36.1	2.7e-17
WP_024744979.1|4306924_4308250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712257.1|4308324_4309368_-	ribonucleotide-diphosphate reductase subunit beta	NA	A8ASV9	Listeria_phage	75.1	1.1e-151
WP_101807270.1|4309565_4312064_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A088FNW1	Listeria_phage	66.9	4.1e-303
WP_024744981.1|4312679_4313723_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	51.8	4.8e-80
WP_024744982.1|4313829_4316538_-	bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024744983.1|4316824_4317439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257400.1|4317510_4318878_-	magnesium transporter	NA	NA	NA	NA	NA
WP_024744985.1|4319567_4321391_+	potassium transporter KefB	NA	NA	NA	NA	NA
WP_082330734.1|4322934_4324878_-	glucose-6-phosphate dehydrogenase	NA	E3SJC5	Synechococcus_phage	37.3	2.6e-79
WP_024743306.1|4324727_4326527_-	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_082324102.1|4326590_4326920_-	phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_024743307.1|4326946_4330267_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_011407425.1|4330259_4330520_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_024743308.1|4330738_4331938_+	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_024743309.1|4331937_4332711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743310.1|4332707_4333529_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_024743311.1|4333525_4335148_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_101807272.1|4335346_4336723_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	2.2e-64
>prophage 23
NZ_CP019085	Xanthomonas oryzae pv. oryzae strain MAI68 chromosome, complete genome	4703782	4406217	4576175	4703782	tRNA,transposase	Acidithiobacillus_phage(16.13%)	106	NA	NA
WP_101807275.1|4406217_4407186_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
WP_082324392.1|4407311_4407677_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_024743782.1|4407673_4408975_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_024743781.1|4409155_4409932_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024743780.1|4410408_4410993_+	manganese efflux pump MntP family protein	NA	NA	NA	NA	NA
WP_024743779.1|4411185_4414635_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_024743778.1|4415386_4418029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743777.1|4418132_4420532_-	NdvB protein	NA	NA	NA	NA	NA
WP_024743776.1|4420534_4421917_-	MFS transporter	NA	NA	NA	NA	NA
WP_024743775.1|4422074_4422659_+	gluconokinase	NA	NA	NA	NA	NA
WP_024743774.1|4423494_4425225_+	PQQ-binding-like beta-propeller repeat protein	NA	A0A0M4JT37	Mollivirus	36.1	1.7e-82
WP_082324100.1|4425556_4425862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324389.1|4425764_4426205_-	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_024743773.1|4426224_4426653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107490046.1|4428199_4429301_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.9e-43
WP_101807277.1|4429320_4430289_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
WP_058419036.1|4431719_4432688_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_053513161.1|4432951_4436809_-	translocation/assembly module TamB	NA	NA	NA	NA	NA
WP_024743466.1|4436805_4438587_-	outer membrane protein assembly factor	NA	NA	NA	NA	NA
WP_033003342.1|4438761_4441521_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.8	9.3e-147
WP_024743464.1|4441773_4443363_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_024743463.1|4443362_4445621_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_024743462.1|4445778_4446687_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_024743461.1|4446776_4448591_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_158525116.1|4448984_4457444_-	hypothetical protein	NA	A0A1S5SDF1	Streptococcus_phage	32.0	1.3e-10
WP_011409712.1|4458396_4459149_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_024745621.1|4459208_4460108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745620.1|4460260_4461016_-	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_024745619.1|4461012_4461585_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_003484969.1|4461600_4461828_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_024745618.1|4461900_4462806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745617.1|4462959_4463925_+	ferrochelatase	NA	NA	NA	NA	NA
WP_024745616.1|4463927_4464779_+	alpha/beta hydrolase	NA	R4JP33	Mycobacterium_phage	31.3	1.3e-06
WP_024745615.1|4464859_4465318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745614.1|4465588_4466374_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_024745613.1|4466989_4467895_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	33.2	1.4e-43
WP_024745612.1|4467958_4468876_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	3.1e-83
WP_053513079.1|4469509_4470847_+	xylose isomerase	NA	NA	NA	NA	NA
WP_024744967.1|4471072_4472140_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_101807280.1|4472294_4474490_+	alpha-glucuronidase	NA	NA	NA	NA	NA
WP_101807281.1|4474486_4476451_+	9-O-acetylesterase	NA	NA	NA	NA	NA
WP_101807282.1|4476462_4477722_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
WP_101807349.1|4477721_4479422_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_101807283.1|4479424_4482139_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_101807284.1|4482361_4483882_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	31.4	2.5e-45
WP_107490031.1|4483876_4484908_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.3e-74
WP_082324355.1|4485090_4486467_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_033003464.1|4486643_4487747_+	restriction endonuclease or methylase	NA	A0A1S5SAB0	Streptococcus_phage	40.4	9.4e-58
WP_024743784.1|4487838_4488213_-	VOC family protein	NA	NA	NA	NA	NA
WP_082324356.1|4488913_4489930_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.9e-49
WP_024743734.1|4490552_4491608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743735.1|4491834_4493253_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_024743736.1|4493293_4494271_-	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_082324358.1|4495675_4497157_-	MFS transporter	NA	NA	NA	NA	NA
WP_082324566.1|4497498_4500372_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024743740.1|4500470_4501958_+	MFS transporter	NA	NA	NA	NA	NA
WP_024743741.1|4501989_4503024_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_024743742.1|4503365_4503899_+	lipocalin family protein	NA	NA	NA	NA	NA
WP_101807285.1|4504180_4505149_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	6.6e-100
WP_154221296.1|4505200_4505539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807286.1|4505615_4506421_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.0	7.7e-09
WP_024743989.1|4506622_4507195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011349116.1|4507333_4507552_+	YdcH family protein	NA	NA	NA	NA	NA
WP_024743991.1|4508188_4509169_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_024743992.1|4509364_4512028_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_024743993.1|4512027_4513002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324359.1|4513000_4513246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743994.1|4513414_4514467_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_053513382.1|4514631_4517670_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_058419058.1|4518508_4519885_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	3.2e-63
WP_024743574.1|4522633_4524163_+	tryptophan 7-halogenase	NA	M4T1E3	Cyanophage	28.5	3.9e-46
WP_024743573.1|4524469_4525249_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_024743572.1|4525245_4526256_-	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_101807288.1|4526535_4527201_+	YceH family protein	NA	NA	NA	NA	NA
WP_101807290.1|4528599_4530576_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.2	6.3e-113
WP_024743567.1|4530782_4531412_+	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	1.1e-52
WP_024743566.1|4531870_4533109_+	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_024743565.1|4533251_4534850_-	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_082324360.1|4534918_4536010_-	DUF4380 domain-containing protein	NA	NA	NA	NA	NA
WP_033003378.1|4536242_4537058_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.0	1.1e-18
WP_058419055.1|4537346_4538723_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_024744511.1|4545201_4547106_-	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.0e-19
WP_024744510.1|4547102_4547705_-	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_024744509.1|4547805_4549065_-	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_024744508.1|4549355_4551518_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_024744507.1|4551670_4551877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807291.1|4552084_4552474_-	YchJ family protein	NA	NA	NA	NA	NA
WP_082330766.1|4552531_4553353_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_101807292.1|4553477_4554854_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.3	4.3e-60
WP_053513660.1|4554985_4556167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053513661.1|4556264_4559696_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_024745665.1|4559843_4560542_-	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_024745666.1|4560525_4561998_-	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
WP_024745667.1|4561994_4562582_-	DUF4276 family protein	NA	NA	NA	NA	NA
WP_024745668.1|4562581_4563778_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_082324363.1|4563851_4564481_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	49.5	4.2e-47
WP_050588040.1|4564574_4565072_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053513662.1|4566485_4567010_+	FUSC family protein	NA	NA	NA	NA	NA
WP_101807293.1|4566981_4567998_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
WP_024744628.1|4568404_4569766_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.1	5.8e-33
WP_101807219.1|4569946_4571323_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
WP_082324568.1|4572011_4572725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745343.1|4572755_4573262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745344.1|4573535_4573742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745345.1|4573728_4574841_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_107490090.1|4575073_4576175_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	3.2e-42
>prophage 24
NZ_CP019085	Xanthomonas oryzae pv. oryzae strain MAI68 chromosome, complete genome	4703782	4584901	4642779	4703782	transposase	Acidithiobacillus_phage(30.77%)	44	NA	NA
WP_058419060.1|4584901_4586278_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_024742954.1|4586802_4587114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024742953.1|4587373_4587856_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_024742952.1|4588152_4589322_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_024742951.1|4589563_4589752_+	CsbD family protein	NA	NA	NA	NA	NA
WP_074038671.1|4590396_4590654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024742950.1|4590778_4591228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024742949.1|4591384_4592365_+	ATP-binding cassette domain-containing protein	NA	K7PHD1	Enterobacteria_phage	46.4	7.0e-73
WP_082324366.1|4593284_4593641_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024743547.1|4593683_4596464_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024743548.1|4596750_4597773_+	sugar kinase	NA	NA	NA	NA	NA
WP_154221263.1|4598229_4598370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743549.1|4598393_4599602_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_024743552.1|4601573_4602740_+	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_154221305.1|4604028_4604397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419197.1|4604691_4606068_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.0e-77
WP_082324367.1|4606078_4606372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324368.1|4606482_4608678_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.6	2.4e-65
WP_024712580.1|4608776_4609979_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_024743645.1|4610249_4611260_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	7.3e-49
WP_024743646.1|4611534_4612002_+	DUF4410 domain-containing protein	NA	NA	NA	NA	NA
WP_082324173.1|4613378_4614755_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
WP_158500224.1|4614870_4615188_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_101807296.1|4615300_4616269_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
WP_130625425.1|4616693_4616924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130625426.1|4617087_4619733_+	protein kinase/lanthionine synthetase C family protein	NA	NA	NA	NA	NA
WP_131085815.1|4619773_4620520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807297.1|4620541_4621837_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_050587973.1|4621856_4623983_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.3	7.9e-29
WP_101807298.1|4624239_4625487_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.6	2.1e-61
WP_082324571.1|4626779_4627190_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_033003354.1|4627449_4627905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130625428.1|4627837_4628098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807299.1|4628128_4629016_-	pseudouridylate synthase	NA	NA	NA	NA	NA
WP_033003355.1|4629349_4630927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743499.1|4631421_4632249_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_058419165.1|4632975_4634034_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.6e-73
WP_107490046.1|4635777_4636879_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.9e-43
WP_101807300.1|4637116_4637677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058419031.1|4637675_4638644_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
WP_130625431.1|4638738_4639041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745548.1|4639112_4639850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033004251.1|4639867_4640560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807103.1|4641753_4642779_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.9e-49
