The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028568	Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 chromosome, complete genome	5022876	373912	415224	5022876	protease,integrase,transposase	Escherichia_phage(28.57%)	26	370830:370846	390271:390287
370830:370846	attL	GCTGCGCCTCACCGCCA	NA	NA	NA	NA
WP_000019402.1|373912_374893_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	1.6e-186
WP_059169912.1|375360_375621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101618245.1|375696_376824_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	25.7	1.7e-06
WP_107979038.1|377253_377565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019402.1|377672_378653_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	1.6e-186
WP_010676173.1|378994_379501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005895563.1|379497_379917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031285326.1|381401_382349_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.4	1.2e-42
WP_101617718.1|383063_384566_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_101617715.1|384567_385761_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_011707639.1|385921_386500_-	single-stranded DNA-binding protein	NA	R9TR60	Vibrio_phage	58.9	1.2e-53
WP_011707638.1|387023_387683_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_101617713.1|387778_390604_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.3	0.0e+00
390271:390287	attR	TGGCGGTGAGGCGCAGC	NA	NA	NA	NA
WP_011707635.1|392878_393490_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_101617711.1|393700_395680_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.3	4.0e-27
WP_101617709.1|395688_397173_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_101617707.1|397236_398028_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005306036.1|398356_399253_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_011707631.1|399315_400380_-	DUF3103 domain-containing protein	NA	NA	NA	NA	NA
WP_101617705.1|400530_401682_-	benzoate/H(+) symporter BenE family transporter	NA	NA	NA	NA	NA
WP_101617703.1|401680_402373_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_101617701.1|402383_403580_-	NnrS family protein	NA	NA	NA	NA	NA
WP_016352207.1|409538_409856_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_101614248.1|410072_413156_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_101614249.1|413242_413788_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_101614250.1|413880_415224_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 2
NZ_CP028568	Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 chromosome, complete genome	5022876	913329	923265	5022876	tRNA	uncultured_Mediterranean_phage(25.0%)	10	NA	NA
WP_017410638.1|913329_914076_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	54.1	7.2e-70
WP_011704775.1|914080_914698_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.4	4.0e-34
WP_073352336.1|914700_915276_+	DedA family protein	NA	NA	NA	NA	NA
WP_029302383.1|915286_916327_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0A7NU10	Lactobacillus_phage	35.6	8.6e-13
WP_011704778.1|916374_917358_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.1	1.7e-34
WP_024946180.1|917442_918456_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.3	9.1e-108
WP_005309452.1|918635_918851_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_101615631.1|918866_919310_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	48.6	1.7e-26
WP_043125117.1|919398_921186_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.1	4.0e-74
WP_073348937.1|921399_923265_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.6	1.1e-34
>prophage 3
NZ_CP028568	Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 chromosome, complete genome	5022876	1126219	1191423	5022876	integrase,transposase,tRNA	Salmonella_phage(22.22%)	58	1117470:1117487	1196921:1196938
1117470:1117487	attL	GGCGGCCAGGGCATCGGC	NA	NA	NA	NA
WP_031285326.1|1126219_1127167_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.4	1.2e-42
WP_011704943.1|1127554_1129096_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_029301667.1|1129274_1130129_-	Tim44 domain-containing protein	NA	NA	NA	NA	NA
WP_073349087.1|1130309_1130411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011704946.1|1130561_1131956_+	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	71.5	5.0e-181
WP_011704947.1|1132022_1132115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101618020.1|1132292_1133366_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	26.6	2.1e-22
WP_005334896.1|1133560_1133809_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.9	1.5e-19
WP_017408769.1|1133810_1135172_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	76.2	1.1e-164
WP_107979045.1|1135405_1136107_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_019706001.1|1136225_1137173_+|transposase	IS30-like element ISAs2 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	31.4	6.4e-31
WP_101618202.1|1137481_1138204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101618205.1|1138233_1138725_+	adhesin	NA	NA	NA	NA	NA
WP_101618207.1|1138792_1141231_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_148248246.1|1141250_1141631_+	hypothetical protein	NA	Q6QLL3	Human_immunodeficiency_virus	92.9	4.4e-07
WP_000019402.1|1141691_1142672_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	1.6e-186
WP_148248248.1|1142706_1143603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101617926.1|1143627_1144266_-	response regulator	NA	NA	NA	NA	NA
WP_101617928.1|1144386_1147815_+	transporter substrate-binding domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	29.7	5.9e-42
WP_044799339.1|1147776_1148070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101617930.1|1148841_1150089_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_011704959.1|1150142_1151204_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_011704960.1|1151214_1151685_-	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_101617932.1|1151695_1152499_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_019706001.1|1154258_1155206_-|transposase	IS30-like element ISAs2 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	31.4	6.4e-31
WP_016349735.1|1155886_1156459_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_101617608.1|1156471_1158394_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_101617609.1|1158409_1160623_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_101617611.1|1160649_1160976_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011704967.1|1160990_1161359_-	response regulator	NA	W8CYM9	Bacillus_phage	40.5	1.0e-16
WP_101617613.1|1161368_1162583_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.1	4.2e-11
WP_101617615.1|1162886_1163975_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_017782062.1|1164178_1165120_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016349742.1|1165247_1165856_+	LysE family translocator	NA	NA	NA	NA	NA
WP_101617617.1|1165958_1167818_+	U32 family peptidase	NA	Q6DW11	Phage_TP	40.2	2.5e-15
WP_101617619.1|1168584_1169061_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	52.9	8.8e-21
WP_101617620.1|1169057_1170617_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_101617621.1|1170826_1171228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101617623.1|1171297_1172851_-	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_101617624.1|1172878_1173460_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_011704978.1|1173613_1173799_-	DUF3149 domain-containing protein	NA	NA	NA	NA	NA
WP_101617626.1|1173931_1174825_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_101617628.1|1174912_1175245_+	DUF1904 family protein	NA	NA	NA	NA	NA
WP_043159901.1|1175402_1176230_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_049048448.1|1176348_1177794_-	outer membrane porin, OprD family	NA	NA	NA	NA	NA
WP_026383935.1|1177942_1180912_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.6	0.0e+00
WP_003055107.1|1180914_1181475_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.8e-50
WP_010792470.1|1181604_1182594_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_003090697.1|1182590_1182827_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_003090698.1|1182823_1183189_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_003090700.1|1183206_1184892_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.2	1.3e-39
WP_000732290.1|1184963_1185239_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294666.1|1185254_1185605_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000414383.1|1185676_1186111_+	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_101617994.1|1186562_1188500_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_101617992.1|1188617_1189514_-	DMT family transporter	NA	NA	NA	NA	NA
WP_101617990.1|1189608_1189824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101617988.1|1190097_1191423_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	27.3	2.4e-28
1196921:1196938	attR	GGCGGCCAGGGCATCGGC	NA	NA	NA	NA
>prophage 4
NZ_CP028568	Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 chromosome, complete genome	5022876	2454721	2521302	5022876	integrase,transposase,tRNA	Catovirus(11.76%)	57	2487234:2487251	2518999:2519016
WP_101616750.1|2454721_2455666_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_011706066.1|2455875_2456253_+	YbaN family protein	NA	NA	NA	NA	NA
WP_073350350.1|2456282_2456930_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	42.7	6.3e-30
WP_101616752.1|2457112_2459659_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	36.3	1.0e-43
WP_011706069.1|2459782_2460112_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_019706001.1|2460915_2461863_-|transposase	IS30-like element ISAs2 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	31.4	6.4e-31
WP_011706072.1|2464106_2465177_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_017408387.1|2465261_2465684_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_101617337.1|2465909_2469809_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	27.3	2.8e-56
WP_101617335.1|2469875_2470742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011706076.1|2470767_2471136_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_101617333.1|2471329_2474512_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	31.0	9.0e-61
WP_101617332.1|2474508_2475510_+	response regulator	NA	W8CYM9	Bacillus_phage	30.4	1.6e-11
WP_024945381.1|2475499_2476144_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_101617330.1|2476171_2477272_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_049049560.1|2477268_2478306_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_101617328.1|2478688_2479873_-	acyltransferase	NA	NA	NA	NA	NA
WP_101617326.1|2480133_2480778_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_101617324.1|2481262_2482456_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_073350327.1|2482561_2483992_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.4	1.4e-26
WP_005300975.1|2484077_2484350_+	acylphosphatase	NA	NA	NA	NA	NA
WP_073350325.1|2484435_2485071_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_073350323.1|2485289_2487323_-|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
2487234:2487251	attL	GATGTGTTCCAGCATGTG	NA	NA	NA	NA
WP_073350321.1|2487509_2488592_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_011706091.1|2488701_2489346_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.5	1.4e-32
WP_011706092.1|2489409_2489991_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	40.8	1.4e-28
WP_101617322.1|2490024_2490117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073350319.1|2490398_2491868_+	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_000429836.1|2492224_2492659_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|2492730_2493081_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|2493094_2493370_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|2493405_2493828_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|2493879_2495574_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|2495591_2495954_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|2495950_2496187_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000204520.1|2496183_2496891_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000935451.1|2496929_2498645_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000344784.1|2498647_2499508_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000194037.1|2501899_2502655_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.5	3.4e-59
WP_041206683.1|2502669_2504211_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.2	3.2e-128
WP_001163403.1|2505356_2506139_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_000376623.1|2506314_2506815_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001993321.1|2506833_2507013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083557448.1|2507324_2508509_+	saccharopine dehydrogenase family protein	NA	NA	NA	NA	NA
WP_073350311.1|2508596_2509262_-	type B chloramphenicol O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	42.4	1.2e-23
WP_071534640.1|2509684_2509879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073352450.1|2509839_2511312_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_034019298.1|2512497_2513058_-	ETC complex I subunit	NA	NA	NA	NA	NA
WP_073350309.1|2513267_2513621_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001993321.1|2513639_2513819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|2513748_2514588_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|2514581_2514929_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206316.1|2515092_2515884_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000845048.1|2516029_2517043_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|2517245_2517596_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001161490.1|2517771_2518332_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001138014.1|2518335_2521302_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
2518999:2519016	attR	CACATGCTGGAACACATC	NA	NA	NA	NA
>prophage 5
NZ_CP028568	Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 chromosome, complete genome	5022876	2915057	2961107	5022876	transposase,plate,protease,tRNA,bacteriocin	uncultured_Mediterranean_phage(13.33%)	35	NA	NA
WP_017409658.1|2915057_2915816_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_101615138.1|2916000_2917521_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	42.6	1.8e-88
WP_011705745.1|2917542_2918031_-|bacteriocin	bacteriocin production protein	bacteriocin	NA	NA	NA	NA
WP_039214580.1|2918217_2919513_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	49.9	4.0e-92
WP_101615134.1|2919852_2921217_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	42.1	1.1e-79
WP_011705742.1|2921342_2921951_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_024944039.1|2922028_2924551_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.4	4.7e-89
WP_005300047.1|2924752_2925244_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_101615131.1|2925393_2925624_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_101615129.1|2926229_2927180_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	2.4e-62
WP_011705738.1|2927237_2928485_+	response regulator	NA	A0A127AWB9	Bacillus_phage	32.2	6.5e-15
WP_016350454.1|2928595_2929066_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_029303253.1|2929085_2929793_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_011705735.1|2929789_2930506_+	arginyltransferase	NA	NA	NA	NA	NA
WP_005300033.1|2930575_2930794_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_024944043.1|2930863_2933116_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.7	9.2e-169
WP_005300028.1|2933175_2933493_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	49.4	2.4e-14
WP_005300025.1|2933721_2933940_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	63.2	1.2e-17
WP_101615128.1|2934047_2934911_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	31.2	1.8e-27
WP_041206683.1|2935961_2937503_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.2	3.2e-128
WP_000194037.1|2937517_2938273_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.5	3.4e-59
WP_148248278.1|2938811_2939540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101617444.1|2942279_2944325_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.4	5.1e-33
WP_017411057.1|2944335_2944623_-	type VI secretion system PAAR protein	NA	G4KK81	Yersinia_phage	39.4	2.3e-08
WP_101617441.1|2944880_2946311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101617439.1|2946357_2949843_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_101617438.1|2949884_2951330_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_101617436.1|2951338_2951944_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_101617434.1|2951943_2953482_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_101617431.1|2953484_2956127_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	6.3e-92
WP_011705720.1|2956147_2956858_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_101617428.1|2956949_2958284_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_011705718.1|2958286_2958802_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_011705717.1|2958801_2960052_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_011705716.1|2960108_2961107_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 6
NZ_CP028568	Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 chromosome, complete genome	5022876	3969820	3977724	5022876	protease	Staphylococcus_phage(50.0%)	9	NA	NA
WP_081396127.1|3969820_3970405_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.7	3.3e-30
WP_101614011.1|3970488_3971700_+|protease	serine protease	protease	V5LS29	Emiliania_huxleyi_virus	26.9	4.0e-09
WP_016351734.1|3971762_3972872_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.0	7.9e-65
WP_101614009.1|3973013_3973667_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.4	2.7e-20
WP_101614008.1|3973721_3974831_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.2	1.6e-49
WP_010675395.1|3974927_3975377_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_029304291.1|3975499_3975832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101614006.1|3975907_3976387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011707102.1|3976470_3977724_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.5	2.3e-100
>prophage 7
NZ_CP028568	Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 chromosome, complete genome	5022876	4097655	4144043	5022876	transposase,integrase,protease,tRNA	Ralstonia_phage(14.29%)	42	4115410:4115469	4144749:4144816
WP_101616342.1|4097655_4099071_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017410937.1|4099261_4101433_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.5	4.4e-27
WP_011707208.1|4101531_4102200_+	opacity-associated protein OapA	NA	NA	NA	NA	NA
WP_011707209.1|4102472_4102682_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	57.1	1.4e-15
WP_017410935.1|4103869_4104415_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	37.5	5.5e-27
WP_024945878.1|4104461_4105541_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_011707212.1|4105446_4106442_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_029299157.1|4106438_4106690_+	DUF2132 domain-containing protein	NA	NA	NA	NA	NA
WP_011707214.1|4106694_4106946_+	DUF2960 domain-containing protein	NA	NA	NA	NA	NA
WP_101616344.1|4106948_4107347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101616347.1|4107460_4108030_-	YkgB family protein	NA	NA	NA	NA	NA
WP_101616349.1|4108072_4108507_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_101616351.1|4108515_4109433_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_017410927.1|4109493_4109988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101616354.1|4110159_4112133_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	24.7	8.4e-09
WP_101616356.1|4112200_4112707_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_101616358.1|4112970_4115265_+|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
4115410:4115469	attL	CAGAAAGGGTTTAATGCGCGCCGTTGCCCAGATAGCTCAGTCGGTAGAGCAGGGGATTGA	NA	NA	NA	NA
WP_101616360.1|4116115_4117735_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_000019402.1|4118266_4119247_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	1.6e-186
WP_148248300.1|4119315_4120044_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_031285326.1|4120052_4121000_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.4	1.2e-42
WP_123785038.1|4122210_4122759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029304363.1|4122755_4123058_+	DUF1232 domain-containing protein	NA	A0A2I7S9Z5	Vibrio_phage	39.2	2.0e-07
WP_101618074.1|4123080_4123707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101618072.1|4123703_4124138_+	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_101618067.1|4124630_4125872_+|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	30.9	1.5e-27
WP_101618065.1|4125962_4126385_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_101618063.1|4126654_4127428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107979071.1|4127748_4128594_+	WYL domain-containing protein	NA	A0A0R6PH67	Moraxella_phage	30.5	6.1e-33
WP_000194037.1|4128653_4129409_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.5	3.4e-59
WP_041206683.1|4129423_4130965_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.2	3.2e-128
WP_101618267.1|4131386_4132055_+	TM2 domain-containing protein	NA	NA	NA	NA	NA
WP_107979072.1|4132067_4132757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107979073.1|4132917_4134354_+	hypothetical protein	NA	A0A1L7N0M1	Ralstonia_phage	32.3	2.0e-07
WP_148248301.1|4134633_4135173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148248303.1|4135165_4135834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101616365.1|4135889_4136375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101616366.1|4136362_4137988_-	thiamine biosynthesis protein ThiF	NA	NA	NA	NA	NA
WP_101616368.1|4137993_4139142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101616423.1|4139151_4140138_-	patatin-like phospholipase family protein	NA	A0A1B2LRS3	Wolbachia_phage	26.7	6.7e-23
WP_101616372.1|4140685_4142878_-	DUF927 domain-containing protein	NA	NA	NA	NA	NA
WP_101616374.1|4142891_4144043_-|integrase	site-specific integrase	integrase	Q4ZCC1	Staphylococcus_virus	24.4	6.4e-09
4144749:4144816	attR	CAGAAAGGGTTTAATGCGCGCCGTTGCCCAGATAGCTCAGTCGGTAGAGCAGGGGATTGAAAATCCCC	NA	NA	NA	NA
>prophage 1
NZ_CP028565	Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 plasmid pGES5_045096, complete sequence	32665	12172	20129	32665	transposase,integrase	Escherichia_phage(16.67%)	11	NA	NA
WP_001389365.1|12172_12937_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001297012.1|13024_13138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|13443_13944_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001993321.1|13962_14142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|14071_14911_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|14904_15252_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_012658785.1|15473_16337_-	carbapenem-hydrolyzing class A beta-lactamase GES-5	NA	A0A1B0VBP7	Salmonella_phage	39.0	5.6e-42
WP_000845039.1|16516_17530_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_107979018.1|17498_17798_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011222055.1|17802_18390_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	56.9	9.7e-54
WP_101617792.1|18461_20129_+	modification methylase PaeR7I	NA	R4TFP1	Halovirus	24.4	6.2e-21
>prophage 1
NZ_CP028567	Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 plasmid pMCR5_045096, complete sequence	241090	1387	63293	241090	integrase,transposase	Escherichia_phage(21.05%)	56	1374:1433	74371:76148
1374:1433	attL	GGGACGTATCCTCTTTAGTGGAAGCTCTGGGGGCCGCGGATGTTCTCGTGCTCTTGCGGC	NA	NA	NA	NA
WP_041206683.1|1387_2929_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.2	3.2e-128
WP_053821788.1|4476_6120_-	phosphoethanolamine--lipid A transferase MCR-5.1	NA	NA	NA	NA	NA
WP_099108050.1|6138_6681_-	chromate resistance protein ChrB	NA	NA	NA	NA	NA
WP_003055107.1|6920_7481_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.8e-50
WP_026383935.1|7483_10453_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.6	0.0e+00
WP_101618219.1|10488_10893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101618217.1|11012_12179_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	69.9	3.4e-151
WP_101618215.1|12281_13457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101618213.1|13770_14016_+	plasmid replication protein RepB	NA	NA	NA	NA	NA
WP_107979020.1|14120_14348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003089120.1|14358_14757_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003089115.1|14831_15182_+	mercury transporter MerT	NA	NA	NA	NA	NA
WP_003150552.1|15194_15470_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_003089113.1|15477_15690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101618198.1|15702_18696_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	47.4	8.2e-258
WP_003150546.1|18699_19110_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_003089107.1|19109_19349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101618187.1|20041_22927_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.9	1.4e-190
WP_000904906.1|23052_23667_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
WP_001082319.1|23732_24536_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|24535_25372_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_028697649.1|25478_25955_+	TnpR	NA	NA	NA	NA	NA
WP_000557454.1|26029_26890_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000587837.1|26902_27445_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|27926_28118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001330846.1|28123_28369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080860.1|28419_29556_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_100229849.1|31613_33644_+	N-6 DNA methylase	NA	A0A220A2U5	Liberibacter_phage	25.3	8.9e-22
WP_100229850.1|33640_34690_+	DUF1016 domain-containing protein	NA	Q9JMP5	Wolbachia_phage	33.1	4.0e-34
WP_025760282.1|34686_36012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100229851.1|36008_39257_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_076611309.1|39249_40554_+|transposase	ISL3-like element ISSm4 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	31.0	7.2e-57
WP_074148850.1|41028_41250_-	resolvase	NA	NA	NA	NA	NA
WP_000935452.1|41181_42486_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001067855.1|42532_43237_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|43426_44242_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|44392_45097_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001381192.1|45587_46580_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000376623.1|46548_47049_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001993321.1|47067_47247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|47176_48016_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|48009_48357_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206316.1|48520_49312_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_063857839.1|49429_50296_-	PSE family carbenicillin-hydrolyzing class A beta-lactamase CARB-12	NA	A0A077SL40	Escherichia_phage	44.5	1.2e-55
WP_088813959.1|50343_51905_-|transposase	IS3-like element ISAs20 family transposase	transposase	NA	NA	NA	NA
WP_023622803.1|52091_52646_-	aminoglycoside N-acetyltransferase AAC(6')-IIa	NA	NA	NA	NA	NA
WP_000777555.1|52754_53228_-	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	G3MBI7	Bacillus_virus	32.1	3.7e-19
WP_052484405.1|53370_53703_-	quaternary ammonium compound efflux SMR transporter QacK	NA	NA	NA	NA	NA
WP_032495607.1|53950_54607_-	quinolone resistance pentapeptide repeat protein QnrVC6	NA	NA	NA	NA	NA
WP_014454105.1|54883_55438_-	aminoglycoside N-acetyltransferase AAC(6')-Ib'	NA	NA	NA	NA	NA
WP_002075255.1|55617_56631_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_120783633.1|56599_56860_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_039272634.1|56894_57488_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	49.7	1.2e-40
WP_039272567.1|57484_60517_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_101618091.1|61478_62081_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_101618093.1|62189_63293_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2I7R1N2	Vibrio_phage	31.6	1.6e-36
74371:76148	attR	GCCGCAAGAGCACGAGAACATCCGCGGCCCCCAGAGCTTCCACTAAAGAGGATACGTCCCATGACCCAACAAACGCTGACCCGCTTGAGACACCTGAAACTGACTGGCATGGCGGATGCCGTGCAACAACAACTGGAACAGGCAAGTACCTACGAAGGGCTGCCCTTCATCGAGCGGCTAAGCCTGCTGGTCGAACACGAACAACTGAGCCGGGAGCAGCGTAAACAAGCTCGGCTGGTCAAGCAGGCGAGGCTCAAACTCCAGGCCACGGTGCAAGAGGTGGACTACCAGTCTGCACGCAACCTGGAGCGGTCACAGGTGGCAAACCTGGCCCAAGGAGAGTGGCTGCGCCGGGGCCAGAACCTGCTCATTACCGGCCCCTGTGGCTGCGGAAAAACCTACCTAGCCTGTGCGCTGGGCTACCAAGCCTGTCAGCAGGGGCACAGCACTCGTTACTACCGGCTGCCGCGTCTGCTACTTGAGCTGAGCCAGGCCAAGGTAGATGGCAGTTACGCCAGACTGCTGGGTCAACTGGCAAGGATAGAGCTGCTGATCCTGGATGACTGGGGACTGGAAGCGGTGAATGCCGAGCAGCGCAACGCCCTGCTGGAGATCATGGATGATCGGTACGGGAAATACTCGACGGTCGTGGTCAGTCAGCTGCCAACGGAAGAGTGGTACGCGAGCTTGGGGGACAACACTCTGGCAGATGCGATCCTGGACCGGCTGATGCACAACGCTCACCGGCTGTCACTGAAGGGAGAATCGATGAGAAAGAGGAGAAGTGAGTTGACCCAATCTGAACACTCGAGTTAGAAACGGGGTGACGTGAGCGCGTTAAGGATCAGGGTGTTCACGTTGGCCGGAATGGCTGTTCAACTTCGCCGGAATACGCAAGTGGATTGGCTGGACGTATACAACCATTCACTCGCTGAGTTCAAACATCAGGTACGTGAGTGCTTGAAGCTAGACCTCTAATCCTTGGGACTGATTGCTTATTCTGCCCTGGTAGAACAACTTTCAGTCACCCCAAGCCGTAATGTCCCTTCTGGACAATATCAATATTGTTTACCCACCATGAATCCATCTGGATTAATTAATAATTCAAGTCCATCAGGACAAGGAGATTTTTATGAACACTAACAACGCATCTGTAGTAAGCATTAATAACGGAAACGGCCTGCCTGTTTTCAAATCCGAGTCTGCCAGTGTACTGCTCCAGGAATTGGGAATGCCCAATCTGGTCACTCACTGTGTCGATGCTGGGAAATATCAACGCCTTGTGCCTGATGTTCCCAACGGATACCTGGTACCTGTCCGTGAAGCACGCAAGTGCATGTTGTGGGCCTCCTCTCCAACCATGAAGCAAAGTTTGCTTCTTAGAGGGGAGACTGGAACGGGCAAAACTGAGTTCGTAATGTTCTTGGCTGCTCGTTTGAACATTCCGCTCGCAAGAGTTGAGTGTCACGCCAGTATGTTACCGGAAGTTGTTGATGGCGGCGTGAAGTTGATACCCAATCCGCAAGGTGAAGGTGTTATCACCCGTTATGTGTTGAGTGATGTCATGCGCCTCTACCGTGATGGTGGCTGGATCCTGTTGGATGAAGTGGACAAAGTAAGCGACGAATTATCCGCCCGTTTGCACGCTATCACCGATGGAAAACCAGTCACTATTCCCGAGACCGGCGAAGTGATTTACAAGCACCCCAACACCAAAGTATTTGGAACATCAAATACGATTGGCGATGGCACCAGTGTTCGGTATTTGTCCTCCCGTC	NA	NA	NA	NA
>prophage 2
NZ_CP028567	Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 plasmid pMCR5_045096, complete sequence	241090	72874	111966	241090	transposase	Acidithiobacillus_phage(40.0%)	33	NA	NA
WP_041206683.1|72874_74416_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.2	3.2e-128
WP_000194037.1|74430_75186_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.5	3.4e-59
WP_101618142.1|75502_76561_+	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_101618144.1|76811_77774_+	DUF3150 domain-containing protein	NA	NA	NA	NA	NA
WP_101618145.1|77834_79685_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_101618147.1|79941_80994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101618149.1|81109_81595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148248192.1|81672_82011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001809438.1|82112_83144_+|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
WP_021141311.1|83560_84697_+|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
WP_101618123.1|86049_88050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101618122.1|88108_89383_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_101618120.1|89547_91209_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_107979024.1|91171_91651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021141311.1|91928_93065_+|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
WP_107979025.1|93092_94046_+	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_101618247.1|94143_94638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099993964.1|94938_95955_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
WP_101618269.1|96094_96766_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_005342491.1|96859_97810_-|transposase	IS1595-like element ISKpn3 family transposase	transposase	NA	NA	NA	NA
WP_101618231.1|98132_99782_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_101618233.1|99842_100487_-	fructose-6-phosphate aldolase	NA	NA	NA	NA	NA
WP_005342491.1|100798_101749_+|transposase	IS1595-like element ISKpn3 family transposase	transposase	NA	NA	NA	NA
WP_043133530.1|102325_102883_+	PTS glucitol/sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_043133533.1|102903_103884_+	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_081934683.1|103909_104275_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_043133536.1|104361_105138_+	sorbitol-6-phosphate dehydrogenase	NA	W8CYX9	Bacillus_phage	46.3	6.9e-07
WP_043133537.1|105239_105596_+	glucitol operon activator	NA	NA	NA	NA	NA
WP_043133538.1|105696_106461_+	DNA-binding transcriptional repressor	NA	NA	NA	NA	NA
WP_043133539.1|106493_107459_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	33.1	1.6e-37
WP_011191341.1|108577_109852_-|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_004099020.1|110008_110380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011191342.1|110697_111966_+|transposase	IS4-like element ISApu1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP028567	Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 plasmid pMCR5_045096, complete sequence	241090	136851	183850	241090	integrase,transposase	Saccharomonospora_phage(35.71%)	45	136011:136029	151838:151856
136011:136029	attL	TCGATCAGCCAATAACATC	NA	NA	NA	NA
WP_046400746.1|136851_138417_-|transposase	IS21-like element ISAs27 family transposase	transposase	K4I413	Acidithiobacillus_phage	45.8	2.9e-121
WP_101617249.1|138585_139965_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_101617251.1|139974_142572_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_101617253.1|142574_143234_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_101617255.1|143582_144632_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_101617257.1|144674_145682_+	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_101617259.1|146311_148909_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_101617261.1|149616_150375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101617265.1|151204_151492_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_101617266.1|151479_151773_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_021141234.1|151908_153135_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	78.6	7.7e-154
151838:151856	attR	GATGTTATTGGCTGATCGA	NA	NA	NA	NA
WP_010674034.1|153192_153597_+|transposase	IS200/IS605-like element ISAs26 family transposase	transposase	I4AZM1	Saccharomonospora_phage	54.4	1.1e-32
WP_107979027.1|153655_154192_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_148248203.1|155194_156064_-	replication protein RepA	NA	A0A077SLP3	Escherichia_phage	33.0	5.7e-34
WP_101618134.1|157092_157497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101618140.1|157889_158096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101618132.1|158164_158617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101618130.1|158699_159167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101618129.1|159503_159932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101618128.1|160009_160432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010674034.1|160550_160955_-|transposase	IS200/IS605-like element ISAs26 family transposase	transposase	I4AZM1	Saccharomonospora_phage	54.4	1.1e-32
WP_021141234.1|161012_162239_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	78.6	7.7e-154
WP_101618058.1|162961_163306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101618054.1|163691_164111_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_148248205.1|164621_164972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101618048.1|165689_165953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101618046.1|165980_166325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101618044.1|166401_166986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148248208.1|167149_167575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101618059.1|167940_168753_+	AAA family ATPase	NA	Q8JL10	Natrialba_phage	30.4	1.9e-15
WP_101618040.1|168759_169047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101618038.1|169962_170367_-|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	53.6	1.1e-32
WP_107979029.1|170424_171651_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	78.3	5.0e-153
WP_101617939.1|171865_172381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148248210.1|172787_174794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101617945.1|175965_176349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101617946.1|176376_177786_-|transposase	transposase	transposase	I4AZI9	Saccharomonospora_phage	29.2	8.9e-29
WP_088212901.1|177785_178088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101617948.1|178166_178631_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	51.5	2.3e-34
WP_101617950.1|178787_179441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101617952.1|179452_180019_+	single-stranded DNA-binding protein	NA	A0A2I7R8Y7	Vibrio_phage	70.7	4.2e-46
WP_101617956.1|180559_181195_+	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_101617958.1|181578_181944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010674034.1|182161_182566_-|transposase	IS200/IS605-like element ISAs26 family transposase	transposase	I4AZM1	Saccharomonospora_phage	54.4	1.1e-32
WP_021141234.1|182623_183850_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	78.6	7.7e-154
