The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025541	Klebsiella sp. 2N3 chromosome, complete genome	5333433	10581	60084	5333433	integrase,terminase,tail,holin	Klebsiella_phage(22.64%)	63	26273:26287	58870:58884
WP_050583641.1|10581_13188_-	SGNH/GDSL hydrolase family protein	NA	A0A286S1P0	Klebsiella_phage	76.2	7.9e-47
WP_023327995.1|13265_16334_-	hypothetical protein	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
WP_004152651.1|16330_16711_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_023327996.1|16720_17203_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	95.0	3.1e-82
WP_023327997.1|17383_17848_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.1	1.5e-57
WP_023327998.1|18162_18498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101816707.1|18581_21479_-|tail	phage tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.8	3.2e-105
WP_077264578.1|21552_22035_-	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	43.6	4.9e-19
WP_004217333.1|22031_22388_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_004217335.1|22464_22641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023328000.1|22808_23291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101816708.1|23345_24518_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	9.4e-24
WP_004190640.1|24541_24934_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_023286295.1|24930_25482_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	1.0e-28
WP_064146239.1|25483_25867_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	1.2e-20
WP_016946677.1|25853_26087_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
WP_004190649.1|26096_26351_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	8.0e-21
26273:26287	attL	TCAGCAGGCGAATAA	NA	NA	NA	NA
WP_023300922.1|26352_26748_-	hypothetical protein	NA	A0A0S2SYB7	Pseudomonas_phage	43.3	3.3e-13
WP_004190653.1|27069_28023_-	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_004190654.1|28033_28819_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.4	1.7e-66
WP_023328003.1|28903_30016_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.9	1.6e-110
WP_022631477.1|29999_31400_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	9.2e-127
WP_004190663.1|31399_32707_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
WP_004218556.1|32684_33689_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
WP_004244013.1|34237_34423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218558.1|34551_34797_-	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_019405025.1|35610_35805_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.1	1.4e-25
WP_004190672.1|35755_36031_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_004190674.1|36027_36372_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_008807831.1|36368_36908_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	99.4	1.5e-101
WP_047694604.1|36904_37216_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	99.0	8.5e-49
WP_072032791.1|37816_38263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047694602.1|38168_38426_-	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	97.6	2.4e-41
WP_023287514.1|38760_39582_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	67.5	1.1e-98
WP_020804605.1|39697_40054_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	63.2	3.3e-41
WP_020804598.1|40050_40347_-	DUF1364 domain-containing protein	NA	E5AGG0	Erwinia_phage	74.5	1.7e-35
WP_072122536.1|40349_40556_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	69.7	1.2e-22
WP_101816710.1|40555_41155_-	hypothetical protein	NA	K7PKS6	Enterobacteria_phage	77.9	9.5e-89
WP_032735916.1|41565_41799_-	XRE family transcriptional regulator	NA	K7PM44	Enterobacteria_phage	70.1	2.9e-25
WP_048270046.1|42059_42380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040198779.1|42497_44357_-	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	57.8	1.6e-211
WP_040198816.1|44353_44611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040198781.1|44619_44871_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	52.8	2.8e-10
WP_101816711.1|44867_45068_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	76.9	3.7e-21
WP_040198784.1|45064_45433_-	DUF977 domain-containing protein	NA	H6WRX9	Salmonella_phage	39.0	2.9e-11
WP_048270039.1|45440_46190_-	DNA replication protein DnaC	NA	H6WRX8	Salmonella_phage	81.5	9.3e-118
WP_048270174.1|46192_47032_-	hypothetical protein	NA	Q8HA96	Salmonella_phage	53.1	8.8e-24
WP_048270038.1|47097_47892_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	51.7	9.7e-65
WP_048270037.1|48020_48557_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	71.2	5.2e-62
WP_023320775.1|48559_48787_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	50.0	3.4e-15
WP_050485525.1|48891_49326_+	transcriptional regulator	NA	H6WRX4	Salmonella_phage	39.0	2.3e-15
WP_101816713.1|49714_49906_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
WP_023282477.1|49914_50070_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	71.2	2.0e-14
WP_101816715.1|50207_53468_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	53.9	1.7e-277
WP_101816717.1|53480_54569_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	56.0	8.2e-107
WP_101816718.1|54603_55254_+	morphogenetic protein	NA	H2BDG4	Pseudomonas_virus	44.4	2.5e-42
WP_012542038.1|55250_55559_+	hypothetical protein	NA	I6PD68	Cronobacter_phage	56.9	4.2e-24
WP_004892750.1|55566_55806_+	DUF4060 domain-containing protein	NA	M9P0E0	Enterobacteria_phage	70.1	8.0e-23
WP_101816720.1|55815_56130_+	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	2.1e-10
WP_101816721.1|56026_57214_-|integrase	integrase	integrase	K7PGY1	Enterobacteria_phage	51.9	5.4e-120
WP_004151901.1|57390_58281_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_004140266.1|58280_59273_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
58870:58884	attR	TTATTCGCCTGCTGA	NA	NA	NA	NA
WP_004140269.1|59274_60084_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 2
NZ_CP025541	Klebsiella sp. 2N3 chromosome, complete genome	5333433	451769	461233	5333433	protease,tRNA	Brazilian_cedratvirus(16.67%)	9	NA	NA
WP_004224003.1|451769_453491_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|453535_454237_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|454590_454809_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|454929_457209_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|457239_457557_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|457882_458104_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_071528213.1|458058_458241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023286192.1|458180_460121_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|460117_461233_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 3
NZ_CP025541	Klebsiella sp. 2N3 chromosome, complete genome	5333433	918163	990803	5333433	tail,holin,lysis,terminase,head,tRNA,integrase	Cronobacter_phage(23.64%)	89	939905:939951	987874:987920
WP_002892491.1|918163_919681_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	9.5e-85
WP_023339104.1|920012_921488_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.7	2.0e-47
WP_002892486.1|921547_923695_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_023286110.1|923777_925112_-	cadaverine:lysine antiporter	NA	NA	NA	NA	NA
WP_004147422.1|925477_927046_-	transcriptional regulator CadC	NA	NA	NA	NA	NA
WP_004147421.1|927125_927380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002892402.1|927339_927612_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_002892400.1|927712_928633_-	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	40.1	5.4e-51
WP_023286109.1|929143_930010_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016946536.1|930032_931058_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_023328194.1|931059_933495_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_101816770.1|933505_934201_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_009485574.1|934259_934820_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_004191501.1|935931_936237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023286107.1|936289_937594_-	citrate synthase	NA	NA	NA	NA	NA
WP_002892370.1|938104_938275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002892366.1|938353_938755_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_002892360.1|939150_939444_-	hypothetical protein	NA	NA	NA	NA	NA
939905:939951	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_075647611.1|940106_940445_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.5	9.6e-22
WP_101816772.1|942174_942879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101816774.1|943045_945523_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	45.4	1.2e-198
WP_064164250.1|945509_945905_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.8	2.8e-36
WP_064164251.1|945901_946372_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	37.9	2.6e-25
WP_101817157.1|946371_946791_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	47.8	2.4e-30
WP_072001734.1|946961_947228_+	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_016531188.1|947204_947384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101816776.1|947424_949998_-|tail	tail protein (tape measure)	tail	F1C5E9	Cronobacter_phage	36.3	1.3e-94
WP_048337553.1|950089_950560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077255485.1|950615_950867_-	hypothetical protein	NA	H6WRV3	Salmonella_phage	62.7	2.8e-26
WP_053065655.1|951031_951610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048287255.1|951921_952677_-	DNA-binding protein	NA	K7PH30	Enterobacteria_phage	50.2	2.1e-61
WP_075647506.1|952895_953609_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	54.6	1.1e-62
WP_049185987.1|953677_954442_-	DNA breaking-rejoining protein	NA	G0ZNE6	Cronobacter_phage	44.0	1.2e-40
WP_023341847.1|954501_954723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075647505.1|954725_955109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023342738.1|955105_955474_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	83.6	1.0e-48
WP_032430935.1|955476_955839_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	48.3	1.3e-19
WP_004223297.1|955835_956219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004223294.1|956222_956393_-	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	50.0	3.4e-12
WP_012967729.1|956392_956773_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	56.1	1.4e-29
WP_101816778.1|956775_957069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178847.1|957078_958176_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	73.6	4.2e-151
WP_004178846.1|958187_958619_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.1	1.4e-41
WP_101816781.1|958622_960008_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	64.2	1.5e-166
WP_101816783.1|960785_961790_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.0	2.9e-114
WP_101816785.1|961716_963186_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.3	1.5e-148
WP_101816787.1|963198_964671_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.7	1.5e-249
WP_101816789.1|964670_965273_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	75.6	3.5e-75
WP_004178838.1|965643_965973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101816791.1|966078_966543_-|lysis	lysis protein	lysis	Q9AZ06	Salmonella_phage	75.2	2.4e-55
WP_023304960.1|966539_967019_-	lysozyme	NA	A5VW81	Enterobacteria_phage	83.0	1.9e-71
WP_032456970.1|967002_967326_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	80.4	2.7e-42
WP_101817158.1|968346_969114_-	hypothetical protein	NA	A0A1B2I9V6	Erwinia_phage	75.5	3.4e-107
WP_023304882.1|969940_970441_-	hypothetical protein	NA	G8C7V7	Escherichia_phage	90.9	9.7e-87
WP_064164269.1|970574_971210_-	NinG family protein	NA	M9NYX8	Enterobacteria_phage	77.0	1.6e-81
WP_064164270.1|971202_971871_-	protein-serine/threonine phosphatase	NA	M9P0E4	Enterobacteria_phage	77.9	1.2e-103
WP_024264476.1|971867_972035_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	62.5	7.8e-09
WP_004223230.1|972040_972637_-	DUF1367 domain-containing protein	NA	A0A0U2RT94	Escherichia_phage	54.3	2.1e-56
WP_043906731.1|972732_972990_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	76.6	6.4e-26
WP_032428632.1|972989_973277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101816793.1|973955_974600_-	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	78.4	1.5e-108
WP_023158884.1|974596_974857_-	DUF4752 domain-containing protein	NA	T1S9K2	Salmonella_phage	75.0	7.4e-30
WP_101816795.1|974853_975351_-	hypothetical protein	NA	A0A193GYX5	Enterobacter_phage	74.4	3.5e-12
WP_101816797.1|975347_975650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101816798.1|975646_976384_-	Replication protein P	NA	A0A0K2FIT1	Enterobacteria_phage	54.8	2.4e-65
WP_101817160.1|976380_977346_-	replication protein	NA	K7PGZ0	Enterobacteria_phage	76.7	8.5e-63
WP_020804197.1|977405_978203_-	chromosome partitioning protein ParB	NA	A0A2H4J902	uncultured_Caudovirales_phage	72.8	6.1e-91
WP_001548453.1|978288_978510_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004178811.1|978550_978784_-	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	70.4	3.0e-22
WP_071789738.1|978888_979578_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	70.6	1.0e-86
WP_101817162.1|979600_979720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101816800.1|979926_980718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001548448.1|980757_980961_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	74.6	5.4e-20
WP_008807814.1|981388_981595_+	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_101816803.1|981653_982166_+	hypothetical protein	NA	A0A1W6DY33	Salmonella_phage	45.3	2.2e-33
WP_087802254.1|982173_982371_+	thioredoxin reductase	NA	NA	NA	NA	NA
WP_101816805.1|982522_983176_+	single-stranded DNA-binding protein	NA	A0A1W6JP21	Morganella_phage	61.8	4.4e-63
WP_087775319.1|983159_983450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068987121.1|983446_983752_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_101816807.1|983748_984405_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.0	3.5e-113
WP_086549568.1|984401_985172_+	dcm methylase	NA	D5LH17	Escherichia_phage	52.6	1.6e-64
WP_101816809.1|985387_986080_+	hypothetical protein	NA	M1F3E2	Salmonella_phage	55.0	4.8e-60
WP_101816811.1|986076_986268_+	hypothetical protein	NA	G9L698	Escherichia_phage	64.4	7.8e-13
WP_101816813.1|986264_986483_+	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	56.5	3.6e-14
WP_101816814.1|986696_987860_+|integrase	integrase	integrase	G8C7S0	Escherichia_phage	86.8	8.6e-203
WP_071787017.1|987929_988253_-	hypothetical protein	NA	NA	NA	NA	NA
987874:987920	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004143017.1|988291_989158_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004143016.1|989159_989372_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_004143010.1|989417_990803_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 4
NZ_CP025541	Klebsiella sp. 2N3 chromosome, complete genome	5333433	3006641	3056014	5333433	tail,plate,portal,head,tRNA,integrase,capsid	Salmonella_phage(80.95%)	63	2998842:2998857	3019810:3019825
2998842:2998857	attL	TGGCCAGACTGCTCAT	NA	NA	NA	NA
WP_101816928.1|3006641_3007661_-|integrase	integrase	integrase	F1BUS9	Erwinia_phage	60.8	4.4e-118
WP_101816930.1|3007664_3008291_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	38.4	5.2e-37
WP_101816931.1|3008390_3008627_+	regulator	NA	NA	NA	NA	NA
WP_101816933.1|3008661_3009171_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	83.4	6.0e-76
WP_004174277.1|3009178_3009379_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	87.7	1.5e-27
WP_101816934.1|3009342_3009684_+	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	85.8	4.2e-49
WP_019704181.1|3009751_3009985_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	90.9	7.8e-31
WP_101816936.1|3009984_3010212_+	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	85.3	1.2e-31
WP_101816937.1|3010208_3011096_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	75.9	6.9e-120
WP_101816939.1|3011076_3013485_+	endonuclease	NA	A0A1S6L028	Salmonella_phage	88.6	0.0e+00
WP_004144689.1|3013668_3013857_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	7.9e-26
WP_049182327.1|3013870_3014104_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	84.4	7.8e-31
WP_101816940.1|3014179_3014437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101816942.1|3014788_3015811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101816944.1|3015849_3016875_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	90.3	3.3e-174
WP_101816946.1|3016874_3018638_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	93.0	0.0e+00
WP_101816948.1|3018778_3019612_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	75.8	5.2e-101
WP_101816950.1|3019628_3020693_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	94.0	2.8e-184
3019810:3019825	attR	ATGAGCAGTCTGGCCA	NA	NA	NA	NA
WP_101816952.1|3020696_3021347_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	85.6	3.1e-101
WP_101816954.1|3021443_3021908_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	86.4	3.5e-75
WP_004144701.1|3021907_3022111_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	88.1	1.7e-29
WP_004144702.1|3022114_3022330_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	1.0e-29
WP_101816956.1|3022310_3022820_+	glycoside hydrolase	NA	E5G6N1	Salmonella_phage	84.0	7.3e-82
WP_101816958.1|3022824_3023208_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.9	8.1e-17
WP_101816960.1|3023204_3023633_+	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	79.4	2.8e-50
WP_101816962.1|3023574_3023766_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	71.4	3.9e-20
WP_101816965.1|3023728_3024151_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	80.4	5.9e-61
WP_101816967.1|3024143_3024590_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.6	6.9e-52
WP_101816969.1|3024656_3026411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101816971.1|3026493_3027066_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	71.2	6.7e-76
WP_101816973.1|3027062_3027425_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	6.4e-48
WP_101816975.1|3027411_3028320_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	67.2	1.2e-106
WP_101816977.1|3028312_3028915_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	62.2	1.6e-59
WP_048336694.1|3030509_3030827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101816979.1|3030882_3031965_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	40.7	6.4e-27
WP_047666934.1|3032103_3033276_+|tail	tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.5e-210
WP_101816980.1|3033285_3033801_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	86.0	4.3e-82
WP_059065556.1|3033853_3034153_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	4.8e-33
WP_002896220.1|3034167_3034287_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_101816982.1|3034279_3036907_+|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	38.6	3.9e-118
WP_101816983.1|3036903_3037389_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	79.5	2.3e-61
WP_101816985.1|3037385_3038483_+	late control protein D	NA	E5G6Q3	Salmonella_phage	84.4	3.9e-173
WP_004174338.1|3038553_3038772_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004144517.1|3038784_3039162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002917636.1|3039489_3039996_+	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
WP_004174339.1|3040095_3041937_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_004149864.1|3042155_3043901_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
WP_001144069.1|3044012_3044228_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_071526681.1|3044226_3044457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004900709.1|3044465_3045479_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	1.4e-108
WP_004181356.1|3045523_3047131_-	allantoin permease	NA	NA	NA	NA	NA
WP_002916877.1|3047284_3047902_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_016532672.1|3047910_3048585_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_002916875.1|3048586_3049063_-	urease accessory protein	NA	NA	NA	NA	NA
WP_023286881.1|3049072_3050776_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_002916872.1|3050768_3051089_-	urease subunit beta	NA	NA	NA	NA	NA
WP_002916871.1|3051098_3051401_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_002916869.1|3051410_3052235_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_004144529.1|3052224_3052371_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
WP_004144530.1|3052632_3053250_-	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_004150923.1|3053357_3053741_+	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_004144532.1|3053939_3054761_+	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
WP_002916864.1|3054772_3056014_-|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	50.1	5.2e-89
>prophage 5
NZ_CP025541	Klebsiella sp. 2N3 chromosome, complete genome	5333433	3538539	3547962	5333433		Enterobacteria_phage(85.71%)	11	NA	NA
WP_101817018.1|3538539_3540873_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.5	0.0e+00
WP_101817020.1|3540886_3541207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004185275.1|3541203_3541431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101817021.1|3541427_3541979_-	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	69.3	3.4e-32
WP_032426459.1|3541975_3542242_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_101817023.1|3542780_3543518_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	60.2	6.4e-71
WP_004185270.1|3543514_3543760_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_101817025.1|3543777_3544344_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.2	2.8e-58
WP_048290705.1|3544947_3545340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048290703.1|3545327_3546506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048290701.1|3546603_3547962_-	SIR2 family protein	NA	Q38324	Lactococcus_phage	28.6	2.3e-21
>prophage 6
NZ_CP025541	Klebsiella sp. 2N3 chromosome, complete genome	5333433	3999236	4006141	5333433		Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|3999236_4000100_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_019705220.1|4000110_4000884_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_002912636.1|4001124_4002018_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_101817038.1|4002263_4003625_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|4003943_4004666_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|4004662_4006141_-	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 7
NZ_CP025541	Klebsiella sp. 2N3 chromosome, complete genome	5333433	4047103	4055887	5333433		Klebsiella_phage(16.67%)	6	NA	NA
WP_101817041.1|4047103_4048732_+	hypothetical protein	NA	K9L8K6	Klebsiella_phage	43.9	7.2e-115
WP_014907233.1|4048905_4050312_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	3.6e-38
WP_000926396.1|4050548_4051964_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.8	8.9e-53
WP_023286699.1|4051986_4053357_+	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	26.0	1.9e-31
WP_023286698.1|4053520_4054687_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.2	2.7e-111
WP_023286697.1|4054879_4055887_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.5e-30
>prophage 8
NZ_CP025541	Klebsiella sp. 2N3 chromosome, complete genome	5333433	5057285	5068172	5333433		Escherichia_phage(87.5%)	9	NA	NA
WP_023286399.1|5057285_5060393_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_023286398.1|5060447_5061713_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|5061743_5062832_-	hypothetical protein	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004176262.1|5062918_5063179_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_004176269.1|5063476_5064337_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|5064357_5065119_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|5065379_5066282_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004224682.1|5066293_5067559_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
WP_002210516.1|5067551_5068172_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
