The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	7509	60933	4698819	protease,transposase	Leptospira_phage(28.57%)	38	NA	NA
WP_024744592.1|7509_8346_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_024744593.1|8530_9337_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_024744594.1|9613_10807_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_053513954.1|10960_11629_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_014501265.1|11713_12475_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010364790.1|12521_12944_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_024743315.1|12947_13361_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_024743314.1|13656_14424_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_024743313.1|14434_14704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743312.1|14778_16239_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_101807019.1|17384_18761_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	4.1e-63
WP_101807304.1|18989_19874_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	2.0e-87
WP_107490060.1|19890_20992_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	1.1e-42
WP_024744007.1|21252_22380_-	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_024744008.1|23450_24791_-	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_010364746.1|25008_25701_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_008572943.1|25817_26138_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_024744009.1|27435_28959_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	29.2	1.0e-25
WP_033003570.1|29063_30299_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_024744011.1|30459_31116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053512972.1|31278_33090_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_024744014.1|33237_33588_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_024744015.1|33894_35025_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_033003577.1|35807_36860_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_033003579.1|37560_38634_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_024744018.1|38942_40001_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.9e-77
WP_131091728.1|42408_42753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107490044.1|43088_44120_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_024744291.1|44201_45683_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024744290.1|45877_50350_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_024744289.1|50551_50932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324081.1|51078_52266_+	DNA topoisomerase IB	NA	A0A0U2TSJ7	Niemeyer_virus	35.3	1.3e-41
WP_024744287.1|52468_52774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324376.1|53960_55100_+	saccharopine dehydrogenase	NA	NA	NA	NA	NA
WP_024744284.1|55413_56199_-	DUF1868 domain-containing protein	NA	NA	NA	NA	NA
WP_033003662.1|56209_58798_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024744282.1|58970_60128_+	ROK family protein	NA	NA	NA	NA	NA
WP_101807022.1|60170_60933_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	322162	388888	4698819	transposase	Leptospira_phage(37.5%)	50	NA	NA
WP_107490044.1|322162_323194_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_101807309.1|323229_324669_-	HpaF protein	NA	NA	NA	NA	NA
WP_024744915.1|325733_328142_-	serine kinase	NA	NA	NA	NA	NA
WP_107490032.1|329608_330711_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	3.8e-43
WP_082324345.1|331577_332024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513734.1|332020_334021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744340.1|334794_335265_-	4-hydroxyphenylacetate 3-monooxygenase	NA	NA	NA	NA	NA
WP_130625300.1|335319_335601_-	serine kinase	NA	NA	NA	NA	NA
WP_024744341.1|335681_335924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744342.1|335933_336872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744343.1|336868_337696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744344.1|337692_337953_-	EscS/YscS/HrcS family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_024744345.1|337957_338602_-	EscR/YscR/HrcR family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_024744346.1|338588_339542_-	YscQ/HrcQ family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_053513737.1|339634_340276_-	type III secretion protein HpaP	NA	NA	NA	NA	NA
WP_053513739.1|340275_342198_-	hypersensitivity response secretion protein hrcV	NA	NA	NA	NA	NA
WP_024744349.1|342206_343280_-	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_011257083.1|343495_343951_+	HrpB1 family type III secretion system apparatus protein	NA	NA	NA	NA	NA
WP_011407211.1|343984_344377_+	type III secretion protein HrpB2	NA	NA	NA	NA	NA
WP_024744351.1|344378_345143_+	EscJ/YscJ/HrcJ family type III secretion inner membrane ring protein	NA	NA	NA	NA	NA
WP_024744352.1|345150_345780_+	type III secretion protein HrpB4	NA	NA	NA	NA	NA
WP_024744353.1|345764_346466_+	HrpE/YscL family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_024744354.1|346455_347784_+	EscN/YscN/HrcN family type III secretion system ATPase	NA	NA	NA	NA	NA
WP_053513741.1|347776_348286_+	type III secretion protein HrpB7	NA	NA	NA	NA	NA
WP_024744356.1|348282_349113_+	EscT/YscT/HrcT family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_053513743.1|349195_351019_+	EscC/YscC/HrcC family type III secretion system outer membrane ring protein	NA	NA	NA	NA	NA
WP_053513745.1|351758_352190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053513747.1|352600_353164_+	lytic transglycosylase domain-containing protein	NA	A0A0K2QQJ4	Ralstonia_phage	39.4	5.2e-12
WP_024744361.1|353627_355181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744362.1|356447_356789_-	HPF/RaiA family ribosome-associated protein	NA	NA	NA	NA	NA
WP_053513751.1|356973_359532_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_053513749.1|359550_359811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807032.1|359890_360859_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.6e-98
WP_033003076.1|360984_362709_-	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.7	3.0e-34
WP_024742976.1|362949_363891_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_107490044.1|365447_366479_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_101807033.1|366526_368161_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_050587979.1|368698_370228_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_024742979.1|370224_372456_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_024742980.1|372458_374216_+	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_082324554.1|374272_376162_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_024742982.1|376158_378762_+	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_011407199.1|378784_378970_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_024742983.1|379083_381246_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_024742984.1|381262_381895_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_101807034.1|382260_383637_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.5	2.0e-78
WP_024743402.1|383718_384474_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_024743401.1|384851_386261_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024743400.1|386609_387041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419058.1|387511_388888_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	3.2e-63
>prophage 3
NZ_CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	492791	710279	4698819	tail,plate,capsid,integrase,protease,head,terminase,tRNA,transposase,portal,holin	Stenotrophomonas_phage(31.25%)	155	518418:518462	561400:561444
WP_053513464.1|492791_493355_-|tRNA	tRNA threonylcarbamoyladenosine biosynthesis protein RimN	tRNA	NA	NA	NA	NA
WP_024745936.1|493365_495858_-	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.3	1.9e-114
WP_101807039.1|496040_497315_-	RDD family protein	NA	NA	NA	NA	NA
WP_101807040.1|497356_498079_-	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_024745938.1|498119_498593_-	DUF494 family protein	NA	NA	NA	NA	NA
WP_101807041.1|498635_499778_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_101807042.1|499849_500986_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
WP_024745941.1|501118_501631_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
WP_024745942.1|502031_502955_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_024745943.1|502954_504268_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_053513456.1|506218_507496_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_024745946.1|507693_508518_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_024745947.1|508518_509577_+	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
WP_024745948.1|509743_511249_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_053513469.1|511245_511755_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_019302641.1|511864_512998_-	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.1e-28
WP_014504872.1|513240_513762_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_033004404.1|513960_514875_-	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_024745951.1|514975_515416_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_014504870.1|515524_517399_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
WP_024745952.1|517591_517912_+	hypothetical protein	NA	NA	NA	NA	NA
518418:518462	attL	CTCATAATCCTTTGGTTGAAGGTTCGAATCCTTCTGGGCCCACCA	NA	NA	NA	NA
WP_082330806.1|518531_519806_-|integrase	tyrosine-type recombinase/integrase	integrase	V9IQN0	Stenotrophomonas_phage	50.5	1.1e-110
WP_011257520.1|519939_520146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075243253.1|520142_520415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745956.1|520411_520657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745957.1|520653_520929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745958.1|521090_521501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258448.1|521726_522005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408133.1|522001_522220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082330809.1|522528_525201_-	toprim domain-containing protein	NA	V9IQW5	Stenotrophomonas_phage	69.7	0.0e+00
WP_011258450.1|525234_525447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408135.1|525443_525722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745959.1|525732_526053_-	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	56.5	6.3e-23
WP_053503015.1|526055_526313_-	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	46.4	6.6e-07
WP_011258452.1|526384_526822_+	transcriptional regulator	NA	E5E3P4	Burkholderia_phage	32.0	5.4e-09
WP_011258453.1|527482_528469_-	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	54.8	2.5e-94
WP_011258454.1|528465_528867_-|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	62.3	6.0e-39
WP_024745960.1|528879_531750_-|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	47.5	6.2e-194
WP_011258456.1|531782_531896_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
WP_011258457.1|531904_532207_-|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	62.6	6.3e-25
WP_011258458.1|532252_532762_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	79.9	1.8e-72
WP_011258459.1|532792_533959_-|tail	tail sheath protein	tail	E5FFG9	Burkholderia_phage	62.4	4.6e-132
WP_024745961.1|533970_534330_-|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	66.1	4.3e-36
WP_024745962.1|534326_534890_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	43.7	3.1e-25
WP_024745963.1|534950_535529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745964.1|535536_537042_-|tail	tail fiber protein	tail	V9IQX0	Stenotrophomonas_phage	47.0	2.1e-52
WP_024745965.1|537051_537597_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.7	3.5e-50
WP_024745966.1|537589_538480_-|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	53.7	7.2e-85
WP_024745967.1|538561_539011_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	54.7	1.8e-36
WP_024745968.1|538998_539418_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	65.2	2.0e-40
WP_011258470.1|539891_540533_-	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	60.9	7.9e-49
WP_024745970.1|540529_540805_-|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	59.8	3.0e-21
WP_024745971.1|540797_541154_-	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	4.5e-22
WP_024745972.1|541158_541368_-|tail	tail protein	tail	K4PAW7	Burkholderia_phage	59.4	5.4e-15
WP_012445486.1|541367_541835_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.7	9.2e-31
WP_011258475.1|541934_542654_-|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	63.4	2.0e-69
WP_024745974.1|542657_543677_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	70.9	2.1e-136
WP_024745975.1|543723_544566_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	52.6	1.7e-67
WP_033004409.1|544687_546472_+|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	75.1	1.2e-267
WP_024745977.1|546471_547491_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	72.5	4.1e-140
WP_082330810.1|547511_547742_+	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	54.8	1.9e-13
WP_024745978.1|547674_548379_+	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	77.8	3.3e-109
WP_033004412.1|548410_548878_-	DUF4411 family protein	NA	NA	NA	NA	NA
WP_024745980.1|548877_550056_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_101807043.1|550786_553546_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.3	1.8e-41
WP_024745590.1|553554_554481_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_101807044.1|554477_557312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743124.1|557339_558071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807045.1|558097_560440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324338.1|561511_561745_-	hypothetical protein	NA	V9IQN0	Stenotrophomonas_phage	53.1	4.1e-16
561400:561444	attR	CTCATAATCCTTTGGTTGAAGGTTCGAATCCTTCTGGGCCCACCA	NA	NA	NA	NA
WP_024743230.1|563621_565511_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_011260615.1|565727_566069_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	44.4	2.3e-15
WP_053513444.1|566267_567992_+	ATP-dependent RNA helicase RhlB	NA	A0A1V0SBR7	Catovirus	29.4	1.1e-47
WP_024743228.1|568067_568754_+	cell division ATP-binding protein FtsE	NA	NA	NA	NA	NA
WP_024743227.1|568750_569701_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_082324547.1|569757_570552_+	response regulator	NA	NA	NA	NA	NA
WP_053513446.1|570548_571274_+	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	44.3	4.7e-50
WP_024743224.1|571490_572366_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	39.5	3.6e-44
WP_053513448.1|572444_573059_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_053513449.1|573111_574404_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003483210.1|576694_576982_+	co-chaperone GroES	NA	A0A221S331	uncultured_virus	40.0	5.1e-16
WP_011260602.1|577125_578766_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	63.5	5.1e-177
WP_053513452.1|579066_581343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058419179.1|582450_583419_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_058419036.1|585804_586773_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_024745526.1|587704_588778_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	47.9	4.3e-84
WP_053513971.1|589294_591472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513973.1|591565_593983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513975.1|594246_595167_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_024745528.1|595166_595685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053513977.1|595846_598672_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_053513979.1|598767_599328_-	VUT family protein	NA	A0A2I7SAW6	Vibrio_phage	30.2	1.4e-12
WP_058419055.1|601034_602411_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_101807046.1|603395_603998_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_053513670.1|606503_607004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053513672.1|607904_608852_-	nucleoside-diphosphate sugar epimerase	NA	NA	NA	NA	NA
WP_024745121.1|608988_609579_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_024745122.1|609789_610533_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_024745365.1|612848_615536_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_024745366.1|615622_616360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807047.1|616370_617747_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	7.1e-63
WP_130625305.1|617926_618487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419175.1|618805_620182_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	7.1e-63
WP_053513412.1|620492_623222_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.7	3.8e-68
WP_082324544.1|623290_624466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324336.1|624512_626390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807048.1|626403_627978_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_053513416.1|628110_629073_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_058419060.1|629360_630737_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_058419174.1|631742_635567_+	avirulence protein	NA	NA	NA	NA	NA
WP_024745997.1|636636_638220_-	SDR family oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
WP_082324335.1|638610_638802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745996.1|641302_643627_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_024745994.1|645530_646622_-	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_024745993.1|647586_648465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324334.1|648653_649538_+	DMT family transporter	NA	NA	NA	NA	NA
WP_024745991.1|649815_651588_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_050588046.1|651985_653686_-	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
WP_033004419.1|654840_656217_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_024745988.1|656303_657299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745987.1|657544_658456_+	magnesium transporter	NA	NA	NA	NA	NA
WP_024745985.1|658990_659275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745984.1|659604_660051_+	autotransporter	NA	NA	NA	NA	NA
WP_101807049.1|660362_661464_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	5.0e-43
WP_058419060.1|662173_663550_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_024743083.1|664722_666414_-	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_024743082.1|666666_667452_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_024743081.1|668695_669700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743080.1|669738_670668_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_024743079.1|671203_674092_-	insulinase family protein	NA	NA	NA	NA	NA
WP_024743078.1|674344_676927_+	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	29.2	3.2e-08
WP_101807050.1|677504_678303_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024745720.1|680906_682361_-	cellulase family glycosylhydrolase	NA	H2DE45	Erwinia_phage	32.6	5.2e-48
WP_024745721.1|682568_684056_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	57.1	2.4e-125
WP_082324540.1|684335_685289_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	38.0	1.7e-15
WP_024745723.1|685457_687107_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_033004321.1|688098_690036_+	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_024745725.1|690187_690856_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024745726.1|690860_691913_+	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.6	1.4e-18
WP_024745727.1|691943_692681_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024745728.1|692711_693626_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_024745729.1|694188_694989_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_024745730.1|695550_696516_+	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_024745731.1|696624_697194_-	lipocalin family protein	NA	NA	NA	NA	NA
WP_024745732.1|697578_697890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745733.1|697957_700051_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_053513809.1|700645_701830_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_024745735.1|701939_704075_+	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	26.1	1.8e-28
WP_024745736.1|704418_704817_+	YbaN family protein	NA	NA	NA	NA	NA
WP_024745737.1|704874_705117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745738.1|705106_705961_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_082324332.1|705948_706629_+	DUF484 family protein	NA	NA	NA	NA	NA
WP_024745740.1|706822_707740_+	tyrosine recombinase XerC	NA	A0A142F2H8	Mycobacterium_phage	28.1	1.7e-12
WP_024745741.1|708255_708807_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_024745742.1|708911_710279_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.5	4.7e-43
>prophage 4
NZ_CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	728115	815983	4698819	transposase	Ralstonia_phage(16.67%)	60	NA	NA
WP_053513544.1|728115_729147_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	7.9e-75
WP_024743814.1|730448_731840_+	endopolygalacturonase	NA	NA	NA	NA	NA
WP_024743813.1|732108_733248_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_024743812.1|733244_734660_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	50.6	4.3e-15
WP_024743811.1|735161_736367_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.9	1.6e-66
WP_011409453.1|737446_737725_+	YbeD family protein	NA	NA	NA	NA	NA
WP_024743809.1|737712_738411_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_024743808.1|738425_739439_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_033003474.1|739837_742021_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	31.4	3.7e-82
WP_024743806.1|742312_743179_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_024743805.1|743340_744396_+	bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase	NA	A0A1B0V161	Roseobacter_phage	47.1	3.7e-80
WP_024743804.1|744518_745922_+	nicotinate phosphoribosyltransferase	NA	A0A218M332	Acidovorax_phage	52.6	6.6e-133
WP_024743801.1|748141_748903_+	DUF2242 domain-containing protein	NA	NA	NA	NA	NA
WP_011409446.1|749027_749408_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_058419171.1|749579_750917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743799.1|750937_751879_+	decarboxylating 6-phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	44.6	8.5e-68
WP_024743798.1|752218_753277_-	oxidoreductase	NA	NA	NA	NA	NA
WP_082324538.1|753436_753799_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_024743796.1|754083_755895_+	PAS domain S-box protein	NA	A0A2K9L0Z8	Tupanvirus	27.8	3.5e-09
WP_011260315.1|755891_756332_+	response regulator	NA	NA	NA	NA	NA
WP_053513717.1|756335_757838_+	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L5I4	Tupanvirus	26.9	4.9e-09
WP_024743794.1|757929_758445_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_024743793.1|758613_759351_-	pteridine reductase	NA	NA	NA	NA	NA
WP_033003467.1|759418_760603_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_058419161.1|762003_762972_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	2.3e-100
WP_107490082.1|763023_763122_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024743525.1|764000_766709_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_050587990.1|766859_769754_+	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	25.2	2.0e-22
WP_053513077.1|769750_772147_+	alpha-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_024743528.1|772280_773447_+	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_050587991.1|773661_774429_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743530.1|774473_775751_+	sugar MFS transporter	NA	NA	NA	NA	NA
WP_024743531.1|775791_776859_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743532.1|776865_777894_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_024743533.1|777896_779051_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_024743534.1|779555_780161_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_024743535.1|780157_781411_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_024743536.1|781412_783311_-	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_024743537.1|783312_785355_-	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_024743539.1|786568_787801_-	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	41.5	2.3e-73
WP_058419068.1|788021_788990_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_101807052.1|794354_795092_-	endonuclease	NA	NA	NA	NA	NA
WP_053513041.1|795141_795957_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_101807053.1|796048_796699_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_082324537.1|796792_797533_-	cytochrome c4	NA	NA	NA	NA	NA
WP_024744861.1|797734_798358_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_024744862.1|798451_799147_-	VIT family protein	NA	NA	NA	NA	NA
WP_024744863.1|799362_800727_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_058419060.1|802518_803895_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_024712624.1|804669_805155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744626.1|806097_807018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513043.1|807050_808550_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.1	3.6e-12
WP_082324328.1|808546_809266_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024744866.1|809404_810505_+	glycosyltransferase	NA	A0A142BZU7	Faustovirus	28.5	9.8e-15
WP_024744868.1|811640_811916_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_024744869.1|811980_813090_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.4	3.8e-35
WP_024744870.1|813158_813734_+	S-(hydroxymethyl)glutathione synthase	NA	NA	NA	NA	NA
WP_024744871.1|813793_814624_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_024744872.1|814753_814963_+	DUF4386 family protein	NA	NA	NA	NA	NA
WP_058419036.1|815014_815983_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
>prophage 5
NZ_CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	1073223	1135648	4698819	protease,transposase	Leptospira_phage(16.67%)	44	NA	NA
WP_107490031.1|1073223_1074255_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.3e-74
WP_058419168.1|1075315_1076284_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	2.8e-98
WP_082324317.1|1078186_1079560_-	MFS transporter	NA	NA	NA	NA	NA
WP_024745685.1|1079658_1081698_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_024745686.1|1081905_1082928_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_024745687.1|1083343_1084441_+	OmpA family protein	NA	NA	NA	NA	NA
WP_024745688.1|1084633_1085143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513257.1|1085162_1086023_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_024745690.1|1085973_1086366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745691.1|1086368_1087577_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.5	2.9e-20
WP_053513259.1|1087667_1088765_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024745693.1|1088768_1089629_+	sulfate ABC transporter permease subunit CysT	NA	NA	NA	NA	NA
WP_024745694.1|1089625_1090579_+	sulfate ABC transporter permease subunit CysW	NA	NA	NA	NA	NA
WP_024745695.1|1090586_1091621_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	2.0e-25
WP_024745696.1|1091980_1092694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033004302.1|1092763_1093786_-	L-threonine 3-dehydrogenase	NA	NA	NA	NA	NA
WP_024745698.1|1094017_1094305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033004295.1|1094301_1096635_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_033004296.1|1099049_1101200_+	S46 family peptidase	NA	NA	NA	NA	NA
WP_024745700.1|1101292_1101937_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_024745701.1|1102907_1104206_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_024745702.1|1104273_1105356_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_033004297.1|1105570_1106311_+	CvpA family protein	NA	NA	NA	NA	NA
WP_024745703.1|1106347_1107814_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.1	8.3e-86
WP_024745704.1|1107952_1108777_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_101807070.1|1109496_1110295_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024745844.1|1110757_1111177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513157.1|1111356_1112100_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_024745846.1|1112734_1113277_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_053513155.1|1113257_1114394_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_033004364.1|1114598_1116125_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_024745848.1|1116296_1118399_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_082324316.1|1118502_1119846_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	33.8	5.0e-29
WP_024745850.1|1119903_1120593_-	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	35.7	5.9e-34
WP_082324528.1|1120767_1122414_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_024745852.1|1122563_1122872_+	glutaredoxin 3	NA	A0A2L0UZG6	Agrobacterium_phage	43.2	4.7e-07
WP_024745853.1|1122868_1123264_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_014502224.1|1123478_1124486_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_014502225.1|1124626_1125388_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_058419165.1|1126594_1127653_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.6e-73
WP_058419103.1|1128969_1129938_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
WP_024745448.1|1132225_1133518_+	trigger factor	NA	NA	NA	NA	NA
WP_002806026.1|1133610_1134237_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_011257881.1|1134361_1135648_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
>prophage 7
NZ_CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	1243142	1394569	4698819	protease,plate,transposase	Ralstonia_phage(15.38%)	107	NA	NA
WP_101807076.1|1243142_1244540_-|protease	serine protease	protease	NA	NA	NA	NA
WP_053513692.1|1244967_1246938_+	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_024744518.1|1247782_1248628_+	transporter	NA	NA	NA	NA	NA
WP_024744517.1|1248916_1251037_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_024744516.1|1251313_1251775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744515.1|1251906_1252632_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_053513688.1|1253449_1255591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513686.1|1255707_1257843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807077.1|1258005_1258811_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	37.1	5.3e-10
WP_024745783.1|1259913_1261152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745784.1|1261977_1264083_-	catalase	NA	A0A2K9L0T1	Tupanvirus	47.7	1.9e-136
WP_050588043.1|1265732_1266380_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	45.5	6.5e-35
WP_024745785.1|1266376_1266928_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_101807315.1|1267293_1270227_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	49.9	8.9e-257
WP_024745787.1|1270694_1270886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745788.1|1271316_1272120_+	sulfotransferase	NA	M4QPS9	Synechococcus_phage	27.7	9.0e-26
WP_033004344.1|1272208_1273420_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_024745790.1|1273416_1275576_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	28.0	2.2e-34
WP_024745792.1|1276384_1276789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745793.1|1276870_1278889_-	M2 family metallopeptidase	NA	NA	NA	NA	NA
WP_024745794.1|1279000_1280671_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_024745795.1|1280667_1281432_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_024745796.1|1281531_1283265_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_024745797.1|1283484_1284201_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.4	2.8e-23
WP_024745798.1|1284193_1285486_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_024745799.1|1285637_1286129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745800.1|1286197_1286455_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_024745801.1|1286457_1287267_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_024745802.1|1287302_1288043_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_014502368.1|1288047_1288647_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024745803.1|1288891_1290088_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_008574699.1|1290087_1290729_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024745804.1|1291079_1292276_+	polyketide cyclase	NA	NA	NA	NA	NA
WP_024745805.1|1292357_1292744_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_024745806.1|1292746_1293421_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_024745807.1|1293484_1294282_-	D-alanyl-D-alanine carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_024745808.1|1294412_1294592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745809.1|1294588_1294873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745812.1|1295488_1296691_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_101807079.1|1297095_1297512_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024745813.1|1297667_1298399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745814.1|1298598_1299477_+	M15 family metallopeptidase	NA	A8ATW4	Listeria_phage	34.5	3.9e-06
WP_024745815.1|1299584_1299845_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_024745816.1|1299904_1301386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745817.1|1301401_1305139_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_101807080.1|1305135_1306119_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_053513252.1|1306115_1306910_+	OmpA family protein	NA	NA	NA	NA	NA
WP_024745820.1|1306962_1308033_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_107490031.1|1308963_1309995_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.3e-74
WP_101807081.1|1310066_1312889_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.4	1.0e-52
WP_101807316.1|1313394_1314411_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.3	7.3e-49
WP_058419153.1|1315518_1316895_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	3.0e-77
WP_058419152.1|1317038_1318415_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.6	5.1e-61
WP_058419050.1|1319079_1320048_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_024744031.1|1320461_1320974_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_033003115.1|1323523_1324312_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_011259947.1|1324311_1325646_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_024743027.1|1325797_1326406_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_033003111.1|1326791_1327280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003467601.1|1327326_1327827_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011409204.1|1327830_1329327_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003467612.1|1329468_1329966_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011409203.1|1330113_1330602_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_024743026.1|1330604_1332440_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_024743025.1|1332403_1333495_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_053513684.1|1333580_1336313_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.6	7.1e-91
WP_014502423.1|1336343_1336697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807082.1|1336789_1339576_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.3	6.9e-41
WP_053513217.1|1339550_1340423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107490046.1|1342459_1343562_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.9e-43
WP_024743437.1|1346069_1347134_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_024743436.1|1347148_1347400_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_024743435.1|1347699_1348812_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_024743434.1|1348808_1349351_-	shikimate kinase	NA	NA	NA	NA	NA
WP_024743433.1|1349517_1350117_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_012445807.1|1350297_1350714_+	YjfI family protein	NA	NA	NA	NA	NA
WP_024743432.1|1350726_1351500_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_024743431.1|1351525_1352608_+	potassium channel protein	NA	NA	NA	NA	NA
WP_082324520.1|1352610_1353282_+	YjfK family protein	NA	NA	NA	NA	NA
WP_024743429.1|1353319_1353724_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_024743428.1|1353736_1354309_+	DUF1190 domain-containing protein	NA	A0A191ZBZ0	Erwinia_phage	28.1	6.4e-10
WP_024743427.1|1354310_1355477_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	41.6	6.4e-73
WP_050587989.1|1355839_1356301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743426.1|1358098_1360105_+	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_082324305.1|1361154_1364301_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024743423.1|1364632_1365385_+	SapC family protein	NA	NA	NA	NA	NA
WP_101807084.1|1365395_1366442_+	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_024743421.1|1366482_1368000_+	tryptophan 7-halogenase	NA	A0A1D7SF58	Cyanophage	31.8	5.8e-50
WP_024743420.1|1368037_1369042_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_024743419.1|1369186_1369585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807085.1|1369716_1371093_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	6.0e-78
WP_024745604.1|1371680_1373078_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_024745603.1|1373519_1374902_-	APC family permease	NA	NA	NA	NA	NA
WP_024745602.1|1375094_1375859_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024745601.1|1376172_1377114_+	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_053513783.1|1377869_1379258_+	amino acid permease	NA	NA	NA	NA	NA
WP_101807086.1|1381207_1382662_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	41.0	9.0e-93
WP_033004264.1|1382618_1383521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050588037.1|1383520_1384762_-	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	34.7	3.2e-54
WP_101807087.1|1384994_1385963_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.6e-98
WP_024744440.1|1387083_1388100_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_082324517.1|1388160_1388955_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_024744438.1|1389114_1390476_-	magnesium transporter	NA	NA	NA	NA	NA
WP_024744437.1|1390763_1392494_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	24.1	1.0e-10
WP_005913389.1|1392552_1392822_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_003487850.1|1392814_1393207_-	PTS fructose IIA component family protein	NA	NA	NA	NA	NA
WP_058419145.1|1393600_1394569_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
>prophage 8
NZ_CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	1419992	1527274	4698819	protease,tRNA,transposase	Ralstonia_phage(18.75%)	87	NA	NA
WP_107490044.1|1419992_1421024_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_058419036.1|1421090_1422059_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_011258205.1|1422362_1422692_-	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_024743872.1|1422688_1423228_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_058419057.1|1423437_1424406_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
WP_024743209.1|1424519_1425764_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.7	5.0e-92
WP_024743208.1|1425760_1427023_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_024743207.1|1427022_1427787_-	Fe-S cluster assembly ATPase SufC	NA	W5SAS9	Pithovirus	28.5	2.0e-11
WP_024743206.1|1428044_1429502_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_024743205.1|1429517_1429976_-	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_003487757.1|1430147_1430615_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_033003226.1|1430719_1430938_+	peptidase	NA	NA	NA	NA	NA
WP_024743204.1|1431544_1432141_-	DUF1439 domain-containing protein	NA	NA	NA	NA	NA
WP_033003224.1|1432196_1432739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743203.1|1432796_1433138_-	DUF3861 domain-containing protein	NA	NA	NA	NA	NA
WP_024743202.1|1433195_1433837_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_024743201.1|1433941_1434367_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_024743200.1|1434922_1435783_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_024743199.1|1435826_1436519_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_101807090.1|1436584_1437350_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024743682.1|1437700_1438738_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_024743681.1|1438851_1439982_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_082324514.1|1440271_1440928_+	YitT family protein	NA	NA	NA	NA	NA
WP_024743679.1|1442030_1442603_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_024743678.1|1442599_1443034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033003404.1|1443030_1443912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743677.1|1443879_1444446_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_024743676.1|1444438_1444906_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_024743675.1|1444919_1445867_+	aspartate carbamoyltransferase catalytic subunit	NA	NA	NA	NA	NA
WP_024743674.1|1446303_1446738_+	OsmC family protein	NA	NA	NA	NA	NA
WP_024743673.1|1446890_1447490_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_024743672.1|1447787_1448669_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_024743669.1|1449761_1452371_+	bifunctional aspartate kinase/diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_024743668.1|1452354_1452813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743667.1|1452809_1454165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743666.1|1454145_1455552_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_053512934.1|1455868_1456690_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_058419088.1|1456784_1457753_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.5e-99
WP_024743020.1|1458007_1459006_-	octaprenyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_024743021.1|1459281_1459815_+	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	60.9	1.9e-32
WP_024743022.1|1460097_1461582_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.5	5.0e-14
WP_024743023.1|1461875_1462583_+	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_154221304.1|1463191_1463353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324511.1|1465094_1465772_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_158500229.1|1465893_1466340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016904074.1|1466308_1466533_-	putative selenoprotein	NA	NA	NA	NA	NA
WP_024745822.1|1466532_1468605_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_050588044.1|1468888_1469695_+	pirin family protein	NA	NA	NA	NA	NA
WP_101807093.1|1469781_1470153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419141.1|1470556_1473373_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.6	4.7e-53
WP_024745912.1|1473372_1474269_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_024745911.1|1474265_1474730_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_082324298.1|1474753_1475233_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_082324297.1|1475382_1475862_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_082324296.1|1475948_1477685_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_082324203.1|1478465_1479842_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
WP_024743650.1|1480492_1481089_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_058419169.1|1481514_1482891_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.0e-77
WP_024712501.1|1485794_1486256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130625317.1|1487571_1488228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024742990.1|1488495_1489209_-	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_024742991.1|1489312_1490062_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_082324510.1|1491503_1492625_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_082324295.1|1492639_1493467_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_024743606.1|1493450_1494734_-	EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_024743605.1|1494760_1495276_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_024743604.1|1495286_1497443_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.5	1.4e-09
WP_024743603.1|1497511_1499515_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011258268.1|1499533_1499863_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_131091743.1|1499893_1500121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743602.1|1500352_1503817_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_014502625.1|1504210_1504753_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_033003388.1|1505177_1506086_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_024743600.1|1507616_1508429_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_024743598.1|1509374_1509986_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_024743597.1|1510104_1510989_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_024743596.1|1511010_1512102_+	DUF3616 domain-containing protein	NA	NA	NA	NA	NA
WP_024743595.1|1512170_1513574_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_019302800.1|1513587_1514094_+	Fur family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743594.1|1514496_1514955_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_024743593.1|1515732_1515936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807094.1|1516099_1517243_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.9	1.2e-84
WP_101807095.1|1517352_1518369_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
WP_101807096.1|1518654_1520031_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	53.7	8.9e-74
WP_033004102.1|1520058_1520949_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_024743817.1|1521635_1522232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107490052.1|1526242_1527274_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	8.7e-74
>prophage 9
NZ_CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	1569964	1637944	4698819	protease,tRNA,transposase	Ralstonia_phage(33.33%)	57	NA	NA
WP_058419068.1|1569964_1570933_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_024744656.1|1571256_1571550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324504.1|1571628_1572042_-	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_033003771.1|1572733_1573720_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_053513278.1|1573770_1574004_-	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_024744651.1|1574477_1574771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807099.1|1575663_1576113_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_053513279.1|1576378_1577236_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.0e-11
WP_024744648.1|1577440_1578052_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_024744647.1|1578163_1580806_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	40.0	4.7e-172
WP_024744646.1|1581319_1581955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807100.1|1581977_1583006_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_101807101.1|1583002_1583902_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_011259822.1|1583958_1584375_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_053513280.1|1584386_1585502_+	J domain-containing protein	NA	NA	NA	NA	NA
WP_024744641.1|1586591_1587062_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_033003769.1|1587499_1588174_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_024744639.1|1588484_1591595_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024744638.1|1592061_1592796_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_024744637.1|1592934_1593507_+	Maf-like protein	NA	NA	NA	NA	NA
WP_024744636.1|1593506_1595006_+	ribonuclease G	NA	NA	NA	NA	NA
WP_024744635.1|1595146_1599067_+	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_024744634.1|1599072_1599825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744633.1|1599923_1601369_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_024744632.1|1601625_1602207_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_024744631.1|1602352_1603720_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_082324502.1|1603794_1604199_+	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_024744630.1|1604250_1604712_+	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_024744629.1|1604781_1605879_-|protease	protease	protease	NA	NA	NA	NA
WP_101807075.1|1606285_1607083_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024745348.1|1607195_1608071_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_024745349.1|1608072_1608333_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_024745350.1|1608364_1609669_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_101807102.1|1609702_1611409_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_024745352.1|1611551_1612892_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_024745353.1|1612901_1613738_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_130625325.1|1613744_1613972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745354.1|1613984_1614476_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_024745355.1|1614683_1615433_-	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
WP_024745356.1|1615542_1616079_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
WP_024745357.1|1616189_1616669_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_024745358.1|1616897_1618142_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_024745359.1|1618149_1619400_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_053514015.1|1619396_1620767_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.8	2.4e-34
WP_024744748.1|1622324_1622621_+	cysteine methyltransferase	NA	NA	NA	NA	NA
WP_024744749.1|1622661_1623360_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_058419134.1|1623610_1624579_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
WP_101807103.1|1625162_1626188_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.9e-49
WP_058419132.1|1627305_1627728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743076.1|1628583_1630599_-	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_101807317.1|1631268_1632285_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	9.6e-49
WP_058419036.1|1632681_1633650_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_154221280.1|1633733_1634303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744531.1|1634668_1635520_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_024744530.1|1635615_1636185_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	74.9	4.5e-72
WP_024744529.1|1636219_1636405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058419036.1|1636975_1637944_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
>prophage 10
NZ_CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	1698578	1768237	4698819	transposase,tRNA,integrase	Leptospira_phage(20.0%)	54	1696969:1696985	1771750:1771766
1696969:1696985	attL	TGGCCGAAGGCCGCGCC	NA	NA	NA	NA
WP_024743628.1|1698578_1699505_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_003485583.1|1699661_1699922_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_024743627.1|1700088_1702203_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_024743626.1|1702576_1703617_-	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_101807108.1|1703680_1704556_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_024743624.1|1704552_1704822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743623.1|1704880_1705384_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	38.7	3.6e-17
WP_024743622.1|1705380_1706526_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_024743621.1|1706667_1707246_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	39.6	8.4e-34
WP_024743620.1|1707367_1707688_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_053513476.1|1707684_1708428_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024743618.1|1708424_1709024_+	YhgN family NAAT transporter	NA	NA	NA	NA	NA
WP_024743617.1|1709793_1712988_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024743616.1|1713094_1714480_+	LOG family protein	NA	NA	NA	NA	NA
WP_024743615.1|1714649_1715165_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	A0A1W6JT76	Pseudomonas_phage	42.5	1.1e-05
WP_024743614.1|1715161_1715638_+	type IV pilus modification protein PilV	NA	NA	NA	NA	NA
WP_024743613.1|1715634_1716801_+	PilW family protein	NA	NA	NA	NA	NA
WP_101836532.1|1716797_1717313_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_024743610.1|1718232_1721271_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_024743609.1|1721277_1721733_+	type IV pilin protein	NA	NA	NA	NA	NA
WP_019299933.1|1721909_1722452_-	fimbrial protein	NA	NA	NA	NA	NA
WP_024743608.1|1722590_1724612_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_024744187.1|1726406_1727135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744188.1|1727264_1728359_-	acyltransferase	NA	NA	NA	NA	NA
WP_024744189.1|1728786_1730454_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_024744190.1|1730470_1731328_-	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_024744191.1|1731512_1733054_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	42.8	2.7e-79
WP_024744192.1|1733067_1734273_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_024744193.1|1734333_1735704_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_024744194.1|1736057_1736762_+	histidine utilization repressor	NA	NA	NA	NA	NA
WP_024744195.1|1736918_1737929_-	membrane protein	NA	NA	NA	NA	NA
WP_024744196.1|1738495_1739059_-	phasin family protein	NA	NA	NA	NA	NA
WP_024744197.1|1739220_1739496_-	polyhydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_101807318.1|1739736_1740546_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_024744199.1|1740487_1741144_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_024744200.1|1741445_1742414_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_053513270.1|1742588_1743674_+	phosphoserine transaminase	NA	M1Q1P2	Streptococcus_phage	43.6	1.7e-75
WP_053513272.1|1743756_1744965_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_024744202.1|1745086_1746400_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_101807110.1|1746441_1747239_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_107490046.1|1747434_1748536_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.9e-43
WP_024744617.1|1748956_1749424_-	TonB family protein	NA	NA	NA	NA	NA
WP_058419031.1|1749854_1750823_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
WP_082324283.1|1750944_1751712_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_024743448.1|1751718_1753110_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	49.6	1.0e-93
WP_024743447.1|1753570_1754155_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_024743446.1|1754254_1755271_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_082324494.1|1755894_1757313_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_017154976.1|1757408_1757651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324282.1|1757644_1757986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107490965.1|1758538_1759639_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	7.2e-42
WP_101807112.1|1759696_1763290_-	avirulence protein	NA	NA	NA	NA	NA
WP_024743886.1|1764664_1766776_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.2	1.3e-15
WP_107490049.1|1767271_1768237_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
1771750:1771766	attR	TGGCCGAAGGCCGCGCC	NA	NA	NA	NA
>prophage 11
NZ_CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	1839187	1849075	4698819	tRNA	Micromonas_sp._RCC1109_virus(16.67%)	7	NA	NA
WP_053513920.1|1839187_1840864_+	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.3	2.1e-37
WP_011408885.1|1840952_1841594_+	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_019300309.1|1841766_1842801_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.0	1.6e-112
WP_024745487.1|1843102_1843591_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_024745486.1|1843692_1846341_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.8	2.4e-83
WP_003481884.1|1846480_1846693_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_101807119.1|1848583_1849075_+	glycoside hydrolase family 104 protein	NA	D5LH07	Escherichia_phage	67.7	4.6e-57
>prophage 12
NZ_CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	1974676	2061282	4698819	transposase,tRNA	uncultured_Caudovirales_phage(34.78%)	52	NA	NA
WP_024745402.1|1974676_1976194_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.5	8.6e-86
WP_024745401.1|1976335_1977472_+	two-component system response regulator	NA	NA	NA	NA	NA
WP_024745399.1|1977836_1980014_+	response regulator	NA	A0A1V0SGX0	Hokovirus	33.1	1.3e-47
WP_019299970.1|1980025_1980895_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_024745398.1|1981071_1982754_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.2	2.1e-32
WP_024745396.1|1983403_1986172_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_003486316.1|1986319_1986568_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011259444.1|1986564_1986975_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_024745395.1|1987040_1989632_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_101807129.1|1989985_1990801_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_101807130.1|1991456_1993700_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_024745392.1|1993808_1994885_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_010365269.1|1994881_1995478_-	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_019302811.1|1995474_1996341_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_082324264.1|1996586_1998977_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	58.3	3.9e-08
WP_082324486.1|1999055_1999400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002806488.1|1999754_2000237_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_082324263.1|2000372_2001170_-	flagellar brake protein	NA	NA	NA	NA	NA
WP_053513169.1|2002211_2004473_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.5	1.3e-10
WP_053513167.1|2004884_2007146_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.7	2.5e-12
WP_024742986.1|2007737_2010212_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	47.4	1.9e-10
WP_107490044.1|2010257_2011289_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_053514012.1|2014316_2016560_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.8	3.4e-14
WP_082324099.1|2016818_2018195_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_053513639.1|2018476_2020690_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.2	1.9e-09
WP_053513641.1|2020887_2023257_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.7	2.7e-09
WP_024744836.1|2023270_2024032_-	transporter	NA	NA	NA	NA	NA
WP_101807131.1|2029539_2031801_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.4	2.8e-08
WP_024743066.1|2032699_2034709_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_002806565.1|2034742_2035108_-	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
WP_010375641.1|2035104_2035413_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_101807132.1|2035513_2036536_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_024743068.1|2036532_2037315_-	ParA family protein	NA	Q8JL10	Natrialba_phage	35.7	1.7e-13
WP_024743069.1|2037316_2038291_-	flagellar motor protein MotD	NA	NA	NA	NA	NA
WP_014503259.1|2038297_2039038_-	flagellar motor protein	NA	NA	NA	NA	NA
WP_024743070.1|2039126_2039480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033003138.1|2041766_2042474_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	1.4e-51
WP_082330725.1|2042476_2043421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130625354.1|2043053_2043989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743072.1|2043990_2046210_-	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	28.6	3.7e-05
WP_024743073.1|2046464_2046917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324484.1|2047808_2050850_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_082324483.1|2051094_2051373_-	hypothetical protein	NA	A0A0P0ZG22	Escherichia_phage	70.3	9.0e-34
WP_058419068.1|2051528_2052497_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_024744204.1|2052980_2053415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807133.1|2054809_2056031_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	67.7	2.1e-103
WP_082324260.1|2056127_2056529_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_024745516.1|2056525_2057035_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	36.0	1.3e-09
WP_024745515.1|2057015_2057357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324259.1|2057370_2057967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419060.1|2058072_2059449_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_058419060.1|2059905_2061282_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
>prophage 13
NZ_CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	2139522	2201963	4698819	protease,transposase,tRNA	Ralstonia_phage(25.0%)	48	NA	NA
WP_101807140.1|2139522_2140659_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_024744409.1|2140655_2141114_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_024744410.1|2141364_2141685_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.3e-12
WP_024744411.1|2141827_2144110_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.6	5.1e-175
WP_002813418.1|2144317_2144536_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_024744412.1|2144616_2145369_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_024744413.1|2145502_2146132_-	cinnamoyl-CoA reductase	NA	NA	NA	NA	NA
WP_154221278.1|2146323_2146545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744414.1|2146807_2147929_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_101807141.1|2147986_2148955_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	2.0e-64
WP_101807142.1|2149238_2151596_+	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
WP_024744416.1|2151758_2153687_+	DUF3857 domain-containing protein	NA	NA	NA	NA	NA
WP_082324480.1|2153793_2154423_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_033003706.1|2154535_2158702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744419.1|2158938_2160315_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.3	4.0e-74
WP_024744420.1|2160346_2160673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324256.1|2160669_2161077_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	7.5e-21
WP_024744422.1|2161108_2161459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744423.1|2161455_2162787_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	4.3e-41
WP_024744424.1|2163107_2164313_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_024744425.1|2164477_2166850_-	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_053513574.1|2166874_2167507_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002812972.1|2167725_2168151_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
WP_024744427.1|2168169_2169375_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_024744428.1|2169385_2170174_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_024744429.1|2170170_2171031_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024744430.1|2171101_2171740_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_082324255.1|2171736_2172957_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_024744432.1|2172967_2174365_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_024744433.1|2174679_2175900_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_082330762.1|2176391_2177552_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_101807324.1|2178400_2179417_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.3	3.3e-49
WP_101807143.1|2179754_2180354_-	DUF1264 domain-containing protein	NA	NA	NA	NA	NA
WP_101807144.1|2180499_2181468_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	2.8e-98
WP_082324479.1|2181616_2182006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744965.1|2181944_2182322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033003964.1|2182527_2183781_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_101807145.1|2183818_2184388_+	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_024744963.1|2184371_2184734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744960.1|2187108_2188086_-	siroheme synthase	NA	NA	NA	NA	NA
WP_024744957.1|2189407_2189596_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024744956.1|2189608_2189884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019302775.1|2190528_2190786_+	stress-induced protein	NA	NA	NA	NA	NA
WP_101807146.1|2191011_2191980_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.1e-99
WP_024744883.1|2192621_2193107_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_101807147.1|2193213_2194134_+	M14 family metallocarboxypeptidase	NA	NA	NA	NA	NA
WP_024744881.1|2195323_2197135_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_058419089.1|2200994_2201963_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	5.6e-99
>prophage 14
NZ_CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	2220899	2367422	4698819	plate,transposase	Tupanvirus(42.86%)	51	NA	NA
WP_107490085.1|2220899_2222000_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	3.2e-42
WP_101807325.1|2222339_2222702_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_101807151.1|2222758_2226652_+	avirulence protein	NA	NA	NA	NA	NA
WP_101850708.1|2226783_2230176_+	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_101807153.1|2230307_2234615_+	avirulence protein	NA	NA	NA	NA	NA
WP_024743648.1|2236546_2237440_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024743647.1|2237693_2239346_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	27.5	9.1e-41
WP_082324252.1|2239439_2240399_-|transposase	transposase	transposase	A0A0M5M147	Mycobacterium_phage	33.8	5.7e-11
WP_101807154.1|2240451_2244768_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.7	5.0e-54
WP_131091774.1|2244846_2247468_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	24.9	4.0e-67
WP_024743560.1|2247413_2248121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158525161.1|2248351_2267740_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	25.1	9.1e-132
WP_101807157.1|2267838_2290251_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.0	1.1e-133
WP_101807158.1|2290247_2304734_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	24.9	1.4e-124
WP_101807159.1|2304864_2305110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744003.1|2305265_2306360_+	type III polyketide synthase	NA	NA	NA	NA	NA
WP_024744002.1|2306399_2307143_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_024744001.1|2307139_2308417_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_024744000.1|2308404_2309760_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_024743999.1|2309756_2310554_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_024743998.1|2310630_2312337_+	cyclic peptide export ABC transporter	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	22.4	2.0e-06
WP_003468470.1|2312435_2312654_+	MbtH family NRPS accessory protein	NA	NA	NA	NA	NA
WP_101807326.1|2313036_2314620_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_024743719.1|2318263_2321389_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_024743718.1|2321440_2322553_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_053513440.1|2322676_2323255_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053512987.1|2325809_2327897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743837.1|2329834_2332924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033007312.1|2335208_2335916_+	response regulator	NA	NA	NA	NA	NA
WP_101807160.1|2335912_2336905_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_033003485.1|2336901_2339361_+	two-component system VirA-like sensor kinase	NA	NA	NA	NA	NA
WP_033003483.1|2339474_2340455_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_101807161.1|2340463_2341492_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_024743830.1|2341664_2341991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053513001.1|2341987_2344891_-	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	1.9e-09
WP_024743828.1|2344887_2345610_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_053513003.1|2345606_2346254_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_053513005.1|2346250_2349709_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_024743825.1|2349712_2351029_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_024743824.1|2351030_2352368_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_024743823.1|2352364_2353753_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_024743822.1|2353749_2354289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743821.1|2354297_2356235_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.6	7.7e-39
WP_024743820.1|2356498_2356960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743819.1|2357062_2357266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324173.1|2358310_2359687_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
WP_058419068.1|2359849_2360818_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_024743894.1|2361259_2364031_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.3	1.2e-77
WP_024743895.1|2364063_2365074_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_024743896.1|2365037_2366915_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_024743897.1|2366918_2367422_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 15
NZ_CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	2617555	2708371	4698819	protease,transposase,tRNA	Ralstonia_phage(14.29%)	54	NA	NA
WP_014503014.1|2617555_2617996_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.0	7.1e-25
WP_024744763.1|2618074_2618710_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_082324468.1|2619106_2619850_-	cytochrome c1	NA	NA	NA	NA	NA
WP_024744765.1|2619857_2621117_-	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_024744766.1|2621116_2621761_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_024744767.1|2622288_2623275_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	56.0	1.3e-29
WP_050588012.1|2624627_2624921_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_130625339.1|2624937_2625177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744770.1|2625215_2626670_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_024744771.1|2627093_2628080_+	PhoH family protein	NA	A0A1B2ICF6	Erwinia_phage	47.7	4.8e-45
WP_033003832.1|2628510_2629155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744772.1|2629209_2629695_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_024744773.1|2629694_2630213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744774.1|2630307_2631186_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_024744775.1|2631182_2632463_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_024744776.1|2632478_2633480_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_033003835.1|2633631_2634996_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_101807173.1|2635470_2636319_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_024744779.1|2636315_2637227_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_024744780.1|2637355_2638489_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	7.4e-26
WP_082324228.1|2638634_2640146_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_024744782.1|2640132_2641719_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_024744783.1|2641715_2642918_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_058419102.1|2643766_2644735_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	3.6e-98
WP_024743152.1|2647354_2648740_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_024743150.1|2649386_2650766_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_033003186.1|2650765_2652082_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_082330729.1|2652218_2653463_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.4	1.9e-19
WP_024743147.1|2653768_2655049_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_082324226.1|2655350_2655659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743145.1|2655618_2657967_-	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_024743144.1|2657963_2658809_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_024743143.1|2658815_2660495_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_024743142.1|2661023_2662376_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_024743141.1|2662436_2665568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743140.1|2665732_2666587_+	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	38.7	3.2e-13
WP_101807174.1|2666757_2668062_+	DUF445 family protein	NA	NA	NA	NA	NA
WP_024743138.1|2668203_2672298_+	response regulator	NA	A0A1V0SGX0	Hokovirus	28.4	5.0e-56
WP_058419204.1|2673390_2674359_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
WP_024743589.1|2674845_2679855_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_101807175.1|2680132_2680792_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743591.1|2680806_2682114_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_101807176.1|2682126_2685297_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_024744846.1|2687988_2688984_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_024744845.1|2689144_2691661_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
WP_024744844.1|2691657_2692614_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_024744843.1|2692772_2694515_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_082324465.1|2694833_2695970_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_058419101.1|2696364_2699127_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.4	3.6e-42
WP_024712661.1|2699397_2700123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324130.1|2700601_2701618_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
WP_101807177.1|2704193_2704937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807178.1|2705553_2706930_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_101807049.1|2707269_2708371_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	5.0e-43
>prophage 16
NZ_CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	2901210	3017720	4698819	protease,tRNA,transposase	Ralstonia_phage(13.33%)	84	NA	NA
WP_058419096.1|2901210_2902179_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
WP_082324130.1|2903570_2904587_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
WP_101807194.1|2904759_2905662_-	CAP domain-containing protein	NA	NA	NA	NA	NA
WP_101807195.1|2905859_2907227_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.9	1.6e-112
WP_024743338.1|2907478_2907991_+	DUF3060 domain-containing protein	NA	NA	NA	NA	NA
WP_082324207.1|2907920_2908160_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_024743337.1|2908502_2910002_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_024743336.1|2909998_2910931_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024743335.1|2911111_2913940_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_024743334.1|2913982_2915185_+	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_014502759.1|2915426_2916863_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.8	3.7e-38
WP_024743333.1|2917061_2917655_+	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	2.1e-11
WP_082324453.1|2917919_2918513_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	8.1e-16
WP_024743331.1|2918509_2920279_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.5	5.2e-58
WP_024743330.1|2920521_2921376_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743329.1|2921372_2922776_+	TolC family protein	NA	NA	NA	NA	NA
WP_024743328.1|2923127_2923322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743327.1|2923601_2924723_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_024743326.1|2924719_2925637_-	pyridoxal kinase	NA	NA	NA	NA	NA
WP_101807196.1|2926164_2927295_-	molecular chaperone DnaJ	NA	Q8QNB4	Ectocarpus_siliculosus_virus	30.0	1.4e-24
WP_024743324.1|2927454_2929380_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	2.2e-147
WP_011258741.1|2929521_2930040_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_101807197.1|2930140_2931193_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_024743322.1|2931309_2932974_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_082324204.1|2933416_2933842_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_011258737.1|2933931_2934327_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_024743320.1|2934673_2934949_-	RnfH family protein	NA	NA	NA	NA	NA
WP_024743319.1|2934962_2935394_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_010366344.1|2935454_2935958_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	41.9	5.8e-23
WP_024743318.1|2936122_2938570_-	S8 family serine peptidase	NA	A0A218KC60	Bacillus_phage	26.7	2.6e-15
WP_058419096.1|2940319_2941288_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
WP_101807198.1|2941510_2942887_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.3	7.3e-60
WP_033003395.1|2943655_2944348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130625332.1|2944466_2944892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807049.1|2945039_2946141_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	5.0e-43
WP_033003338.1|2947120_2947369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082330739.1|2947645_2948800_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_024743456.1|2948799_2950122_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_024743457.1|2950148_2951189_+	fatty acid desaturase family protein	NA	NA	NA	NA	NA
WP_082324452.1|2951206_2952067_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_101807199.1|2952102_2952702_+	LysE family translocator	NA	NA	NA	NA	NA
WP_082324200.1|2952768_2953704_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_082324199.1|2953769_2955122_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_058419055.1|2955670_2957047_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_158525112.1|2957043_2958141_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.1	1.5e-76
WP_101807049.1|2958189_2959291_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	5.0e-43
WP_024743394.1|2962641_2963616_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.0	2.6e-19
WP_024743393.1|2965478_2966204_-	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.8e-09
WP_101807075.1|2966666_2967464_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082324197.1|2967472_2968927_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.5	4.4e-47
WP_024743064.1|2968993_2970424_-	replicative DNA helicase	NA	O80281	Escherichia_phage	53.6	3.8e-120
WP_024743063.1|2970645_2971200_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	34.1	1.2e-18
WP_024743062.1|2971416_2973357_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.8	2.6e-26
WP_024743061.1|2973532_2974171_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_012444392.1|2978237_2979029_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_024743060.1|2979174_2979390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743059.1|2979389_2980157_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_024743058.1|2980218_2981049_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_024743057.1|2981121_2981550_+	cytochrome c	NA	NA	NA	NA	NA
WP_024743056.1|2981681_2982161_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011258294.1|2982411_2982627_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
WP_024743055.1|2982854_2983340_+	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_024744839.1|2985958_2988190_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	59.7	1.5e-09
WP_058419090.1|2988333_2989710_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
WP_058419089.1|2990828_2991797_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	5.6e-99
WP_101836935.1|2992118_2993192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807200.1|2993364_2994333_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
WP_033004173.1|2995423_2996059_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_053513872.1|2996194_2997712_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_024745369.1|2998046_2999927_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.9	5.2e-24
WP_024745370.1|3000115_3000895_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_011259009.1|3000976_3001462_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	36.2	2.8e-14
WP_082330790.1|3003919_3004159_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_024745371.1|3004408_3005122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745372.1|3006635_3007142_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_024745373.1|3007303_3007882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745374.1|3007973_3008474_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024745375.1|3008540_3009386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050588027.1|3009436_3009715_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_024745377.1|3009934_3010123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014503886.1|3010536_3011145_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_024745379.1|3012341_3014159_+	M14 family metallopeptidase	NA	NA	NA	NA	NA
WP_024745380.1|3014287_3016477_+	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_101807204.1|3016922_3017720_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	3408941	3463433	4698819	tRNA,transposase	Acidithiobacillus_phage(33.33%)	36	NA	NA
WP_107490063.1|3408941_3410044_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	1.9e-42
WP_024744212.1|3410355_3411267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744213.1|3411391_3413977_-	ATP-dependent chaperone ClpB	NA	A0A1C3S747	Escherichia_phage	35.4	3.8e-126
WP_024744214.1|3414422_3414728_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_024744215.1|3415108_3417724_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.5	2.8e-28
WP_024744216.1|3418024_3418639_+	DUF937 domain-containing protein	NA	NA	NA	NA	NA
WP_024744217.1|3419071_3421318_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_024744218.1|3421441_3421849_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_024744219.1|3422189_3423680_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_005989873.1|3424298_3424706_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_024744220.1|3424850_3425609_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_024744221.1|3425673_3426186_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_011258141.1|3426229_3426487_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_024744222.1|3426596_3427394_-	aminotransferase class IV family protein	NA	NA	NA	NA	NA
WP_050588001.1|3428633_3429869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744223.1|3430017_3431394_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_011407903.1|3431785_3432577_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_024744224.1|3432863_3433913_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_024744225.1|3434152_3435736_+	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
WP_101807217.1|3435923_3436722_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_033003517.1|3437816_3439778_-	response regulator	NA	NA	NA	NA	NA
WP_024743903.1|3439761_3440649_-	histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	33.0	9.3e-24
WP_024743904.1|3440645_3441656_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_024743905.1|3441646_3442042_-	anti-sigma regulatory factor	NA	NA	NA	NA	NA
WP_014504248.1|3442038_3442401_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_024743906.1|3442402_3443245_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_024743907.1|3443919_3446244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324164.1|3446268_3448239_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	21.2	3.5e-15
WP_053513725.1|3448350_3449781_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_053513727.1|3450541_3451333_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_101836534.1|3451550_3451832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807218.1|3452639_3454034_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_101807336.1|3454341_3455444_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	3.8e-43
WP_101807219.1|3455621_3456998_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
WP_058419060.1|3459838_3461215_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_158525114.1|3462320_3463433_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	59.9	6.5e-59
>prophage 18
NZ_CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	3552372	3573138	4698819	tRNA,transposase	Ralstonia_phage(60.0%)	15	NA	NA
WP_058419069.1|3552372_3553341_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.6e-98
WP_130625388.1|3553435_3553627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745347.1|3553699_3554092_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_130625389.1|3555877_3556768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419068.1|3557235_3558204_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_082324099.1|3558448_3559825_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_107490060.1|3560827_3561930_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	1.1e-42
WP_101807338.1|3562790_3563793_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	4.2e-97
WP_024744854.1|3566877_3567078_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_024744855.1|3567440_3568235_+	thiazole synthase	NA	NA	NA	NA	NA
WP_014504352.1|3568536_3569295_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_014504353.1|3569370_3571233_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_024744856.1|3571290_3571632_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_014504356.1|3571890_3572166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807223.1|3572339_3573138_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	3818288	3884976	4698819	protease,tRNA,transposase	Staphylococcus_phage(14.29%)	46	NA	NA
WP_058419057.1|3818288_3819257_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
WP_024744620.1|3819458_3819881_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	62.2	1.0e-41
WP_024744619.1|3820491_3820881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744618.1|3820873_3822526_+|protease	serine protease	protease	NA	NA	NA	NA
WP_101807233.1|3822977_3823784_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	37.1	9.1e-10
WP_024745219.1|3823836_3825015_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	33.3	6.9e-51
WP_050588023.1|3825401_3826331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324136.1|3826495_3827896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745216.1|3827843_3829751_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_101807234.1|3829763_3830786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745214.1|3830915_3831755_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_024745213.1|3832365_3833523_+	phosphotransferase	NA	NA	NA	NA	NA
WP_053513843.1|3833558_3835721_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_053513841.1|3836095_3836671_+	nicotinamide mononucleotide transporter	NA	NA	NA	NA	NA
WP_024745210.1|3836776_3837505_+	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_024745209.1|3837935_3838775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745208.1|3838771_3841075_-	type II secretion system secretin GspD	NA	A7BJX1	Enterobacteria_phage	24.4	1.5e-09
WP_101807235.1|3841071_3841902_-	general secretion pathway protein GspN	NA	NA	NA	NA	NA
WP_024745206.1|3841891_3842545_-	general secretion pathway protein GspM	NA	NA	NA	NA	NA
WP_024745205.1|3842528_3843650_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011407644.1|3843646_3844498_-	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_024745204.1|3844494_3845130_-	type II secretion system protein J	NA	NA	NA	NA	NA
WP_024745203.1|3845126_3845543_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_024745202.1|3845539_3846049_-	type II secretion system protein GspH	NA	NA	NA	NA	NA
WP_011407642.1|3846058_3846490_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_011257722.1|3846757_3847975_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_082324135.1|3847974_3848154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324134.1|3848150_3849890_-	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_024745200.1|3850007_3851891_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.7	7.0e-21
WP_053513836.1|3852111_3858192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745197.1|3859169_3863222_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	56.9	5.8e-121
WP_024745196.1|3863637_3864435_-	DsbC family protein	NA	NA	NA	NA	NA
WP_024745195.1|3864918_3865890_-	site-specific tyrosine recombinase XerD	NA	A0A0K0N6I5	Gordonia_phage	30.3	1.9e-14
WP_024745194.1|3866315_3866783_+	RDD family protein	NA	NA	NA	NA	NA
WP_082324133.1|3866880_3867192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745193.1|3867196_3868303_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_053513834.1|3868299_3869382_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_024745191.1|3869489_3870962_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.5	9.0e-48
WP_024745189.1|3871317_3871743_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_082324132.1|3871753_3872986_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_082324131.1|3872988_3873636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745188.1|3873764_3876707_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	34.2	2.2e-130
WP_053513831.1|3877429_3879403_+	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	36.7	1.3e-14
WP_101807236.1|3879859_3881236_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	9.2e-63
WP_082324130.1|3881589_3882606_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
WP_082324130.1|3883959_3884976_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
>prophage 20
NZ_CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	3904776	3911146	4698819		Enterobacteria_phage(50.0%)	6	NA	NA
WP_011407616.1|3904776_3906123_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
WP_024743259.1|3906168_3907572_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	28.8	1.6e-41
WP_024743260.1|3907688_3908597_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	33.8	5.4e-27
WP_024743261.1|3908593_3909151_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.1	1.7e-44
WP_011407613.1|3909147_3910035_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
WP_011407612.1|3910090_3911146_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
>prophage 21
NZ_CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	4255049	4331829	4698819	transposase	Acidithiobacillus_phage(21.43%)	56	NA	NA
WP_058419036.1|4255049_4256018_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_050588016.1|4256461_4256932_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_024744929.1|4257616_4259749_-	ATP-dependent DNA helicase DinG	NA	NA	NA	NA	NA
WP_082324401.1|4260235_4260598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744927.1|4260599_4261451_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_024744926.1|4261503_4262385_+	TolB-like protein	NA	NA	NA	NA	NA
WP_024744925.1|4263050_4265612_-	iron-uptake factor	NA	NA	NA	NA	NA
WP_101807267.1|4265844_4266597_+	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	33.3	2.8e-21
WP_053513030.1|4266724_4267639_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024744922.1|4267731_4268709_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_014505063.1|4268896_4269889_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_033003934.1|4270109_4270358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744920.1|4270563_4271034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744919.1|4271134_4272925_-	DUF885 domain-containing protein	NA	NA	NA	NA	NA
WP_024744918.1|4273129_4275367_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_101807344.1|4276960_4277977_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	3.3e-49
WP_082324203.1|4278147_4279524_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
WP_024743126.1|4281942_4282953_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_024743127.1|4283353_4284547_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024712051.1|4284543_4285290_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	5.2e-20
WP_024743128.1|4285321_4286923_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011257320.1|4286983_4287184_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024743129.1|4287180_4287768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743130.1|4288216_4288489_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_024743131.1|4288554_4289544_+	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_082324107.1|4289613_4290375_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_024743133.1|4290477_4291473_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.2	8.5e-26
WP_033003179.1|4291490_4292282_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_024743135.1|4292283_4292868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033003181.1|4292986_4293925_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_101807269.1|4294038_4294242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807049.1|4294281_4295383_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	5.0e-43
WP_058419060.1|4295811_4297188_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_024744975.1|4297768_4298317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053512924.1|4298804_4299089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744977.1|4299673_4300951_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_011257407.1|4301230_4301557_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_024744978.1|4301528_4302023_-	flavodoxin	NA	A0A068CFW0	Listeria_phage	36.1	2.7e-17
WP_024744979.1|4302030_4303356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712257.1|4303430_4304474_-	ribonucleotide-diphosphate reductase subunit beta	NA	A8ASV9	Listeria_phage	75.1	1.1e-151
WP_101807270.1|4304671_4307170_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A088FNW1	Listeria_phage	66.9	4.1e-303
WP_024744981.1|4307785_4308829_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	51.8	4.8e-80
WP_024744982.1|4308935_4311644_-	bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024744983.1|4311930_4312545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257400.1|4312616_4313984_-	magnesium transporter	NA	NA	NA	NA	NA
WP_024744985.1|4314673_4316497_+	potassium transporter KefB	NA	NA	NA	NA	NA
WP_082330734.1|4318040_4319984_-	glucose-6-phosphate dehydrogenase	NA	E3SJC5	Synechococcus_phage	37.3	2.6e-79
WP_024743306.1|4319833_4321633_-	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_082324102.1|4321696_4322026_-	phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_024743307.1|4322052_4325373_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_011407425.1|4325365_4325626_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_024743308.1|4325844_4327044_+	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_024743309.1|4327043_4327817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743310.1|4327813_4328635_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_024743311.1|4328631_4330254_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_101807272.1|4330452_4331829_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	2.2e-64
>prophage 22
NZ_CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	4401323	4571281	4698819	tRNA,transposase	Acidithiobacillus_phage(16.13%)	106	NA	NA
WP_101807275.1|4401323_4402292_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
WP_082324392.1|4402417_4402783_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_024743782.1|4402779_4404081_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_024743781.1|4404261_4405038_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024743780.1|4405514_4406099_+	manganese efflux pump MntP family protein	NA	NA	NA	NA	NA
WP_024743779.1|4406291_4409741_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_024743778.1|4410492_4413135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743777.1|4413238_4415638_-	NdvB protein	NA	NA	NA	NA	NA
WP_024743776.1|4415640_4417023_-	MFS transporter	NA	NA	NA	NA	NA
WP_024743775.1|4417180_4417765_+	gluconokinase	NA	NA	NA	NA	NA
WP_024743774.1|4418600_4420331_+	PQQ-binding-like beta-propeller repeat protein	NA	A0A0M4JT37	Mollivirus	36.1	1.7e-82
WP_082324100.1|4420662_4420968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324389.1|4420870_4421311_-	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_024743773.1|4421330_4421759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107490046.1|4423305_4424407_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.9e-43
WP_101807277.1|4424426_4425395_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
WP_058419036.1|4426825_4427794_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_053513161.1|4428057_4431915_-	translocation/assembly module TamB	NA	NA	NA	NA	NA
WP_024743466.1|4431911_4433693_-	outer membrane protein assembly factor	NA	NA	NA	NA	NA
WP_033003342.1|4433867_4436627_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.8	9.3e-147
WP_024743464.1|4436879_4438469_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_024743463.1|4438468_4440727_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_024743462.1|4440884_4441793_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_024743461.1|4441882_4443697_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_158525116.1|4444090_4452550_-	hypothetical protein	NA	A0A1S5SDF1	Streptococcus_phage	32.0	1.3e-10
WP_011409712.1|4453502_4454255_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_024745621.1|4454314_4455214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745620.1|4455366_4456122_-	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_024745619.1|4456118_4456691_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_003484969.1|4456706_4456934_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_024745618.1|4457006_4457912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745617.1|4458065_4459031_+	ferrochelatase	NA	NA	NA	NA	NA
WP_024745616.1|4459033_4459885_+	alpha/beta hydrolase	NA	R4JP33	Mycobacterium_phage	31.3	1.3e-06
WP_024745615.1|4459965_4460424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745614.1|4460694_4461480_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_024745613.1|4462095_4463001_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	33.2	1.4e-43
WP_024745612.1|4463064_4463982_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	3.1e-83
WP_053513079.1|4464615_4465953_+	xylose isomerase	NA	NA	NA	NA	NA
WP_024744967.1|4466178_4467246_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_101807280.1|4467400_4469596_+	alpha-glucuronidase	NA	NA	NA	NA	NA
WP_101807281.1|4469592_4471557_+	9-O-acetylesterase	NA	NA	NA	NA	NA
WP_101807282.1|4471568_4472828_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
WP_101807349.1|4472827_4474528_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_101807283.1|4474530_4477245_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_101807284.1|4477467_4478988_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	31.4	2.5e-45
WP_107490031.1|4478982_4480014_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.3e-74
WP_082324355.1|4480196_4481573_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_033003464.1|4481749_4482853_+	restriction endonuclease or methylase	NA	A0A1S5SAB0	Streptococcus_phage	40.4	9.4e-58
WP_024743784.1|4482944_4483319_-	VOC family protein	NA	NA	NA	NA	NA
WP_082324356.1|4484019_4485036_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.9e-49
WP_024743734.1|4485658_4486714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743735.1|4486940_4488359_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_024743736.1|4488399_4489377_-	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_082324358.1|4490781_4492263_-	MFS transporter	NA	NA	NA	NA	NA
WP_082324566.1|4492604_4495478_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024743740.1|4495576_4497064_+	MFS transporter	NA	NA	NA	NA	NA
WP_024743741.1|4497095_4498130_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_024743742.1|4498471_4499005_+	lipocalin family protein	NA	NA	NA	NA	NA
WP_101807285.1|4499286_4500255_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	6.6e-100
WP_154221296.1|4500306_4500645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807286.1|4500721_4501527_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.0	7.7e-09
WP_024743989.1|4501728_4502301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011349116.1|4502439_4502658_+	YdcH family protein	NA	NA	NA	NA	NA
WP_024743991.1|4503294_4504275_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_024743992.1|4504470_4507134_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_024743993.1|4507133_4508108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324359.1|4508106_4508352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743994.1|4508520_4509573_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_053513382.1|4509737_4512776_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_058419058.1|4513614_4514991_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	3.2e-63
WP_024743574.1|4517739_4519269_+	tryptophan 7-halogenase	NA	M4T1E3	Cyanophage	28.5	3.9e-46
WP_024743573.1|4519575_4520355_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_024743572.1|4520351_4521362_-	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_101807288.1|4521641_4522307_+	YceH family protein	NA	NA	NA	NA	NA
WP_101807290.1|4523705_4525682_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.2	6.3e-113
WP_024743567.1|4525888_4526518_+	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	1.1e-52
WP_024743566.1|4526976_4528215_+	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_024743565.1|4528357_4529956_-	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_082324360.1|4530024_4531116_-	DUF4380 domain-containing protein	NA	NA	NA	NA	NA
WP_033003378.1|4531348_4532164_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.0	1.1e-18
WP_058419055.1|4532452_4533829_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_024744511.1|4540307_4542212_-	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.0e-19
WP_024744510.1|4542208_4542811_-	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_024744509.1|4542911_4544171_-	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_024744508.1|4544461_4546624_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_024744507.1|4546776_4546983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807291.1|4547190_4547580_-	YchJ family protein	NA	NA	NA	NA	NA
WP_082330766.1|4547637_4548459_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_101807292.1|4548583_4549960_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.3	4.3e-60
WP_053513660.1|4550091_4551273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053513661.1|4551370_4554802_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_024745665.1|4554949_4555648_-	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_024745666.1|4555631_4557104_-	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
WP_024745667.1|4557100_4557688_-	DUF4276 family protein	NA	NA	NA	NA	NA
WP_024745668.1|4557687_4558884_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_082324363.1|4558957_4559587_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	49.5	4.2e-47
WP_050588040.1|4559680_4560178_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053513662.1|4561591_4562116_+	FUSC family protein	NA	NA	NA	NA	NA
WP_101807293.1|4562087_4563104_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
WP_024744628.1|4563510_4564872_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.1	5.8e-33
WP_101807219.1|4565052_4566429_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
WP_082324568.1|4567117_4567831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745343.1|4567861_4568368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745344.1|4568641_4568848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745345.1|4568834_4569947_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_107490090.1|4570179_4571281_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	3.2e-42
>prophage 23
NZ_CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	4580007	4637885	4698819	transposase	Acidithiobacillus_phage(30.77%)	44	NA	NA
WP_058419060.1|4580007_4581384_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_024742954.1|4581908_4582220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024742953.1|4582479_4582962_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_024742952.1|4583258_4584428_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_024742951.1|4584669_4584858_+	CsbD family protein	NA	NA	NA	NA	NA
WP_074038671.1|4585502_4585760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024742950.1|4585884_4586334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024742949.1|4586490_4587471_+	ATP-binding cassette domain-containing protein	NA	K7PHD1	Enterobacteria_phage	46.4	7.0e-73
WP_082324366.1|4588390_4588747_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024743547.1|4588789_4591570_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024743548.1|4591856_4592879_+	sugar kinase	NA	NA	NA	NA	NA
WP_154221263.1|4593335_4593476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743549.1|4593499_4594708_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_024743552.1|4596679_4597846_+	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_154221305.1|4599134_4599503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419197.1|4599797_4601174_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.0e-77
WP_082324367.1|4601184_4601478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324368.1|4601588_4603784_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.6	2.4e-65
WP_024712580.1|4603882_4605085_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_024743645.1|4605355_4606366_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	7.3e-49
WP_024743646.1|4606640_4607108_+	DUF4410 domain-containing protein	NA	NA	NA	NA	NA
WP_082324173.1|4608484_4609861_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
WP_158500224.1|4609976_4610294_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_101807296.1|4610406_4611375_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
WP_130625425.1|4611799_4612030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130625426.1|4612193_4614839_+	protein kinase/lanthionine synthetase C family protein	NA	NA	NA	NA	NA
WP_131085815.1|4614879_4615626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807297.1|4615647_4616943_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_050587973.1|4616962_4619089_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.3	7.9e-29
WP_101807298.1|4619345_4620593_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.6	2.1e-61
WP_082324571.1|4621885_4622296_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_033003354.1|4622555_4623011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130625428.1|4622943_4623204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807299.1|4623234_4624122_-	pseudouridylate synthase	NA	NA	NA	NA	NA
WP_033003355.1|4624455_4626033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743499.1|4626527_4627355_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_058419165.1|4628081_4629140_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.6e-73
WP_107490046.1|4630883_4631985_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.9e-43
WP_101807300.1|4632222_4632783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807296.1|4632781_4633750_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
WP_130625431.1|4633844_4634147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745548.1|4634218_4634956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033004251.1|4634973_4635666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807103.1|4636859_4637885_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.9e-49
