The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028548	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 chromosome, complete genome	5492984	449876	483134	5492984	tRNA,head,integrase,terminase,protease,portal,capsid,tail	uncultured_Caudovirales_phage(73.33%)	35	467484:467501	483479:483496
WP_002919147.1|449876_450824_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|450838_451348_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|451476_452601_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|452572_453046_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|453071_453614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|453618_454191_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|454194_455013_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|455009_455267_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|455242_455797_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|461592_461814_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|462107_465218_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|465230_466370_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|466748_467399_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
467484:467501	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|467674_468901_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|468993_469935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|470116_470401_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|470411_471191_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_024194847.1|471314_471509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918304.1|471642_471912_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|471904_472093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|472085_472400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|472396_472765_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|472761_473127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|473126_475262_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|475604_475940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|475988_476501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|476764_477931_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|477982_478543_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|478544_479786_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|479782_480118_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|480114_480414_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|480413_480857_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_004198610.1|480983_481175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113647.1|481132_481489_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|481472_483134_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
483479:483496	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 2
NZ_CP028548	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 chromosome, complete genome	5492984	1199727	1276831	5492984	transposase,head,tRNA,plate,integrase,terminase,portal,capsid,coat,lysis,tail	Salmonella_phage(76.09%)	90	1199581:1199640	1262405:1263600
1199581:1199640	attL	GGAAGGTGCGAATAAGCAGGTCATTTCTTCCCAAGCTGACTCGCTGATTAAAATTTCGCG	NA	NA	NA	NA
WP_000019473.1|1199727_1200708_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_002914289.1|1201080_1201530_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_004217499.1|1201648_1201834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914287.1|1202258_1202660_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_002914284.1|1202732_1202912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914281.1|1203117_1204020_+	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	40.2	2.6e-37
WP_002914279.1|1204000_1204546_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_002914277.1|1204553_1204853_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002914274.1|1204928_1205534_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_004145715.1|1205637_1206546_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004151036.1|1206628_1208416_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_004151035.1|1208679_1210200_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002914266.1|1210901_1211483_+	fimbrial protein	NA	NA	NA	NA	NA
WP_004185341.1|1211677_1212340_+	molecular chaperone	NA	NA	NA	NA	NA
WP_004197944.1|1212376_1214932_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002914264.1|1214939_1216034_+	fimbrial protein	NA	NA	NA	NA	NA
WP_002914263.1|1216046_1217075_-	fimbrial protein	NA	NA	NA	NA	NA
WP_004151033.1|1217077_1219615_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002914261.1|1219644_1220313_-	molecular chaperone	NA	NA	NA	NA	NA
WP_002914260.1|1220354_1220903_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_004218900.1|1221006_1221624_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004197960.1|1222063_1222825_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004152937.1|1222880_1223501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914250.1|1223656_1224451_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004151028.1|1224511_1225444_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_004151027.1|1225449_1226178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073547082.1|1226178_1226430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|1226487_1227468_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_062955148.1|1227513_1228512_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	94.5	2.2e-183
WP_004151019.1|1228514_1229144_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|1229266_1229509_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|1229541_1230051_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|1230058_1230259_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|1230222_1230561_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|1230628_1230862_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|1230861_1231089_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|1231085_1231937_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151012.1|1231933_1234318_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_009483812.1|1234547_1234799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|1234798_1236283_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151011.1|1236390_1236579_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151010.1|1236590_1236824_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151009.1|1236919_1237603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|1237589_1238669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151007.1|1238668_1239670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|1240191_1240461_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|1240517_1241561_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_019405037.1|1241560_1243324_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151004.1|1243464_1244298_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|1244314_1245367_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|1245370_1246024_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|1246119_1246584_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|1246583_1246787_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|1246790_1247006_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|1246986_1247496_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|1247500_1247884_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|1247880_1248309_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_085955118.1|1248238_1248442_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	77.6	3.0e-23
WP_004150997.1|1248404_1248827_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|1248819_1249266_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150995.1|1249288_1250155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150994.1|1250249_1250822_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150993.1|1250818_1251181_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004152935.1|1252068_1252740_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150990.1|1252741_1254691_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004200602.1|1254700_1255819_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150988.1|1255870_1256944_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|1257092_1258265_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|1258274_1258790_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|1258842_1259142_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|1259156_1259276_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_000019473.1|1261336_1262317_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_102012126.1|1262355_1262481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150983.1|1263095_1263581_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|1263577_1264672_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
1262405:1263600	attR	CGCGAAATTTTAATCAGCGAGTCAGCTTGGGAAGAAATGACCTGCTTATTCGCACCTTCCTTAGCAGCAAATGGGATGAAATTCTAAGTGATGTTGCCGCGCTGCCCGCGAAGTTTAAAGCGGTGGGCGGTGCGATCATTGACGGCATCCTGAGCGGTATCAATGAGAAGTGGGAGATGCTCAAGAGCAAGCTGGCATCGGTGAAAAGCTACCTGCCGGACTGGATGACCGGCGGCGACAAATCGCCAGGTGCACTTCAGCAGAAAGGAGCAGGCGGATTCTTTGCGGGTATGTATGACAGCGGTGGATATATTCCACGCGGGCAGGTGGGCATTGCTGGCGAGAATGGCCCGGAACTGATTAACGGCCCGGCCTATGTGACCAGCCGCCGAAGGACGGCGGCGCTGGCGTCCGTTGTCGCCGGGATGATGGGGGGAGCGATTCCGGCAGAGGCTGCGCCACTTCATCCAATGAGCCTGCCGGCAACATCCTATCGGCCTGCAGCTGAGAAGCCGGCAGGGGGGCAGCCGATCATTCATATCGAATCGAAGCCGCAATTTATTATCCAGGCATTACCGGGGCAAAGTTCGCAGGATATTGCGAAAGAGGTTGCGCGAATGTTTGCGGAGCATGAGCGGCGTTTAATGGCGAAGGCACGCAGCAACTTCAGCGATCAAGGGGGGTATGATTCATGATGATGGTTCTGGGTTTGTTTGTGTTTCAGCTGCGCACGGTGCCCTATCAGCAACTGCAGTATCAGCGGAACTGGCGGCACGTCACCAACAACCGCGTTAATCGCCGTCCGACAACGCAGTTTCTGGGGCCAGATAATGATCAGCTCACGCTATCCGGCGTCCTCATGCCGGAAGTGACCGGAGGCCGGTTGTCGCTGCTGGCGCTGGAGCTGATGGCGGAGCAGGGGAAGGCCTGGCCGCTGATCGAGGGGGGCGGGACCATCTACGGTATGTACGTGATTGAAAATCTGAGCCAGACAAAAACGGAATTTTTCGCCAGCGGTGAAGCGAGAAAAATAGAGTTTTCGCTGGGGCTAAAGCGTGTTGATGAGTCGCTGTCCGAAATGTTCGGCAGCCTGAGTGACCAGCTTAGCAGCCTGCAGGATTCCGCAGCGGCAGCGGTAGGGAATATCAAAACCACGGTAGGAGGGTTGCTGCAGTGAGCGAGATGACTGATTTACT	NA	NA	NA	NA
WP_004150981.1|1264738_1264957_+	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|1264984_1265362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|1265965_1266448_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
WP_004188817.1|1266558_1267035_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|1267024_1267315_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1267381_1267723_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914159.1|1267870_1269532_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1269618_1270497_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|1270621_1271212_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1271331_1272618_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1272637_1273429_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1273592_1274957_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1275216_1275465_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1275483_1276032_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1276063_1276831_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP028548	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 chromosome, complete genome	5492984	1381547	1434284	5492984	transposase,integrase,holin,terminase,tail	Salmonella_phage(40.38%)	62	1374882:1374896	1404987:1405001
1374882:1374896	attL	TGAGCAGGTTCGCGA	NA	NA	NA	NA
WP_004151980.1|1381547_1383014_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|1383081_1384659_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_062955102.1|1384850_1386101_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	84.4	5.8e-205
WP_063002073.1|1386043_1386286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197356.1|1386282_1386876_-	MT-A70 family protein	NA	T1SA14	Salmonella_phage	91.9	6.3e-109
WP_062955103.1|1386872_1387535_-	hypothetical protein	NA	A0A059VF56	Pseudomonas_phage	46.6	1.2e-47
WP_048264082.1|1387531_1387690_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.1e-17
WP_009485475.1|1387682_1387976_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
WP_062955104.1|1388085_1388334_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	76.8	4.9e-31
WP_062955105.1|1388382_1389264_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	84.3	8.9e-136
WP_062955106.1|1389260_1390082_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	80.2	1.8e-130
WP_004164029.1|1390078_1390378_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004144290.1|1390744_1391326_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
WP_004152538.1|1391480_1391714_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|1391860_1392070_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004207253.1|1392069_1392837_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_032418532.1|1392833_1393619_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
WP_048328152.1|1393738_1394086_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	6.5e-50
WP_062955107.1|1394278_1394689_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	45.1	4.3e-16
WP_032441402.1|1394672_1394864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441401.1|1394860_1395505_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	79.3	8.0e-110
WP_072200041.1|1395798_1396266_+	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	51.7	1.3e-37
WP_029602865.1|1396265_1396559_+	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	86.6	2.7e-44
WP_050491799.1|1396555_1397176_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	40.7	1.0e-29
WP_032441458.1|1397175_1397379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023339258.1|1397371_1397710_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	1.8e-44
WP_004152765.1|1397806_1399291_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|1399290_1399542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032418540.1|1399694_1399952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441400.1|1400029_1400614_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	2.2e-90
WP_062955142.1|1400610_1402086_+	hypothetical protein	NA	Q858H3	Salmonella_phage	93.1	6.4e-280
WP_004200550.1|1402129_1402501_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	91.9	3.7e-59
WP_072354015.1|1402550_1402793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004141368.1|1403254_1403461_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_032441398.1|1403475_1405158_+|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.4	1.5e-264
1404987:1405001	attR	TGAGCAGGTTCGCGA	NA	NA	NA	NA
WP_004152446.1|1405154_1405451_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
WP_032441397.1|1405453_1406134_+	peptidase	NA	G9L6C4	Escherichia_phage	84.0	6.1e-76
WP_004200546.1|1406148_1407135_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	94.2	2.5e-179
WP_020953461.1|1407188_1407626_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.7	1.3e-66
WP_062955141.1|1407636_1407978_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	2.4e-36
WP_004152441.1|1408028_1408352_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
WP_062955139.1|1408351_1408957_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	77.0	4.0e-87
WP_062955138.1|1408956_1411434_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.4	0.0e+00
WP_004152438.1|1411433_1411898_+	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
WP_032447858.1|1411897_1412437_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	8.0e-71
WP_062955137.1|1412447_1414982_+	hypothetical protein	NA	Q858G0	Salmonella_phage	84.1	0.0e+00
WP_062955136.1|1414981_1416892_+	hypothetical protein	NA	Q858F9	Salmonella_phage	82.7	5.4e-287
WP_062955135.1|1416891_1419648_+	hypothetical protein	NA	Q858F8	Salmonella_phage	95.4	0.0e+00
WP_062955134.1|1419644_1419839_+	hypothetical protein	NA	Q858F7	Salmonella_phage	67.2	6.5e-15
WP_071787028.1|1419873_1420026_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	83.7	2.5e-14
WP_062955133.1|1420124_1420421_-	hypothetical protein	NA	T1SA06	Salmonella_phage	63.9	6.9e-24
WP_062955131.1|1423248_1423512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032188295.1|1424674_1424761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|1424799_1425780_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_000608644.1|1426648_1427911_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_072354001.1|1428801_1428942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077265603.1|1429019_1430336_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A0K2FI18	Enterobacter_phage	32.3	2.3e-34
WP_062955010.1|1430422_1430827_+	hypothetical protein	NA	T1SA79	Salmonella_phage	81.1	8.7e-54
WP_023339240.1|1430813_1431119_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	2.7e-39
WP_062955009.1|1431108_1431738_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.9	1.8e-90
WP_062955008.1|1431734_1432235_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	76.9	1.3e-59
WP_102012128.1|1432421_1434284_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 4
NZ_CP028548	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 chromosome, complete genome	5492984	1763867	1770773	5492984	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|1763867_1764731_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004899467.1|1764741_1765515_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_002912636.1|1765756_1766650_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1766895_1768257_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1768575_1769298_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_062955084.1|1769294_1770773_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 5
NZ_CP028548	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 chromosome, complete genome	5492984	1811508	1824154	5492984		Enterobacteria_phage(36.36%)	12	NA	NA
WP_062955058.1|1811508_1812915_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	3.6e-38
WP_062955056.1|1813138_1814203_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	4.4e-105
WP_062956182.1|1814216_1815086_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.4	3.4e-111
WP_048996045.1|1815117_1816008_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	3.7e-28
WP_004175260.1|1816022_1816577_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
WP_000704907.1|1816756_1817923_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_062955151.1|1818871_1819876_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.2	4.0e-31
WP_075053193.1|1819831_1820113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073547076.1|1820715_1821780_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	2.6e-105
WP_063002077.1|1821793_1822663_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
WP_048996045.1|1822694_1823585_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	3.7e-28
WP_015958693.1|1823599_1824154_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
>prophage 6
NZ_CP028548	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 chromosome, complete genome	5492984	2815288	2826176	5492984		Escherichia_phage(87.5%)	10	NA	NA
WP_004151613.1|2815288_2818396_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|2818450_2819716_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2819746_2820835_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|2820921_2821182_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|2821479_2822340_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2822360_2823122_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_023148136.1|2823112_2823346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002903955.1|2823383_2824286_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_050849168.1|2824297_2825563_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	1.9e-232
WP_002210516.1|2825555_2826176_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 7
NZ_CP028548	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 chromosome, complete genome	5492984	3043111	3116450	5492984	plate,integrase,holin,transposase	Enterobacteria_phage(32.43%)	83	3045011:3045028	3124890:3124907
WP_002902150.1|3043111_3044452_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002902148.1|3044464_3046009_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
3045011:3045028	attL	ATCTTTCACCGCGCCGCC	NA	NA	NA	NA
WP_002902144.1|3046051_3046543_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000019473.1|3047012_3047993_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_102012124.1|3048031_3048205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102012123.1|3048125_3049190_-|integrase	integrase family protein	integrase	A0A0M4QX09	Salmonella_phage	82.9	1.4e-175
WP_016197745.1|3049386_3049935_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004152145.1|3050133_3051666_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|3051882_3052644_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152143.1|3052752_3053667_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004176439.1|3053967_3054156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152142.1|3054226_3054535_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_004218009.1|3054540_3054678_+	glycosyl hydrolase family 2	NA	NA	NA	NA	NA
WP_004152141.1|3054702_3055572_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	5.7e-50
WP_004218007.1|3055650_3056853_-	MFS transporter	NA	NA	NA	NA	NA
WP_004152139.1|3056925_3058062_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004152138.1|3058234_3059119_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152137.1|3059243_3060077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152136.1|3060307_3060694_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_004152135.1|3060861_3062478_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152134.1|3062663_3063371_+	murein tripeptide amidase MpaA	NA	NA	NA	NA	NA
WP_004152133.1|3063367_3064333_-	L-Ala-D/L-Glu epimerase	NA	NA	NA	NA	NA
WP_004152131.1|3064435_3064942_+	thiol peroxidase	NA	NA	NA	NA	NA
WP_085666574.1|3065012_3066035_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_002901979.1|3066166_3067708_-	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_002901977.1|3067880_3069194_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_071531198.1|3069325_3070207_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152127.1|3070296_3071358_-	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_002901917.1|3071354_3072752_-	YcjX family protein	NA	NA	NA	NA	NA
WP_002901915.1|3072854_3073073_-	phage shock protein PspD	NA	NA	NA	NA	NA
WP_002901913.1|3073101_3073461_-	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_002901911.1|3073460_3073685_-	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_002901908.1|3073740_3074409_-	phage shock protein PspA	NA	NA	NA	NA	NA
WP_002901905.1|3074576_3075551_+	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_002901901.1|3075541_3076933_-	MFS transporter	NA	NA	NA	NA	NA
WP_002901900.1|3076958_3078128_-	amidohydrolase	NA	NA	NA	NA	NA
WP_004152126.1|3078299_3080609_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004171423.1|3080587_3081418_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004152124.1|3081528_3082434_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002901817.1|3082767_3084411_+	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
WP_002901816.1|3084407_3085373_+	peptide ABC transporter permease SapB	NA	NA	NA	NA	NA
WP_002901815.1|3085577_3086249_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
WP_071531199.1|3086435_3087263_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901813.1|3087338_3088604_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_002901812.1|3088605_3089025_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_004152765.1|3089104_3090589_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|3090588_3090840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152776.1|3091486_3091909_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_001067855.1|3092501_3093206_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000679427.1|3093821_3094169_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001261740.1|3094332_3095124_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001067855.1|3095934_3096639_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_062955100.1|3096675_3096963_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	95.4	4.4e-36
WP_004218565.1|3096959_3097499_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_004218567.1|3097495_3097807_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	3.8e-49
WP_004232548.1|3098444_3099134_-	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_004218534.1|3099133_3099274_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004218533.1|3099270_3099909_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218532.1|3099901_3100570_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004243010.1|3100566_3100734_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218531.1|3100714_3101182_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
WP_004218530.1|3101702_3102731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196831.1|3102938_3103184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218528.1|3103239_3103542_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004201118.1|3103538_3104387_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004201117.1|3104383_3105244_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_001548453.1|3105329_3105551_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201115.1|3105591_3105819_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_004201113.1|3105930_3106629_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_019405077.1|3106651_3106771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201109.1|3106916_3107993_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_004201108.1|3108074_3108278_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_073547062.1|3108706_3108901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201105.1|3108989_3109274_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004201103.1|3109289_3110135_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_004201102.1|3110420_3111101_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_004151898.1|3111097_3111526_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004151899.1|3111522_3112185_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004190725.1|3112181_3112496_+	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	1.6e-10
WP_004153574.1|3112392_3113580_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
WP_004151901.1|3113756_3114647_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_004140266.1|3114646_3115639_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|3115640_3116450_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
3124890:3124907	attR	ATCTTTCACCGCGCCGCC	NA	NA	NA	NA
>prophage 8
NZ_CP028548	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 chromosome, complete genome	5492984	3244122	3333201	5492984	transposase,tRNA,head,integrase,terminase,portal,capsid,lysis,tail	Klebsiella_phage(44.44%)	98	3270925:3270939	3331012:3331026
WP_002901088.1|3244122_3244623_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|3244739_3245186_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901073.1|3245169_3245961_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004150777.1|3246062_3247247_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|3247278_3247971_-	CTP synthase	NA	NA	NA	NA	NA
WP_004150778.1|3248116_3248626_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004150779.1|3248612_3248969_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004150780.1|3248958_3249198_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004150781.1|3249498_3250512_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.4e-12
WP_004150782.1|3250569_3250671_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_099119317.1|3250670_3250745_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|3250862_3250988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|3251047_3251311_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|3251441_3252080_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|3252169_3253084_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_020956815.1|3253299_3253491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150784.1|3253745_3254789_-	type II asparaginase	NA	NA	NA	NA	NA
WP_004150785.1|3255091_3256300_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004150787.1|3256373_3258158_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004150788.1|3258164_3259055_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|3259175_3260684_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150790.1|3260994_3261681_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004140501.1|3262078_3262258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|3262297_3262930_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140506.1|3263496_3263694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140509.1|3263809_3264820_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004150793.1|3264816_3266223_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140512.1|3266278_3267166_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140514.1|3267182_3267689_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150794.1|3267715_3268210_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|3268300_3268486_-	general stress protein	NA	NA	NA	NA	NA
WP_004140529.1|3269107_3270301_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004140530.1|3270413_3270641_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
3270925:3270939	attL	TGGCTGGCGTTCTTT	NA	NA	NA	NA
WP_004150797.1|3271077_3271401_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004150798.1|3271393_3271786_+	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004150799.1|3271782_3272496_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004892953.1|3272768_3272921_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_023328083.1|3273075_3274572_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	63.7	1.4e-125
WP_073547060.1|3274640_3287345_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	47.1	0.0e+00
WP_023328085.1|3287407_3288001_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	76.6	8.0e-80
WP_047666390.1|3288027_3288450_-	hypothetical protein	NA	J9Q806	Salmonella_phage	50.0	5.9e-29
WP_047666389.1|3288491_3289202_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	90.3	1.9e-136
WP_023328087.1|3289203_3289959_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.5	4.6e-125
WP_023328088.1|3289955_3290294_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	1.4e-57
WP_023328089.1|3290293_3293629_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.3	0.0e+00
WP_071836352.1|3293628_3293847_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	90.5	5.4e-34
WP_014228914.1|3293861_3294227_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_023328090.1|3294284_3294746_-	hypothetical protein	NA	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_023328091.1|3294777_3295179_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	2.3e-62
WP_017880258.1|3295175_3295565_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_023328092.1|3295545_3295884_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	90.2	2.8e-53
WP_020317538.1|3295880_3296198_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_049010370.1|3296178_3296439_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	60.5	7.4e-22
WP_023328094.1|3296497_3297784_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.0	9.8e-216
WP_014907815.1|3297861_3298782_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
WP_023279520.1|3298818_3300078_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	1.8e-222
WP_017898992.1|3300077_3300257_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
WP_021462603.1|3300250_3301972_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.5e-190
WP_012542168.1|3301971_3302406_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_014907818.1|3302654_3303086_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.6	1.8e-41
WP_023297386.1|3303082_3303406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032428746.1|3303357_3303720_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
WP_032749552.1|3304046_3304271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049115059.1|3304309_3304747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016160650.1|3305696_3306047_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
WP_032432826.1|3306043_3306541_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.6	1.1e-77
WP_016160648.1|3306540_3306756_-|lysis	phage S lysis protein	lysis	A5LH82	Enterobacteria_phage	88.7	2.7e-30
WP_000019473.1|3307078_3308059_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_102012129.1|3308097_3308223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025861432.1|3310207_3310810_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.6	1.1e-76
WP_062955112.1|3310826_3311858_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	4.7e-96
WP_017898980.1|3311857_3312061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025861428.1|3312057_3312450_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	8.0e-12
WP_077255782.1|3312490_3312781_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	8.0e-17
WP_025368263.1|3312792_3313026_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	3.7e-25
WP_004152765.1|3313104_3314589_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|3314588_3314840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062954975.1|3315429_3316791_-	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_062954976.1|3316964_3317678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062954989.1|3318029_3318899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062954977.1|3318987_3320379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032443841.1|3320727_3321168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047667474.1|3321181_3321646_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	72.2	4.1e-63
WP_077265602.1|3321638_3322643_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	40.0	1.0e-31
WP_046622349.1|3322702_3323257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071561166.1|3323259_3323484_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	62.5	1.3e-19
WP_077257742.1|3323572_3324010_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	62.2	1.3e-39
WP_040234937.1|3324331_3324646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099143961.1|3324808_3325027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023279538.1|3325036_3325231_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_014228879.1|3325273_3325618_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_062954978.1|3325759_3327898_+	exodeoxyribonuclease VIII	NA	S4TNL0	Salmonella_phage	42.7	5.6e-99
WP_012542206.1|3327950_3328196_+	excisionase	NA	NA	NA	NA	NA
WP_032418030.1|3328176_3329304_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.4	4.4e-119
WP_004150800.1|3329421_3330672_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_004150801.1|3330912_3331563_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
3331012:3331026	attR	AAAGAACGCCAGCCA	NA	NA	NA	NA
WP_004150802.1|3331579_3332038_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150803.1|3332094_3333201_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP028548	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 chromosome, complete genome	5492984	3549180	3642131	5492984	tRNA,head,plate,integrase,terminase,protease,portal,capsid,lysis,tail	Salmonella_phage(56.9%)	97	3604706:3604724	3642206:3642224
WP_002898139.1|3549180_3550473_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3550563_3551907_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3551915_3552527_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|3552649_3556903_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|3557038_3557533_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_002898019.1|3558065_3559034_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_002898017.1|3559148_3560915_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3560915_3562637_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3562681_3563383_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3563736_3563955_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_101329668.1|3564075_3566355_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3566385_3566703_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3567028_3567250_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_071528213.1|3567204_3567387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150848.1|3567326_3569267_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3569263_3570379_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3570525_3572184_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3572603_3573299_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3573414_3574314_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3574457_3576110_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3576120_3577089_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_085666582.1|3577039_3577243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896408.1|3577300_3577735_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3577886_3579605_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3579643_3580645_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3580655_3582098_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3582185_3583199_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3583195_3584026_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3584057_3585197_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_004147767.1|3585249_3585429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896394.1|3586074_3586590_+	lipoprotein	NA	NA	NA	NA	NA
WP_032419144.1|3586816_3587545_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3587565_3588297_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3588303_3589020_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3589019_3589688_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3589871_3590603_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3590645_3592118_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3592114_3592831_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3592909_3594037_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3594078_3594567_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3594624_3595470_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3595466_3596420_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|3596430_3597564_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|3597727_3598840_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3599188_3599668_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3599756_3600659_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3601480_3601768_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3601970_3602234_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3602240_3602624_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|3602890_3604576_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3604706:3604724	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3604795_3605014_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3605105_3606206_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|3606202_3606688_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896222.1|3606684_3609312_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896220.1|3609304_3609424_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3609438_3609738_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3609790_3610306_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3610315_3611488_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3611626_3612703_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|3612732_3612936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|3612932_3613664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|3613667_3616619_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|3616620_3617220_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3617212_3618121_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_032441567.1|3618107_3618470_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	4.9e-48
WP_002896177.1|3618466_3619039_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004150857.1|3619133_3619826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3619822_3620269_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3620261_3620693_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896168.1|3620788_3621217_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3621213_3621597_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3621601_3622111_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3622091_3622307_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3622310_3622514_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3622513_3622978_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3623073_3623724_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|3623727_3624786_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|3624802_3625636_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3625778_3627545_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3627544_3628570_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|3628631_3630374_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|3630649_3631327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001316229.1|3631441_3631747_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3631685_3631874_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150862.1|3632027_3634442_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|3634438_3635296_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|3635292_3635520_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|3635519_3635753_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|3635820_3636162_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|3636125_3636326_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|3636333_3636843_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|3636875_3637097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|3637242_3638121_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|3638132_3639077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|3639175_3640660_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|3640659_3640911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151720.1|3641078_3642131_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
3642206:3642224	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 10
NZ_CP028548	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 chromosome, complete genome	5492984	4294581	4306234	5492984	integrase	Enterobacteria_phage(70.0%)	13	4295031:4295045	4318087:4318101
WP_004144574.1|4294581_4295685_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4295031:4295045	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|4295695_4296949_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4297301_4298492_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4298479_4299430_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|4299429_4299855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152202.1|4300422_4300989_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152203.1|4301006_4301252_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_062956184.1|4301248_4301986_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.9e-70
WP_002889915.1|4302527_4302794_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|4302790_4303348_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|4303344_4303572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4303568_4303889_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4303900_4306234_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4318087:4318101	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 11
NZ_CP028548	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 chromosome, complete genome	5492984	4962197	5002618	5492984	integrase,transposase	Salmonella_phage(15.38%)	39	4952389:4952404	4981608:4981623
4952389:4952404	attL	CCTGGCCGGTGGCGTG	NA	NA	NA	NA
WP_001138082.1|4962197_4965083_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.9	1.1e-190
WP_001389365.1|4965785_4966550_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001297012.1|4966637_4966751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|4967056_4967557_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_031974050.1|4967575_4967755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000259032.1|4967684_4968524_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|4968517_4968865_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001261740.1|4969028_4969820_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_042862943.1|4969912_4971172_-	chloramphenicol efflux MFS transporter CmlA10	NA	S4TR35	Salmonella_phage	31.3	1.1e-25
WP_000381802.1|4971426_4971960_-	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
WP_015059047.1|4972033_4972366_-	quaternary ammonium compound efflux SMR transporter QacL	NA	E5E3Y9	Acinetobacter_phage	34.3	3.5e-08
WP_015057121.1|4972616_4973576_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
WP_001067855.1|4973466_4974171_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_096634015.1|4974161_4974359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001082319.1|4974399_4975203_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|4975202_4976039_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_028690953.1|4976162_4976528_-	DUF3742 family protein	NA	NA	NA	NA	NA
WP_028690952.1|4976612_4977245_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_023657212.1|4977257_4977884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028690951.1|4978203_4980048_+	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_028690950.1|4980128_4982780_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	33.9	5.2e-155
4981608:4981623	attR	CACGCCACCGGCCAGG	NA	NA	NA	NA
WP_028690949.1|4982805_4984671_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	37.1	3.4e-52
WP_028690948.1|4984731_4986045_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.2	1.3e-77
WP_028690947.1|4986096_4987404_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023464790.1|4987422_4988253_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_023464791.1|4988311_4989646_-	DUF3422 domain-containing protein	NA	NA	NA	NA	NA
WP_023103885.1|4989828_4990227_-	VOC family protein	NA	NA	NA	NA	NA
WP_011871467.1|4990270_4991380_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.4	2.9e-35
WP_028690946.1|4991439_4991715_-	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_028690945.1|4991997_4992888_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_028690944.1|4992884_4993493_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_023103882.1|4993494_4993902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023103881.1|4994056_4994962_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_028690943.1|4995112_4997089_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_071534863.1|4997302_4997521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023835768.1|4997464_4997896_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_006473314.1|4998303_4998642_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_072160368.1|4998702_5000253_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	42.0	4.5e-90
WP_096634014.1|5001447_5002618_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.7	1.5e-90
>prophage 1
NZ_CP028543	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid p1_020143, complete sequence	159355	1727	66699	159355	protease,transposase,integrase	uncultured_Caudovirales_phage(26.32%)	58	NA	NA
WP_001515717.1|1727_2468_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004152065.1|3611_4559_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_071527918.1|4585_4897_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152067.1|4961_5885_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
WP_004197688.1|6557_6815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080895248.1|7434_8871_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152070.1|9853_11131_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_004152071.1|11193_13197_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_085955172.1|14230_15438_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178091.1|16866_17298_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|17548_19024_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|19016_19697_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|19886_21272_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|21300_21654_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004152079.1|21767_23060_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|23070_26217_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_000758228.1|26303_26744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098955.1|26870_29318_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|29358_29556_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|29589_30327_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|30615_31065_-	copper resistance protein	NA	NA	NA	NA	NA
WP_000925242.1|31298_33116_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|33115_34012_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|34051_34432_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|34436_35366_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|35420_36101_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|36097_37498_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_004152085.1|37714_38149_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152086.1|38380_38560_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_031944101.1|40302_40812_+	major intrinsic protein MIP	NA	NA	NA	NA	NA
WP_004152091.1|40861_41359_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152092.1|41690_42017_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085903505.1|42016_42727_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004182005.1|42735_43281_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152095.1|43356_43719_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004152096.1|45615_46152_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152097.1|46184_46610_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152098.1|46622_47912_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152099.1|47959_49711_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152100.1|49728_50091_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152101.1|50140_50491_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152102.1|50848_51118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152103.1|51105_51681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|51711_52206_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152105.1|52249_52618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|52651_52855_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152107.1|52903_53161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152108.1|53236_53491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|53666_53933_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|53920_54403_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020314316.1|54614_55961_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004152113.1|57803_58766_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_085395420.1|58752_59502_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152115.1|59739_59937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152116.1|59936_62732_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152117.1|62846_63416_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152118.1|63450_63732_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_000019473.1|65718_66699_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 2
NZ_CP028543	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid p1_020143, complete sequence	159355	73168	106162	159355	transposase,bacteriocin,integrase	Escherichia_phage(45.45%)	34	83068:83127	90960:91779
WP_004217321.1|73168_73873_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000427623.1|75207_76212_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_044117068.1|76503_77172_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.9e-130
WP_001330846.1|77891_78137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|78142_78334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587837.1|78815_79358_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|79370_80231_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000971921.1|81054_82425_-|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
83068:83127	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|83130_83835_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_108193582.1|83780_84098_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000845048.1|84036_85050_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|85194_85692_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|85803_86094_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|86099_86891_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|87054_87402_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259032.1|87395_88235_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_031974050.1|88164_88344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|88362_88863_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001297012.1|89168_89282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|89369_90134_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_019725122.1|90474_91011_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	60.6	6.8e-46
WP_001067855.1|91022_91727_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001535719.1|91793_93191_+	HAMP domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.2	1.1e-58
90960:91779	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
WP_004152290.1|93729_96039_+	ATPase	NA	NA	NA	NA	NA
WP_004152291.1|96042_97359_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000093087.1|97355_99551_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_009486390.1|100172_100361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024940886.1|100504_100693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152292.1|100997_101855_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_004171457.1|101847_101925_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004199332.1|102141_102420_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_004152294.1|102740_103292_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.2	1.1e-19
WP_004152296.1|103560_103839_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_004178051.1|103840_106162_-|bacteriocin	klebicin B-related nuclease bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 1
NZ_CP028544	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid p2_020143, complete sequence	110562	0	110241	110562	portal,tail,integrase,terminase	Salmonella_phage(82.52%)	115	3652:3676	20855:20879
WP_101329664.1|0_1098_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	45.1	1.7e-72
WP_014342074.1|1528_1741_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	80.0	4.3e-28
WP_040120273.1|1740_2076_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	67.6	2.1e-37
WP_039817759.1|2072_2252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048333499.1|2785_3862_-	recombinase	NA	J9Q736	Salmonella_phage	96.1	8.5e-197
3652:3676	attL	CGGCCGTCGCCAGGAAGGTTTTACC	NA	NA	NA	NA
WP_040120271.1|3864_4131_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	83.0	1.1e-33
WP_021313784.1|4130_5075_-	exonuclease	NA	J9Q7S6	Salmonella_phage	93.6	2.8e-172
WP_032440516.1|5135_6143_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	88.3	2.1e-144
WP_032440517.1|6262_6694_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	91.6	1.1e-65
WP_021313787.1|6849_7149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021313788.1|7159_7579_-	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	62.6	6.3e-47
WP_080790246.1|7779_8223_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	83.0	9.9e-59
WP_074193573.1|8219_9389_-	uracil-DNA glycosylase	NA	J9Q7Z2	Salmonella_phage	92.3	4.4e-207
WP_077255320.1|9410_10112_-	hypothetical protein	NA	S5YLC4	Mycobacterium_phage	37.1	6.4e-20
WP_101329665.1|10108_12472_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	86.6	0.0e+00
WP_071994325.1|12446_12650_-	hypothetical protein	NA	J9Q6I7	Salmonella_phage	80.6	3.3e-25
WP_032439780.1|12652_13885_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	86.4	2.2e-212
WP_060598440.1|13981_16261_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	63.6	7.2e-246
WP_014342091.1|16863_17244_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_101329666.1|17238_18339_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	28.4	1.6e-17
WP_032443560.1|18587_18998_-	toxin YafO	NA	NA	NA	NA	NA
WP_100206813.1|19007_19418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032443559.1|19707_19953_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	47.4	5.3e-14
WP_087823467.1|19949_20336_-	hypothetical protein	NA	Q716B1	Shigella_phage	70.4	4.1e-45
WP_032443558.1|20345_21122_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	65.4	8.5e-90
20855:20879	attR	CGGCCGTCGCCAGGAAGGTTTTACC	NA	NA	NA	NA
WP_040120264.1|21233_22106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032440525.1|22895_23195_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	66.3	3.6e-28
WP_021313107.1|23191_23344_-	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	82.0	1.6e-16
WP_023279474.1|23588_24056_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	63.9	1.3e-48
WP_087823461.1|24135_24924_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	51.1	1.5e-70
WP_087653286.1|25044_26160_-	DNA primase	NA	J9Q720	Salmonella_phage	91.3	8.2e-203
WP_101329669.1|26313_27654_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	95.5	3.5e-240
WP_023279420.1|27718_28444_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	88.8	2.5e-128
WP_032422983.1|28616_30380_-	hypothetical protein	NA	X2KLG0	Campylobacter_phage	27.4	5.6e-12
WP_004110193.1|30376_30739_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.2e-43
WP_032422982.1|30738_31404_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	83.7	2.9e-102
WP_050485939.1|31697_32282_+	hypothetical protein	NA	A0A2H4J5U3	uncultured_Caudovirales_phage	42.6	6.5e-34
WP_039817675.1|32478_32730_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	73.5	2.0e-24
WP_032422980.1|32732_33425_-	membrane protein	NA	J9Q7Y7	Salmonella_phage	89.1	2.7e-119
WP_004109805.1|33438_33762_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	95.3	2.3e-49
WP_039817683.1|33857_35303_-|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	37.5	4.4e-39
WP_102012119.1|35355_47526_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	58.3	1.8e-29
WP_019704527.1|47542_48154_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	72.1	1.1e-76
WP_004109817.1|48141_48939_-|tail	tail protein	tail	J9Q7R4	Salmonella_phage	85.3	5.4e-140
WP_004109820.1|48931_49630_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	87.4	1.2e-122
WP_032423010.1|49716_50052_-|tail	tail protein	tail	J9Q6E1	Salmonella_phage	84.5	2.6e-51
WP_064163025.1|50095_54631_-	tape measure protein	NA	J9Q712	Salmonella_phage	69.8	0.0e+00
WP_004109830.1|54638_54872_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.5	3.4e-34
WP_004109835.1|54988_55306_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	93.3	1.8e-46
WP_064152245.1|55367_56114_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	82.6	8.1e-106
WP_064152246.1|56181_56574_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	66.7	5.0e-46
WP_021313126.1|56575_57049_-	hypothetical protein	NA	J9Q711	Salmonella_phage	93.6	1.9e-76
WP_004109848.1|57039_57384_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	92.1	7.4e-54
WP_021313128.1|57481_58315_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	83.4	4.8e-131
WP_064152247.1|58314_58749_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	84.0	1.1e-62
WP_014342134.1|58796_59225_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	71.6	7.9e-29
WP_004109857.1|59302_60181_-	hypothetical protein	NA	J9Q710	Salmonella_phage	94.2	4.7e-153
WP_023279435.1|60207_61107_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	82.6	6.1e-124
WP_087525988.1|61129_62719_-|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	88.4	7.4e-274
WP_004109863.1|62736_63993_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	97.4	9.4e-248
WP_004109866.1|63995_64637_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	88.2	5.0e-96
WP_004109869.1|64814_65081_-	hypothetical protein	NA	J9Q757	Salmonella_phage	90.9	1.3e-37
WP_026005938.1|65090_65990_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	97.0	4.2e-165
WP_060528000.1|65986_66241_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	95.2	3.4e-40
WP_019704584.1|66233_66872_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	97.6	1.4e-109
WP_101329652.1|66868_67537_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	92.3	3.9e-107
WP_040120249.1|67536_68217_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	89.7	3.6e-108
WP_040120248.1|68300_69860_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.7	1.3e-278
WP_014342145.1|69862_70138_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	68.1	4.0e-26
WP_019704582.1|70188_70626_-	hypothetical protein	NA	A0A1V0E7W1	Vibrio_phage	36.4	9.5e-14
WP_101329653.1|70781_71312_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	84.5	1.3e-70
WP_032423112.1|71444_71624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004109892.1|71945_72596_+	hypothetical protein	NA	J9Q754	Salmonella_phage	91.7	8.4e-107
WP_004109904.1|72646_72850_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	95.5	4.1e-28
WP_040120247.1|73442_73925_-	hypothetical protein	NA	J9Q805	Salmonella_phage	77.5	2.7e-70
WP_040120246.1|74130_74412_-	ABC transporter	NA	J9Q753	Salmonella_phage	82.8	2.9e-40
WP_021313142.1|74414_74789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004109918.1|74916_75324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088426889.1|75443_75755_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	68.0	5.2e-30
WP_040120244.1|75891_76104_-	hypothetical protein	NA	J9Q804	Salmonella_phage	74.3	9.9e-25
WP_019704577.1|76116_76335_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	81.9	2.9e-27
WP_101329654.1|77108_77411_+	hypothetical protein	NA	J9Q7T6	Salmonella_phage	66.7	8.0e-12
WP_065801224.1|78212_80078_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_101329655.1|80281_81838_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	1.9e-104
WP_032440500.1|81834_83019_+	restriction endonuclease subunit S	NA	A0A240FAT6	Liberibacter_phage	50.6	1.3e-41
WP_040247712.1|83140_86257_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	23.8	1.0e-24
WP_021313148.1|86318_86534_-	hypothetical protein	NA	J9Q747	Salmonella_phage	69.8	1.2e-14
WP_101329656.1|86662_87241_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	57.0	5.1e-55
WP_014342167.1|87368_87524_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	61.2	1.7e-05
WP_019704567.1|87523_87949_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	80.9	9.8e-56
WP_032414138.1|88051_88240_-	hypothetical protein	NA	J9Q800	Salmonella_phage	52.5	3.3e-08
WP_072058614.1|88236_88515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101329657.1|88885_89536_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	80.1	4.9e-91
WP_032423059.1|90114_90342_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.0	7.6e-31
WP_101329658.1|90539_91133_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	84.8	1.7e-98
WP_032423057.1|91317_92151_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	56.4	1.1e-63
WP_032423056.1|92276_92825_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	74.4	3.2e-75
WP_050485941.1|92821_93403_-	hypothetical protein	NA	A0A1B0VMI8	Pseudomonas_phage	50.4	4.2e-33
WP_014342175.1|93625_94045_-	hypothetical protein	NA	J9Q743	Salmonella_phage	73.4	1.9e-51
WP_101329659.1|94108_94753_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	77.1	1.4e-93
WP_032423042.1|94752_95229_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	80.3	1.3e-72
WP_032423043.1|95225_95639_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	77.4	6.2e-55
WP_014342179.1|95640_96744_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	79.8	2.5e-180
WP_101329660.1|96937_97813_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	J9Q742	Salmonella_phage	84.4	1.3e-139
WP_101329661.1|97890_99033_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	95.5	4.4e-212
WP_014342182.1|99163_101467_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	90.9	0.0e+00
WP_021313773.1|101542_102112_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	89.9	1.1e-94
WP_080922323.1|102121_102868_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	62.1	7.7e-80
WP_101329662.1|102857_104774_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	84.5	2.1e-299
WP_072196416.1|104770_105004_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	66.1	4.4e-18
WP_073579047.1|105003_106089_-	exonuclease	NA	J9Q7S9	Salmonella_phage	84.8	1.8e-183
WP_073579045.1|106515_106728_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_080790187.1|106724_107591_+	hypothetical protein	NA	A0A2I6UHT9	Bacillus_phage	55.8	1.1e-05
WP_080790185.1|107621_109082_-	hypothetical protein	NA	A0A2I6UHU5	Bacillus_phage	33.3	5.0e-59
WP_080790184.1|109596_110241_-	hypothetical protein	NA	J9Q739	Salmonella_phage	80.7	1.1e-98
>prophage 1
NZ_CP028547	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid pKPC2_020143, complete sequence	73791	1796	51815	73791	transposase,integrase,protease	Escherichia_phage(33.33%)	56	8127:8186	59256:60078
WP_000616807.1|1796_2450_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_012602143.1|2669_3134_+	Plasmid stable inheritance protein	NA	NA	NA	NA	NA
WP_012602142.1|3130_3235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|4444_5149_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_042934582.1|5617_6175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102012130.1|6302_6653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|6700_7405_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_102012131.1|7395_7590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008324180.1|7691_8066_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	62.7	2.2e-27
8127:8186	attL	ACGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGC	NA	NA	NA	NA
WP_001067855.1|8191_8896_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000957857.1|8961_9150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064441864.1|9241_9778_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	2.8e-84
WP_000027057.1|9960_10821_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_012372818.1|10990_11746_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_001067855.1|12195_12900_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_013214010.1|14101_14359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013214009.1|14404_15184_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.4e-52
WP_011977814.1|15367_16372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977813.1|16401_16605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013214008.1|16650_17172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032738650.1|17229_17580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977810.1|17658_18603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015493090.1|18763_19198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261282.1|19181_19412_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044770.1|19408_19825_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_004206609.1|19898_21461_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000361404.1|21445_22468_+	helicase UvrD	NA	NA	NA	NA	NA
WP_004199234.1|23746_24628_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_013213987.1|25862_26159_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_013213989.1|26487_26913_-	antirestriction protein	NA	A0A2D0W8Z5	Bordetella_virus	37.3	5.3e-17
WP_013213990.1|27023_27302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001161490.1|28844_29405_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001138014.1|29408_32375_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_002904004.1|32615_33476_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|33496_34258_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_023148136.1|34248_34482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002903955.1|34519_35422_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_001067855.1|37055_37760_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000019473.1|38009_38990_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_015493087.1|39503_39899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493086.1|39895_40507_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_015493085.1|40503_41454_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.6	6.6e-76
WP_040219232.1|41600_41801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022652286.1|41854_42487_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.9	2.5e-07
WP_015493083.1|42849_44055_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.2	1.1e-205
WP_016479949.1|44051_45023_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.9	1.4e-113
WP_015493081.1|45158_46430_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.0	6.1e-154
WP_015493080.1|46429_46852_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
WP_015493079.1|47031_47703_-	Gifsy-2 prophage protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.7	5.1e-83
WP_002211749.1|48061_48739_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
WP_015493077.1|48738_48960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493076.1|48970_49390_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_015493075.1|49443_50223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493074.1|50627_51134_+	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	31.8	4.8e-09
WP_015493073.1|51176_51368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032072906.1|51554_51815_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	46.2	4.1e-12
59256:60078	attR	ACGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCA	NA	NA	NA	NA
