The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024127	Escherichia coli strain 14EC001 chromosome, complete genome	5072975	1041386	1049327	5072975		uncultured_Mediterranean_phage(33.33%)	8	NA	NA
WP_001295182.1|1041386_1042148_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1042141_1042768_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|1042907_1044047_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1044109_1045102_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_097562139.1|1045195_1046560_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|1046648_1047425_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1047429_1048068_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590405.1|1048064_1049327_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.0	8.3e-135
>prophage 2
NZ_CP024127	Escherichia coli strain 14EC001 chromosome, complete genome	5072975	1135066	1146269	5072975	integrase,transposase	Enterobacteria_phage(77.78%)	13	1134047:1134060	1147638:1147651
1134047:1134060	attL	AATATCATTTATCC	NA	NA	NA	NA
WP_024238666.1|1135066_1137400_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.5	0.0e+00
WP_000856729.1|1137414_1137735_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_023352720.1|1137870_1138326_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	97.3	3.0e-63
WP_085947970.1|1138369_1139583_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_101981492.1|1139634_1139919_-	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	3.2e-47
WP_024188241.1|1139911_1140502_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	99.3	1.3e-69
WP_001149160.1|1140498_1140765_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001392508.1|1141317_1142052_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	6.1e-130
WP_000638634.1|1142048_1142549_+	transactivation protein	NA	NA	NA	NA	NA
WP_024238667.1|1142622_1143195_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	4.2e-94
WP_024238668.1|1143484_1144384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024238669.1|1144383_1145043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000124709.1|1145075_1146269_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	47.6	8.7e-102
1147638:1147651	attR	GGATAAATGATATT	NA	NA	NA	NA
>prophage 3
NZ_CP024127	Escherichia coli strain 14EC001 chromosome, complete genome	5072975	1669501	1776973	5072975	transposase,terminase,holin,integrase,capsid,tail,tRNA,protease,head	Enterobacteria_phage(33.33%)	114	1657383:1657442	1746092:1746859
1657383:1657442	attL	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGC	NA	NA	NA	NA
WP_000569316.1|1669501_1670428_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|1670432_1671164_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1671144_1671252_-	protein YohO	NA	NA	NA	NA	NA
WP_101981514.1|1671311_1671998_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.4	9.5e-101
WP_101981515.1|1672033_1673320_-|integrase	site-specific integrase	integrase	A0A0N7KZF5	Stx2-converting_phage	99.3	5.5e-251
WP_001193437.1|1673353_1673608_-	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_001030159.1|1673626_1673761_-	hypothetical protein	NA	H6WZF8	Escherichia_phage	100.0	2.2e-22
WP_000457735.1|1673764_1674007_-	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	100.0	1.2e-37
WP_000208043.1|1674094_1674598_-	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	43.0	1.0e-56
WP_101981516.1|1674599_1675286_-	ead/Ea22-like family protein	NA	H6WZG2	Escherichia_phage	84.8	3.2e-117
WP_001386642.1|1675602_1675884_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000548517.1|1675894_1676086_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000682305.1|1676058_1676241_-	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	98.3	2.8e-28
WP_101981517.1|1676237_1676918_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.1	1.0e-131
WP_101981518.1|1676914_1677700_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.2	2.0e-147
WP_000995439.1|1677705_1678002_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_001484321.1|1678077_1678221_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	95.7	1.8e-17
WP_001198861.1|1678189_1678354_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065357.1|1678426_1678795_-	DUF2528 family protein	NA	K7PGR6	Enterobacteria_phage	99.2	2.6e-65
WP_000167599.1|1678945_1679416_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	8.2e-88
WP_085947970.1|1679547_1680760_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_000198436.1|1681175_1681559_-	hypothetical protein	NA	G9L671	Escherichia_phage	99.2	6.7e-64
WP_001278658.1|1682065_1682686_-	hypothetical protein	NA	A4KWT4	Enterobacteria_phage	99.0	6.9e-50
WP_101981519.1|1682682_1683117_-	hypothetical protein	NA	A4KWT5	Enterobacteria_phage	99.3	3.5e-77
WP_000885926.1|1683187_1683529_-	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	99.1	2.5e-62
WP_000428098.1|1683589_1684294_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	1.1e-133
WP_000064148.1|1684407_1684641_+	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	100.0	8.0e-36
WP_024216147.1|1684779_1685076_+	regulatory protein	NA	G9L678	Escherichia_phage	99.0	1.2e-47
WP_000185454.1|1685108_1686047_+	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	100.0	1.3e-172
WP_101981520.1|1686043_1686745_+	Replication protein P	NA	Q6H9X6	Enterobacteria_phage	99.1	4.9e-129
WP_000145908.1|1686741_1687032_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	100.0	5.7e-47
WP_001000130.1|1687102_1687381_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|1687513_1687729_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001281772.1|1687739_1687976_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_024216032.1|1687932_1688379_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	98.6	1.2e-80
WP_000153288.1|1688375_1688903_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	100.0	7.3e-101
WP_001254221.1|1688899_1689082_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	98.3	1.3e-28
WP_032355379.1|1689585_1691358_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.3	0.0e+00
WP_001108084.1|1691921_1692488_+	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_024216034.1|1692462_1693065_+	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	3.9e-90
WP_001028858.1|1693061_1693733_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_000512807.1|1693723_1694212_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_024216035.1|1694853_1695282_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.1	6.4e-63
WP_157744807.1|1695631_1695775_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	92.1	4.0e-14
WP_024216036.1|1695760_1697611_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
WP_000411813.1|1697903_1698110_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	1.2e-30
WP_024216148.1|1698114_1698459_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	97.4	2.1e-56
WP_025380493.1|1698509_1699043_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	1.3e-100
WP_000661712.1|1699316_1700012_+	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_001280923.1|1700106_1700238_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_012816791.1|1700460_1700646_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000828070.1|1701046_1701373_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000095732.1|1701504_1701705_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	95.5	3.7e-29
WP_025380422.1|1701746_1702112_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	5.8e-65
WP_000958392.1|1702401_1702965_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	93.5	3.6e-82
WP_097562302.1|1702961_1704623_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	98.9	0.0e+00
WP_101981521.1|1704686_1706624_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001063027.1|1706668_1706890_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	98.6	9.9e-36
WP_000125968.1|1709416_1709743_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	98.1	2.7e-53
WP_001007905.1|1709752_1710103_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1710099_1710546_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1710542_1710887_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_021497599.1|1710945_1711662_+|tail	phage major tail 2 family protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.9	2.3e-126
WP_001030063.1|1711667_1712042_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1712137_1712347_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_047086143.1|1715632_1715974_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	99.1	2.5e-62
WP_101981522.1|1715973_1716672_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	98.3	8.1e-132
WP_101981523.1|1716682_1717426_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	1.7e-148
WP_158296939.1|1717371_1718004_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.3	5.5e-103
WP_101981525.1|1718253_1721733_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	87.8	0.0e+00
WP_001230489.1|1721800_1722400_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	9.7e-110
WP_101981526.1|1722464_1723778_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.2	1.9e-81
WP_033803510.1|1723779_1724049_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	2.7e-43
WP_033803505.1|1725041_1726283_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.2	7.7e-218
WP_024184430.1|1726934_1728143_-	hypothetical protein	NA	H6WZN3	Escherichia_phage	99.5	1.0e-230
WP_001261971.1|1728347_1728596_-	DinI-like family protein	NA	H6WZN4	Escherichia_phage	100.0	2.4e-38
WP_001295431.1|1729110_1730796_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1730792_1731512_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1731558_1732029_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001373589.1|1732069_1732531_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
WP_001423058.1|1732655_1734656_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001333512.1|1734652_1735789_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
WP_001294387.1|1735781_1738061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001300974.1|1738071_1739160_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_023281358.1|1739466_1739784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097561991.1|1739844_1743477_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001338997.1|1748198_1750232_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.8	1.0e-54
1746092:1746859	attR	GCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACCAGGGCATTCCATGCTTTTACTGCTTTCTCCAGCGGCAATGTTGTCAAAATCCCCAACTGCCAATAATGCCCGGTAGGTGAATGAAACACCTTAAATTCACTTAGTAAGGTTGAATAATCTTCATTTAGCCATGCCTCAACTACCGCTTCGGGAGCTTTAATATATGTACCAGCGATCCGTCGTTGAAAACCCATCCTTGCCAACAGGTTGGTAGTACTTTCTTCATGGCTAACCGTGATGTGTTTTGAATACCAGATATATTTCGCCAAAAGTTGATTACTGATTTCTTCTGTCAGATAACAGATTGGCTCAATGCCTAATGGCGCTAAATCCAGCACCGGAATCGGCGATTTTTTCTTTTTCGAAAGCCAGGGAGGGGAGACTACTACGGCTGGCAGTAGATCGGCGCTGGCATGGTTTGAGGGCTGTGTCAGTTGTTGCTGGCATGATTTCAGTACGGCAACTGCGGGTGTCGAGAGCCAGGGAATGACCTGTTCTGCCAGTGCTGGTTGTGAGATAAGCATTGTCATTAGCATAATGCGCCAACTGTTCTCTTCTTTTTGCCCAAGAAGTTCCGTCAGTGCCGCCATTGCTGCATGTGGGAACGCAGCAATGGCTTTCGTCATCCGATCGTGACAGCGTTTAGTTTGCCCGGCTACACGTATAAGCAGTGTCAATGCGAACGGATGATTGATATGACGCAACACA	NA	NA	NA	NA
WP_001005448.1|1750363_1751473_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001324851.1|1751735_1752017_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830456.1|1752309_1752852_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677393.1|1752931_1753606_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945454.1|1753621_1756102_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_053270427.1|1756117_1757152_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|1757233_1757572_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_001614687.1|1757790_1758615_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1758735_1759008_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195564.1|1759230_1760019_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822274.1|1760015_1760816_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001351783.1|1760880_1761699_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
WP_000434032.1|1761750_1762497_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011976.1|1762470_1763436_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846217.1|1763432_1764437_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000858500.1|1764433_1765711_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1765967_1767020_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000289788.1|1767329_1768184_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_101981527.1|1768212_1769475_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|1769484_1769937_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823270.1|1769967_1770252_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_101981528.1|1770255_1771611_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000844220.1|1771658_1772699_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178552.1|1772798_1773578_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1773659_1774559_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001318299.1|1774963_1775281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476014.1|1775611_1776973_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
>prophage 4
NZ_CP024127	Escherichia coli strain 14EC001 chromosome, complete genome	5072975	1826648	1836994	5072975	transposase	Enterobacteria_phage(33.33%)	10	NA	NA
WP_001116037.1|1826648_1828043_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.3	1.7e-19
WP_000183073.1|1828217_1829111_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000699442.1|1829483_1830569_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	3.6e-102
WP_001023635.1|1830568_1831468_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.3	6.3e-28
WP_000857543.1|1831525_1832404_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.7	2.8e-105
WP_001100786.1|1832408_1832957_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.5	4.2e-51
WP_000095687.1|1832963_1834037_+	hypothetical protein	NA	A0A1V0SDW6	Indivirus	25.8	7.8e-25
WP_000240349.1|1834029_1834761_+	CatB-related O-acetyltransferase	NA	M1HJ62	Paramecium_bursaria_Chlorella_virus	35.1	1.7e-07
WP_000595974.1|1834753_1836241_+	O115 family O-antigen flippase	NA	NA	NA	NA	NA
WP_085949082.1|1836300_1836994_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	88.3	1.3e-121
>prophage 5
NZ_CP024127	Escherichia coli strain 14EC001 chromosome, complete genome	5072975	1890081	1975608	5072975	portal,transposase,terminase,integrase,capsid,tail,holin,head	Enterobacteria_phage(41.46%)	66	1892645:1892663	1960380:1960398
WP_001373172.1|1890081_1891233_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.4	2.0e-42
WP_085947970.1|1891802_1893015_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
1892645:1892663	attL	GTGCTGGATGCACTGGAGC	NA	NA	NA	NA
WP_000973198.1|1893911_1894457_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001326708.1|1894453_1895197_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_101981535.1|1895208_1896288_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986331.1|1896349_1897285_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011483.1|1897742_1898660_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011017.1|1898761_1899712_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122452224.1|1899829_1901473_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532912.1|1902101_1902818_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060232.1|1903160_1904615_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378563.1|1904716_1906033_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480495.1|1906347_1907400_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_001360219.1|1907527_1908004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158296933.1|1908016_1909486_-	adhesin	NA	NA	NA	NA	NA
WP_000039786.1|1909618_1910368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000784549.1|1911018_1913040_-	siderophore yersiniabactin receptor FyuA	NA	NA	NA	NA	NA
WP_001088813.1|1913171_1914749_-	yersiniabactin biosynthesis salycil-AMP ligase YbtE	NA	NA	NA	NA	NA
WP_000194281.1|1914752_1915556_-	yersiniabactin biosynthesis thioesterase YbtT	NA	NA	NA	NA	NA
WP_000982861.1|1915552_1916653_-	yersiniabactin biosynthesis oxidoreductase YbtU	NA	NA	NA	NA	NA
WP_097562110.1|1916649_1926141_-	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
WP_024239418.1|1926228_1932336_-	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	1.8e-33
WP_000140405.1|1932526_1933486_-	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_000098396.1|1933652_1935455_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.6	8.5e-32
WP_001304269.1|1935441_1937244_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
WP_001286281.1|1937236_1938517_+	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_000703040.1|1938544_1939849_+	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_024165620.1|1940042_1941305_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.0	3.1e-73
WP_001325918.1|1941642_1942440_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533619.1|1942675_1943701_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.0e-102
WP_101981694.1|1944547_1944694_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	73.2	3.3e-11
WP_001344632.1|1945290_1945422_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_101981537.1|1945864_1947715_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_000411804.1|1948162_1948369_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
WP_000138558.1|1948624_1948897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|1949056_1949590_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|1949810_1949924_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|1950145_1950331_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|1950858_1951173_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|1951254_1951479_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_000235436.1|1951881_1952391_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_101981539.1|1952362_1954291_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	2.3e-261
WP_000259002.1|1954274_1954481_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_101981540.1|1954477_1956070_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	7.1e-184
WP_001253987.1|1956059_1957565_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.6e-100
WP_000256723.1|1957601_1957949_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_000522615.1|1958006_1959035_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.7	3.9e-114
WP_000201525.1|1959086_1959461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204547.1|1959453_1959807_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000975046.1|1959822_1960356_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	2.2e-57
WP_000683066.1|1960352_1960748_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	3.9e-59
1960380:1960398	attR	GTGCTGGATGCACTGGAGC	NA	NA	NA	NA
WP_000106784.1|1960755_1961508_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.6	2.7e-133
WP_000479116.1|1961521_1961953_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_101981541.1|1961979_1962393_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	7.8e-42
WP_097562279.1|1962373_1964953_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.7	0.0e+00
WP_000847304.1|1964949_1965279_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_001299882.1|1965278_1965977_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	2.1e-132
WP_101981542.1|1965982_1966726_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	1.3e-148
WP_136148694.1|1966671_1967304_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.8	1.7e-104
WP_000649825.1|1967494_1968022_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	61.0	2.1e-60
WP_101981543.1|1968155_1971632_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	96.9	0.0e+00
WP_001360257.1|1971700_1972324_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.4	1.7e-69
WP_000268803.1|1972388_1973702_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.3	1.2e-75
WP_001101707.1|1973703_1973973_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	97.8	9.3e-44
WP_000950813.1|1974149_1975130_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_095111390.1|1975476_1975608_+	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	76.5	1.5e-07
>prophage 6
NZ_CP024127	Escherichia coli strain 14EC001 chromosome, complete genome	5072975	2027846	2063174	5072975	portal,plate,terminase,integrase,capsid,tail,holin,head	Enterobacteria_phage(86.11%)	43	2026778:2026837	2063281:2063404
2026778:2026837	attL	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGA	NA	NA	NA	NA
WP_000078920.1|2027846_2027987_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_000488113.1|2028177_2028438_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_050571963.1|2028705_2030145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132840.1|2030275_2031385_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	8.2e-195
WP_000005431.1|2031542_2032727_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	8.1e-225
WP_000290450.1|2032726_2033239_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665308.1|2033293_2033659_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000763327.1|2033694_2033823_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_101981545.1|2033809_2036617_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	95.0	0.0e+00
WP_122990803.1|2036629_2037118_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.1	6.1e-86
WP_021549126.1|2037159_2037693_-|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.6	6.3e-68
WP_101981546.1|2037695_2040155_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	57.1	1.8e-173
WP_001443704.1|2040157_2040688_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	9.6e-93
WP_001111943.1|2040680_2041577_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.3	2.3e-155
WP_000213447.1|2041580_2041931_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001545559.1|2041927_2042509_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.4	8.0e-101
WP_089571275.1|2042505_2043141_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	98.6	3.4e-113
WP_000920586.1|2043133_2043601_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	4.5e-86
WP_000780560.1|2043738_2044146_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	4.2e-64
WP_001545557.1|2044142_2044535_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	1.3e-70
WP_001757528.1|2044531_2044855_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	98.1	4.7e-50
WP_000864901.1|2044857_2045058_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063096.1|2045057_2045552_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.2	3.0e-88
WP_001545556.1|2045653_2046454_-|terminase	phage small terminase subunit	terminase	A0A0A7NPX9	Enterobacteria_phage	88.3	1.9e-124
WP_001055089.1|2046499_2047552_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.1	6.6e-194
WP_001262655.1|2047575_2048412_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
WP_000613782.1|2048566_2050318_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_001545555.1|2050317_2051364_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.6e-206
WP_001545554.1|2051857_2054083_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_000502619.1|2054106_2055228_-	ATP-binding protein	NA	R4TQL5	Phaeocystis_globosa_virus	29.5	3.7e-17
WP_089571244.1|2055408_2058192_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	86.6	0.0e+00
WP_000564235.1|2058188_2058578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000985152.1|2058901_2059105_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	9.5e-25
WP_000021671.1|2059192_2059306_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	2.4e-09
WP_000514284.1|2059302_2059545_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	5.2e-38
WP_000158977.1|2059556_2059835_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	81.5	1.6e-35
WP_000716033.1|2059845_2060196_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	80.2	2.1e-48
WP_000014504.1|2060217_2060421_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2060492_2060630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001613279.1|2060719_2061124_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	9.4e-24
WP_000290343.1|2061139_2061790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865205.1|2061819_2062167_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2062172_2063174_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2063281:2063404	attR	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTTTGT	NA	NA	NA	NA
>prophage 7
NZ_CP024127	Escherichia coli strain 14EC001 chromosome, complete genome	5072975	2340861	2489342	5072975	portal,terminase,transposase,holin,integrase,capsid,tail,tRNA,protease,head	Escherichia_phage(26.03%)	159	2365465:2365524	2450246:2450262
WP_001295400.1|2340861_2342136_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
WP_024239621.1|2342197_2343058_+	pyridoxal kinase	NA	NA	NA	NA	NA
WP_000765749.1|2343101_2343707_-	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_000100932.1|2343812_2345315_-	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_001030339.1|2345925_2346561_-	endonuclease III	NA	NA	NA	NA	NA
WP_001289652.1|2346560_2347256_-	electron transport complex subunit E	NA	NA	NA	NA	NA
WP_000920802.1|2347259_2347880_-	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_000231922.1|2347883_2348942_-	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_000915767.1|2348942_2351165_-	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_000991805.1|2351157_2351736_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_000133193.1|2351735_2352317_-	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_000214176.1|2352393_2352834_-	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000217950.1|2352919_2353135_-	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_001300888.1|2353407_2353533_-	division septum protein Blr	NA	NA	NA	NA	NA
WP_000567490.1|2354848_2355850_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_000459379.1|2355953_2357126_-	bifunctional maltose regulon transcriptional repressor/cystathionine beta-lyase MalY	NA	NA	NA	NA	NA
WP_000125583.1|2357135_2358728_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_101981555.1|2358902_2359931_+	Mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_000483353.1|2360042_2360810_+	7-alpha-hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
WP_000969092.1|2361030_2361621_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000945878.1|2362011_2363823_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	100.0	0.0e+00
WP_001075863.1|2363819_2365193_+	glucuronide transporter	NA	NA	NA	NA	NA
2365465:2365524	attL	AGGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGT	NA	NA	NA	NA
WP_001043339.1|2367499_2369008_-	YdgA family protein	NA	NA	NA	NA	NA
2365465:2365524	attL	AGGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGT	NA	NA	NA	NA
WP_001170664.1|2369108_2370284_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000066639.1|2370482_2372129_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_101981557.1|2372271_2373675_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_001295399.1|2373671_2374601_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_000732510.1|2374676_2375978_-	two-component system sensor histidine kinase RstB	NA	NA	NA	NA	NA
WP_001092508.1|2375981_2376701_-	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000524868.1|2376829_2377165_+	GlpM family protein	NA	NA	NA	NA	NA
WP_000520804.1|2377161_2377884_-	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_000412379.1|2377920_2379303_-	amino acid permease	NA	NA	NA	NA	NA
WP_000769337.1|2379488_2380433_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001300486.1|2380956_2382489_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000014036.1|2382499_2383888_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_052924701.1|2384994_2386224_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.6	3.2e-131
WP_000953272.1|2386598_2386787_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_052924700.1|2386844_2387636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000226782.1|2387661_2387859_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|2387851_2388064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551672.1|2388053_2388293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204078.1|2388285_2388519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052924699.1|2388511_2388745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|2388750_2389050_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833618.1|2389046_2390447_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	9.6e-116
WP_000192401.1|2390647_2390899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052924698.1|2390895_2391306_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|2391316_2391589_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132080.1|2391715_2391940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039060865.1|2392232_2393390_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.1e-137
WP_000504050.1|2393429_2394002_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.2e-61
WP_001398592.1|2394039_2395215_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	80.2	4.8e-185
WP_101981558.1|2396023_2396326_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	56.4	2.7e-28
2395261:2396029	attR	AGGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTCATGCAGCTCCACCGATTTTGAGAACGACAGCGACTTCCGTCCCAGCCGTGCCAGGTGCTGCCTCAGATTCAGGTTATGCCGCTCAATTCGCTGCGTATATCGCTTGCTGATTACGTGCAGCTTTCCCTTCAGGCGGGATTCATACAGCGGCCAGCCATCCGTCATCCATATCACCACGTCAAAGGGTGACAGCAGGCTCATAAGACGCCCCAGCGTCGCCATAGTGCGTTCACCGAATACGTGCGCAACAACCGTCTTCCGGAGACTGTCATACGCGTAAAACAGCCAGCGCTGGCGCGATTTAGCCCCGACATAGCCCCACTGTTCGTCCATTTCCGCGCAGACGATGACGTCACTGCCCGGCTGTATGCGCGAGGTTACCGACTGCGGCCTGAGTTTTTTAAGTGACGTAAAATCGTGTTGAGGCCAACGCCCATAATGCGGGCAGTTGCCCGGCATCCAACGCCATTCATGGCCATATCAATGATTTTCTGGTGCGTACCGGGTTGAGAAGCGGTGTAAGTGAACTGCAGTTGCCATGTTTTACGGCAGTGAGAGCAGAGATAGCGCTGATGTCCGGCGGTGCTTTTGCCGTTACGCACCACCCCGTCAGTAGCTGAACAGGAGGGACAGCTGATAGAAACAGAAGCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACC	NA	NA	NA	NA
WP_000134114.1|2396322_2396619_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	2.4e-32
2395261:2396029	attR	AGGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTCATGCAGCTCCACCGATTTTGAGAACGACAGCGACTTCCGTCCCAGCCGTGCCAGGTGCTGCCTCAGATTCAGGTTATGCCGCTCAATTCGCTGCGTATATCGCTTGCTGATTACGTGCAGCTTTCCCTTCAGGCGGGATTCATACAGCGGCCAGCCATCCGTCATCCATATCACCACGTCAAAGGGTGACAGCAGGCTCATAAGACGCCCCAGCGTCGCCATAGTGCGTTCACCGAATACGTGCGCAACAACCGTCTTCCGGAGACTGTCATACGCGTAAAACAGCCAGCGCTGGCGCGATTTAGCCCCGACATAGCCCCACTGTTCGTCCATTTCCGCGCAGACGATGACGTCACTGCCCGGCTGTATGCGCGAGGTTACCGACTGCGGCCTGAGTTTTTTAAGTGACGTAAAATCGTGTTGAGGCCAACGCCCATAATGCGGGCAGTTGCCCGGCATCCAACGCCATTCATGGCCATATCAATGATTTTCTGGTGCGTACCGGGTTGAGAAGCGGTGTAAGTGAACTGCAGTTGCCATGTTTTACGGCAGTGAGAGCAGAGATAGCGCTGATGTCCGGCGGTGCTTTTGCCGTTACGCACCACCCCGTCAGTAGCTGAACAGGAGGGACAGCTGATAGAAACAGAAGCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACC	NA	NA	NA	NA
WP_101981559.1|2396618_2397059_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	1.8e-60
WP_000113645.1|2397347_2397704_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_101981560.1|2397687_2399349_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	2.0e-277
WP_000133423.1|2399362_2399644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303517.1|2400641_2400812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000276149.1|2400918_2401284_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_000046661.1|2401270_2401600_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_001260865.1|2401638_2402460_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2402559_2402643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032255134.1|2402735_2403059_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|2403455_2404709_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019525.1|2404815_2405709_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225262.1|2405843_2407064_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2407188_2407884_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|2407836_2409129_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2409287_2409902_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_023281261.1|2409944_2410799_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2410800_2411418_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_072131186.1|2411428_2413852_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.5	4.8e-208
WP_101981561.1|2413912_2416339_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	1.0e-213
WP_001300836.1|2416537_2416843_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_101981696.1|2416950_2417631_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2417663_2418224_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2418258_2418600_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2418734_2419061_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2419266_2420481_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_023281252.1|2420492_2421512_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	3.7e-16
WP_072095801.1|2421569_2421680_+	transporter	NA	NA	NA	NA	NA
WP_001206148.1|2421699_2422995_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
WP_001473551.1|2423014_2423251_-	excisionase family protein	NA	S4TND0	Salmonella_phage	49.3	5.1e-14
WP_001473550.1|2423335_2425810_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.0	1.9e-58
WP_001098307.1|2425903_2426095_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_045907303.1|2426091_2426280_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_122994137.1|2426679_2426844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171921.1|2426847_2427066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024182289.1|2427158_2427359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000362155.1|2427763_2428183_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391950.1|2428283_2428565_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000693832.1|2428548_2428974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097562317.1|2429045_2430116_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	66.2	1.3e-64
WP_097562316.1|2430122_2430863_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.7	9.2e-126
WP_101981562.1|2430888_2431659_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.6	4.8e-85
WP_001118161.1|2431674_2432070_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_000206794.1|2432126_2432711_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	83.5	5.5e-33
WP_001278450.1|2432826_2432931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2433119_2433332_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_097562314.1|2433499_2433778_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_097562313.1|2433779_2434838_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.7	3.7e-88
WP_101981563.1|2434838_2435177_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.9	1.9e-30
WP_000640033.1|2435211_2435766_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	8.0e-66
WP_000917737.1|2435990_2436188_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_101981564.1|2436322_2437036_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000466957.1|2437486_2437918_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_101981565.1|2438481_2440335_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_001299338.1|2440484_2440700_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	5.9e-33
WP_000731237.1|2440704_2441049_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	2.9e-58
WP_096954684.1|2441099_2441633_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	8.1e-100
WP_001056883.1|2441907_2442477_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	99.5	1.5e-104
WP_000455406.1|2442476_2442626_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_012816791.1|2442853_2443039_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|2443566_2443881_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_071961468.1|2443962_2444187_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	3.8e-19
WP_001303046.1|2444228_2444594_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958380.1|2444884_2445448_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_101981566.1|2445444_2447106_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.3	0.0e+00
WP_101981521.1|2447169_2449107_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001063027.1|2449151_2449373_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	98.6	9.9e-36
WP_000125968.1|2451897_2452224_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	98.1	2.7e-53
WP_001007905.1|2452233_2452584_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2452580_2453027_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2453023_2453368_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_021497599.1|2453426_2454143_+|tail	phage major tail 2 family protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.9	2.3e-126
WP_001030063.1|2454148_2454523_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2454618_2454828_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_101981567.1|2454879_2458122_+|tail	phage tail tape measure protein	tail	H6WZM1	Escherichia_phage	97.7	0.0e+00
WP_047086143.1|2458114_2458456_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	99.1	2.5e-62
WP_101981522.1|2458455_2459154_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	98.3	8.1e-132
WP_101981523.1|2459164_2459908_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	1.7e-148
WP_158296940.1|2459853_2460486_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.3	1.4e-103
WP_101981569.1|2460724_2464201_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.8	0.0e+00
WP_024216123.1|2464267_2464867_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	7.5e-110
WP_101981570.1|2464931_2466245_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	2.8e-77
WP_001023357.1|2466246_2466516_+|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	100.0	3.8e-45
WP_024216127.1|2466656_2467532_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	98.6	1.4e-160
WP_024216126.1|2467756_2468407_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	98.6	7.8e-121
WP_101981697.1|2469001_2469316_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	81.9	7.0e-27
WP_000347482.1|2469375_2470659_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_023281233.1|2470747_2472208_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.2	1.5e-42
WP_000214712.1|2472243_2472447_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000215549.1|2472623_2473310_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000636568.1|2473398_2474145_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_040061957.1|2474281_2476327_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_001024746.1|2476370_2476889_-	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_000671731.1|2477164_2477557_+	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_000901367.1|2479698_2479794_-	protein MgtS	NA	NA	NA	NA	NA
WP_001054207.1|2479920_2481108_-	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000087214.1|2481302_2482202_+	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_000803659.1|2482232_2482451_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091199.1|2482482_2482866_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000843414.1|2482885_2483320_-	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000885033.1|2483531_2484197_+	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000210799.1|2484221_2485412_-	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_032161825.1|2485561_2486677_-	putative protein YneK	NA	NA	NA	NA	NA
WP_101981571.1|2486754_2487636_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067858.1|2488637_2489342_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 8
NZ_CP024127	Escherichia coli strain 14EC001 chromosome, complete genome	5072975	2855527	2914261	5072975	terminase,integrase,capsid,tail,tRNA,holin,lysis,head	Stx2-converting_phage(24.0%)	68	2863818:2863832	2914363:2914377
WP_001297484.1|2855527_2856634_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|2856669_2857311_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423742.1|2857314_2858685_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001265481.1|2858852_2859524_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735411.1|2859523_2860984_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001295435.1|2861059_2862181_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359447.1|2862326_2863556_-	peptidase T	NA	NA	NA	NA	NA
WP_000531601.1|2863805_2864942_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
2863818:2863832	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799399.1|2864925_2865789_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_032169753.1|2865953_2866283_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_097562161.1|2866428_2867037_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	43.6	2.9e-37
WP_101981699.1|2867044_2868328_-|tail	phage tail protein	tail	Q9LA62	Enterobacterial_phage	67.9	6.4e-34
WP_097562160.1|2868392_2868992_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	85.9	1.4e-95
WP_101981586.1|2869059_2872446_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	86.2	0.0e+00
WP_072162848.1|2872686_2873319_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	5.5e-103
WP_101981587.1|2873264_2874008_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	4.5e-149
WP_032202872.1|2874018_2874717_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	98.3	1.4e-131
WP_000343411.1|2874716_2875058_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	82.3	6.9e-52
WP_101981588.1|2875050_2878293_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	88.1	0.0e+00
WP_001513217.1|2878340_2878550_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000710952.1|2878645_2879020_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|2879034_2879751_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_032253708.1|2879811_2880156_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	89.5	3.4e-51
WP_101981589.1|2880152_2880599_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	4.4e-75
WP_101981590.1|2880595_2880946_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	98.3	5.0e-58
WP_032253705.1|2880955_2881282_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	99.1	2.7e-53
WP_050923697.1|2883646_2883868_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	93.2	2.1e-33
WP_032253699.1|2883912_2885850_-|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.2	0.0e+00
WP_101981591.1|2885913_2887575_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	98.9	0.0e+00
WP_101981592.1|2887571_2888135_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	93.0	1.2e-80
WP_000829194.1|2888424_2888790_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	94.2	8.7e-61
WP_000095741.1|2888831_2889032_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000828068.1|2889163_2889490_-	TonB family protein	NA	H6WZK5	Escherichia_phage	99.1	1.5e-56
WP_101981593.1|2889833_2890058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153060551.1|2890143_2890329_-	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	95.1	3.9e-17
WP_001280922.1|2890551_2890683_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	90.7	8.5e-11
WP_000661714.1|2890777_2891473_-	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	98.7	1.4e-123
WP_000992078.1|2891746_2892280_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	94.9	9.0e-99
WP_096973148.1|2892330_2892675_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	94.7	2.3e-55
WP_000284506.1|2892678_2892894_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_032253529.1|2892969_2893239_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	70.8	8.5e-05
WP_032253528.1|2893276_2893459_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	84.7	1.7e-20
WP_101981594.1|2893593_2895546_-	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	69.8	5.5e-263
WP_032253524.1|2896341_2897400_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	88.2	6.9e-183
WP_000917767.1|2897550_2897748_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_032253523.1|2897990_2898521_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	71.4	1.0e-70
WP_000904118.1|2898529_2898889_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	1.6e-35
WP_101981595.1|2898901_2899951_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	1.4e-108
WP_122985640.1|2900175_2900289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032253521.1|2900333_2901437_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_032253520.1|2901417_2902068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032152334.1|2902233_2902446_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	3.6e-27
WP_044721546.1|2903093_2903867_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000124819.1|2904232_2904649_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	86.1	2.1e-58
WP_062883710.1|2904664_2905378_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	61.7	4.9e-76
WP_050923779.1|2905400_2906153_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	79.8	2.6e-107
WP_062883709.1|2906159_2907113_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	52.6	1.1e-73
WP_050923775.1|2907134_2907560_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_101962177.1|2907556_2907787_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	53.8	2.9e-06
WP_050923774.1|2907878_2908517_+	LexA family transcriptional regulator	NA	H9C160	Pectobacterium_phage	26.7	3.3e-15
WP_000379588.1|2908800_2908956_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	6.8e-07
WP_001171952.1|2909115_2909334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001299931.1|2909337_2909502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|2909901_2910090_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_024218353.1|2910086_2910278_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_101981596.1|2910371_2912843_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_000003742.1|2912904_2913174_+	excisionase	NA	NA	NA	NA	NA
WP_000074983.1|2913142_2914261_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
2914363:2914377	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 9
NZ_CP024127	Escherichia coli strain 14EC001 chromosome, complete genome	5072975	3162391	3287975	5072975	portal,plate,terminase,holin,integrase,capsid,tail,tRNA,protease,lysis,head	Escherichia_phage(36.67%)	113	3174330:3174350	3274650:3274670
WP_000156518.1|3162391_3164152_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227927.1|3164220_3164739_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000828648.1|3164808_3164976_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759118.1|3165231_3165795_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_024238688.1|3165791_3167432_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333176.1|3167436_3168690_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_024238689.1|3168819_3170727_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.4e-53
WP_001086539.1|3170738_3172847_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000212426.1|3173090_3174200_+	6-N-hydroxylaminopurine resistance protein YcbX	NA	NA	NA	NA	NA
WP_001295353.1|3174196_3174739_-	cell division protein ZapC	NA	NA	NA	NA	NA
3174330:3174350	attL	AGTGCGGCATTTTCGCCAGAT	NA	NA	NA	NA
WP_001295352.1|3174912_3175923_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001307699.1|3176033_3176744_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_000919497.1|3176736_3177252_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_023281170.1|3177259_3177802_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001165668.1|3177813_3178884_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000286333.1|3178874_3181475_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_029798493.1|3181499_3182201_-	molecular chaperone	NA	NA	NA	NA	NA
WP_000750304.1|3182283_3182823_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001263933.1|3183178_3183754_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_023281169.1|3183746_3184706_+	sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000056007.1|3184702_3185848_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_000235203.1|3185858_3186650_+	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_024238694.1|3186646_3187414_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	8.3e-29
WP_023281168.1|3187456_3190069_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	4.1e-19
WP_001307697.1|3190334_3191537_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117881.1|3191705_3193106_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977920.1|3193708_3194797_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_097561943.1|3194981_3196172_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_001109487.1|3196393_3197041_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|3197067_3197616_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_000925985.1|3197796_3199644_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_024238696.1|3199904_3204365_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_001295347.1|3204364_3205069_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288850.1|3205049_3206372_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001298300.1|3206368_3207154_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899600.1|3207289_3208069_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436922.1|3208045_3208939_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_024238697.1|3209092_3209839_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350058.1|3209835_3210018_-	protein YcaR	NA	NA	NA	NA	NA
WP_001752386.1|3210069_3211302_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000570539.1|3211338_3212325_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551270.1|3212321_3214070_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_032234501.1|3214106_3216287_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|3217355_3217640_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|3217799_3219473_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|3219583_3220267_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_001295345.1|3220439_3221204_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000445231.1|3221372_3222656_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057138.1|3222726_3223815_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_000642849.1|3224013_3224706_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_001295344.1|3224835_3226596_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642546.1|3227001_3227859_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292822.1|3227913_3230196_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000468308.1|3230514_3230733_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_101981604.1|3230814_3231978_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	5.4e-205
WP_000978908.1|3231977_3232457_-|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	1.5e-84
WP_101981605.1|3232471_3234919_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	98.7	0.0e+00
WP_072165409.1|3234911_3235067_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	98.0	7.5e-22
WP_001031303.1|3235063_3235339_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|3235395_3235914_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_101981606.1|3235926_3237117_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	2.4e-224
WP_101981607.1|3237240_3237711_-|tail	phage tail protein	tail	A0A0F7LDZ0	Escherichia_phage	42.8	1.2e-22
WP_101981608.1|3237677_3239408_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	64.3	3.1e-84
WP_001285340.1|3239404_3240016_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	100.0	1.7e-117
WP_001121474.1|3240008_3240917_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
WP_000127144.1|3240921_3241269_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	1.1e-57
WP_049039103.1|3241265_3241901_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	1.7e-112
WP_001001786.1|3241967_3242420_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	100.0	8.2e-77
WP_000917180.1|3242412_3242880_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	4.3e-81
WP_001440152.1|3242842_3243016_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_000040652.1|3242987_3243413_-|lysis	LysB family phage lysis regulatory protein	lysis	Q7Y4E2	Escherichia_virus	96.5	1.6e-66
WP_001144101.1|3243761_3244259_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|3244258_3244540_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846399.1|3244543_3244747_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988633.1|3244746_3245256_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_101981609.1|3245355_3246099_-|terminase	terminase endonuclease subunit	terminase	Q94MK1	Enterobacteria_phage	99.2	1.4e-121
WP_101981610.1|3246102_3247176_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	99.2	2.4e-199
WP_001085981.1|3247234_3248089_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0F7LA11	Escherichia_phage	98.6	4.6e-137
WP_000156872.1|3248262_3250035_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_101981611.1|3250034_3251069_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.1	3.2e-201
WP_001547479.1|3251494_3252436_+	hypothetical protein	NA	Q2P9W7	Enterobacteria_phage	81.2	2.7e-146
WP_023136039.1|3252755_3253436_-	hypothetical protein	NA	Q2P9W8	Enterobacteria_phage	99.1	4.6e-124
WP_032152324.1|3253463_3253670_-	DUF2158 domain-containing protein	NA	Q2P9W9	Enterobacteria_phage	100.0	7.3e-33
WP_101981612.1|3253781_3256061_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.4	0.0e+00
WP_000027664.1|3256050_3256326_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113264.1|3256322_3256547_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_085457204.1|3256546_3256849_-	DUF5405 family protein	NA	M1RZ07	Escherichia_phage	97.0	1.6e-44
WP_000557703.1|3256848_3257073_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217671.1|3257136_3257637_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	99.4	1.7e-91
WP_001389237.1|3257814_3258171_-	hypothetical protein	NA	Q1JS28	Enterobacteria_phage	99.2	1.5e-62
WP_001389238.1|3258279_3258579_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	100.0	3.0e-51
WP_000023390.1|3258672_3259668_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	100.0	5.4e-190
WP_000067979.1|3259699_3260497_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_021546843.1|3260578_3261142_-	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
WP_001242678.1|3261267_3262176_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000918506.1|3262176_3263607_-	amino acid permease	NA	NA	NA	NA	NA
WP_000109295.1|3263816_3264965_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165879.1|3265278_3265905_+	hydrolase	NA	NA	NA	NA	NA
WP_000534637.1|3265939_3266803_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_101981613.1|3266804_3267422_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	3.8e-77
WP_000850303.1|3267432_3269877_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000886683.1|3270115_3271408_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|3271498_3272842_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3272852_3273464_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_024239554.1|3273618_3277608_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
3274650:3274670	attR	AGTGCGGCATTTTCGCCAGAT	NA	NA	NA	NA
WP_000228473.1|3277742_3278237_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3278781_3279747_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043577.1|3279869_3281636_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_023281146.1|3281636_3283358_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	3.8e-21
WP_001241678.1|3283399_3284104_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3284388_3284607_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_097562039.1|3285347_3287624_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	2.5e-166
WP_000520781.1|3287654_3287975_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 10
NZ_CP024127	Escherichia coli strain 14EC001 chromosome, complete genome	5072975	3371818	3450161	5072975	portal,transposase,terminase,integrase,capsid,tail,holin,lysis,head	Enterobacteria_phage(32.76%)	91	3379952:3379986	3451595:3451629
WP_001300563.1|3371818_3372931_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000990177.1|3373132_3373810_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000146343.1|3373883_3374150_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000849301.1|3374414_3374675_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001652933.1|3374902_3375988_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000386551.1|3376128_3377091_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001340191.1|3377118_3379269_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
WP_001145127.1|3379388_3379871_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	2.6e-36
3379952:3379986	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000007101.1|3380102_3381467_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_023281135.1|3381695_3382367_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000743444.1|3382369_3383365_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996107.1|3383357_3385094_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000070131.1|3385086_3386220_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_024238542.1|3386230_3387337_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000871982.1|3387298_3387709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001113347.1|3387841_3388603_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000650318.1|3388599_3389841_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_000045450.1|3389840_3390797_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_000446917.1|3390832_3391546_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000373624.1|3391750_3392455_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000852296.1|3392590_3393043_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000598619.1|3393044_3393290_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000080885.1|3393282_3393768_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000084639.1|3393770_3394283_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_001340186.1|3394304_3395294_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_001295302.1|3395690_3396599_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
WP_000042533.1|3396790_3398812_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_101981618.1|3399390_3400068_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000246761.1|3400060_3400816_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000118797.1|3400802_3401957_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000951213.1|3401953_3402994_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_024238544.1|3403080_3404370_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	7.7e-19
WP_000767389.1|3404428_3404905_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_024238546.1|3405408_3406062_+	EspJ family T3SS effector ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_000354291.1|3406074_3406296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001002868.1|3406379_3406760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101981619.1|3406960_3407536_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	77.0	2.3e-76
WP_085947970.1|3407628_3408841_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_021351651.1|3409292_3409664_+	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
WP_000652080.1|3409767_3410616_-	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.5	3.5e-153
WP_000950982.1|3410839_3411721_-	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_001023459.1|3411826_3412096_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_101981620.1|3412097_3413411_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	9.7e-78
WP_001230435.1|3413475_3414075_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	8.2e-109
WP_158296941.1|3417768_3418401_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	90.9	3.5e-102
WP_032284506.1|3418346_3419090_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	1.0e-148
WP_001299882.1|3419095_3419794_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	2.1e-132
WP_000847304.1|3419793_3420123_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_097562279.1|3420119_3422699_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.7	0.0e+00
WP_101981541.1|3422679_3423093_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	7.8e-42
WP_000479116.1|3423119_3423551_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000106784.1|3423564_3424317_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.6	2.7e-133
WP_000683066.1|3424324_3424720_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	3.9e-59
WP_000975046.1|3424716_3425250_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	2.2e-57
WP_001204547.1|3425265_3425619_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201525.1|3425611_3425986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522615.1|3426037_3427066_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.7	3.9e-114
WP_000256723.1|3427123_3427471_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001253987.1|3427507_3429013_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.6e-100
WP_101981540.1|3429002_3430595_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	7.1e-184
WP_000259002.1|3430591_3430798_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_101981539.1|3430781_3432710_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	2.3e-261
WP_000235436.1|3432681_3433191_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001307652.1|3433585_3433780_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000881326.1|3433967_3434585_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_000092318.1|3434734_3435172_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000075132.1|3435168_3435666_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000411802.1|3435665_3435872_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_101981622.1|3436319_3438170_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	96.4	0.0e+00
WP_000499454.1|3438468_3438627_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3438712_3439456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3439640_3440330_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3440344_3440467_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750156.1|3440805_3441768_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_024238680.1|3441975_3442641_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	98.6	4.7e-129
WP_001569612.1|3442637_3443258_-	recombination protein NinG	NA	Q716C3	Shigella_phage	94.2	7.0e-95
WP_000567000.1|3443250_3443421_-	protein ninF	NA	Q716C4	Shigella_phage	98.2	4.6e-25
WP_001254218.1|3443417_3443600_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_032150837.1|3443596_3443986_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	99.2	2.9e-70
WP_085947970.1|3444028_3445242_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_000100845.1|3445473_3446259_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_024228451.1|3446255_3446936_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3446932_3447115_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3447087_3447279_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_077815297.1|3447289_3447571_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	3.6e-46
WP_101981623.1|3447669_3447891_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	93.2	3.5e-33
WP_024238366.1|3447890_3448175_+	ASCH domain-containing protein	NA	A0A1I9LJL9	Stx_converting_phage	91.5	2.6e-44
WP_033863109.1|3448247_3448415_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	7.0e-26
WP_001281774.1|3448443_3448788_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	4.5e-59
WP_001303849.1|3448894_3449113_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_024238367.1|3449090_3450161_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	2.5e-201
3451595:3451629	attR	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
>prophage 11
NZ_CP024127	Escherichia coli strain 14EC001 chromosome, complete genome	5072975	3644428	3749219	5072975	portal,transposase,terminase,holin,capsid,tail,tRNA,protease,lysis,head	Enterobacteria_phage(58.97%)	91	NA	NA
WP_001383852.1|3644428_3645559_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000956455.1|3645635_3645788_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001130654.1|3646240_3647359_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000682514.1|3647424_3647673_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_000360951.1|3647737_3648106_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000351464.1|3648199_3648853_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_001153148.1|3648960_3650208_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_023281111.1|3650275_3651652_-	phenylalanine transporter	NA	NA	NA	NA	NA
WP_101981631.1|3651753_3654897_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.0	8.3e-59
WP_000717153.1|3654908_3656132_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_101981632.1|3656909_3657257_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000074234.1|3657414_3658788_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000770953.1|3658944_3659628_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_101981633.1|3659617_3661066_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_032261474.1|3661802_3663704_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.7	2.3e-27
WP_001160804.1|3663731_3664193_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_101981634.1|3664212_3668730_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	31.0	9.2e-19
WP_000889443.1|3668762_3669023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300892.1|3669148_3669310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052916495.1|3671050_3672187_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383946.1|3672457_3674695_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_101981635.1|3674681_3677654_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224575.1|3677654_3678545_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_023281043.1|3678727_3679489_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
WP_001201822.1|3680001_3680955_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226376.1|3681141_3682626_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_097562249.1|3682809_3683115_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	74.5	1.8e-11
WP_000239881.1|3683171_3683840_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_101981636.1|3683894_3684479_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.3	2.8e-101
WP_101981637.1|3684478_3687829_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_097562251.1|3687893_3688493_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q6H9T1	Enterobacteria_phage	98.5	2.8e-109
WP_101981638.1|3688559_3691958_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.2	0.0e+00
WP_000090895.1|3692018_3692651_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	89.5	5.5e-95
WP_053890196.1|3692587_3693331_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_001152639.1|3693336_3694035_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000847379.1|3694034_3694364_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_101981639.1|3694360_3696940_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.4	0.0e+00
WP_021514939.1|3696932_3697367_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	4.5e-64
WP_000479142.1|3697348_3697771_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.1e-70
WP_158296935.1|3699069_3699303_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-39
WP_000683105.1|3699310_3699706_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_097512389.1|3699702_3700281_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	2.5e-78
WP_021514936.1|3700292_3700646_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	7.6e-62
WP_000158862.1|3700657_3701056_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	83.3	1.2e-50
WP_097562256.1|3701097_3702123_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	9.6e-190
WP_097562255.1|3702178_3702511_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	1.9e-54
WP_097562254.1|3702520_3703840_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	98.9	1.3e-234
WP_072841936.1|3703820_3705422_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.2e-308
WP_000198149.1|3705418_3705625_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_101981640.1|3705621_3707547_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453587.1|3707521_3708067_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_000881608.1|3708631_3708814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|3709020_3709347_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000738425.1|3709827_3710121_+	increased serum survival lipoprotein Iss	NA	C6ZCX3	Enterobacteria_phage	91.8	1.6e-44
WP_001228695.1|3710211_3710394_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000992107.1|3710610_3711144_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	95.5	1.1e-99
WP_000370549.1|3711249_3711522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000250557.1|3711487_3711832_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	90.5	3.5e-35
WP_000284486.1|3711836_3712052_-|holin	holin	holin	M1FN85	Enterobacteria_phage	95.8	1.0e-32
WP_000502162.1|3712074_3712266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000972071.1|3712593_3712788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947970.1|3714046_3715259_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_000805422.1|3715909_3716542_+	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_001255229.1|3716544_3717060_-	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000988364.1|3718907_3719600_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000776555.1|3719819_3720362_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729160.1|3720832_3721699_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|3721700_3721913_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143558.1|3722020_3722542_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|3722577_3723963_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_000255997.1|3724136_3724631_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000212253.1|3724633_3725356_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_024238855.1|3725473_3725983_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000815566.1|3725979_3727047_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000855384.1|3727241_3728135_-	carbamate kinase	NA	NA	NA	NA	NA
WP_023281039.1|3728131_3728947_-	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000495365.1|3728957_3730217_-	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000580893.1|3730226_3731894_-	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000703889.1|3732210_3733260_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_001459527.1|3733281_3734517_+	allantoate deiminase	NA	NA	NA	NA	NA
WP_001333621.1|3736317_3737463_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_001302767.1|3737484_3738786_-	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_000006900.1|3738842_3740204_-	allantoinase AllB	NA	NA	NA	NA	NA
WP_000401100.1|3740263_3741718_-	putative allantoin permease	NA	NA	NA	NA	NA
WP_000765839.1|3741886_3742765_-	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000943544.1|3742864_3743641_-	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_001096881.1|3743653_3745435_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000141275.1|3745524_3746340_-	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_000776388.1|3746417_3746900_-	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_097562295.1|3747129_3748056_+	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_001157934.1|3748124_3749219_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
>prophage 12
NZ_CP024127	Escherichia coli strain 14EC001 chromosome, complete genome	5072975	3945526	4042344	5072975	portal,plate,transposase,terminase,capsid,tail,holin,protease,lysis,head	Shigella_phage(39.13%)	91	NA	NA
WP_000131044.1|3945526_3947560_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|3947688_3948276_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|3948289_3949762_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159095.1|3949775_3951446_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|3951658_3952327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|3952569_3953265_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023927.1|3953257_3954685_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|3954695_3955415_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_024239612.1|3955941_3956796_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024238844.1|3957021_3958347_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	3.2e-113
WP_000474084.1|3958455_3958692_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001306921.1|3958703_3959297_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000621009.1|3959887_3960739_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_101981651.1|3960878_3965135_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000662258.1|3966249_3966351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001466814.1|3966714_3966978_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3966977_3967118_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|3967152_3967380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101981458.1|3968047_3969028_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	1.3e-183
WP_001301257.1|3969402_3969945_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_024238329.1|3970019_3970607_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|3970664_3971333_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001310578.1|3973872_3975516_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001303809.1|3976508_3976838_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_024238330.1|3976849_3977080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001019920.1|3977084_3977699_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070679.1|3978115_3978805_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_101981653.1|3978801_3979758_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_024239739.1|3979754_3981953_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.7	3.3e-38
WP_000121359.1|3981962_3982919_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111348.1|3982897_3983308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097562212.1|3984045_3984315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040079030.1|3984942_3986832_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_097562211.1|3986865_3987057_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	70.5	1.7e-15
WP_097562210.1|3987086_3987617_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	95.5	9.9e-98
WP_021578447.1|3987616_3988219_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.5	3.6e-96
WP_021578446.1|3988190_3988610_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	66.1	4.8e-39
WP_000383548.1|3989485_3990070_-	YmfQ family protein	NA	O22003	Shigella_phage	100.0	1.1e-113
WP_089722541.1|3990060_3991119_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	98.0	6.8e-199
WP_123056701.1|3991105_3991531_-|tail	phage tail protein	tail	U5P0R9	Shigella_phage	99.3	1.5e-80
WP_001259088.1|3991530_3992079_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.4	3.3e-96
WP_097562208.1|3992078_3993158_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.4	4.5e-206
WP_123056700.1|3993154_3994483_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.6	7.2e-246
WP_097562206.1|3994543_3996379_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.3	5.0e-306
WP_000661051.1|3996520_3996790_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	6.0e-43
WP_000090998.1|3996789_3997146_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_097562205.1|3997145_3998642_-|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	98.8	2.9e-272
WP_000497751.1|3998625_3998796_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779292.1|3998804_3999365_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
WP_000224834.1|3999361_3999868_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.3	6.6e-83
WP_000702389.1|3999842_4000253_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	94.9	6.1e-71
WP_000927715.1|4000249_4000573_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	98.1	3.3e-56
WP_000601363.1|4000575_4000776_-	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	1.7e-26
WP_000257507.1|4000825_4002031_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	100.0	1.8e-224
WP_001193631.1|4002045_4002696_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000466255.1|4002673_4003915_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_024244106.1|4003914_4004097_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	96.7	8.5e-25
WP_122987458.1|4004108_4005605_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.4	8.2e-299
WP_000929174.1|4005855_4006341_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	99.4	2.1e-86
WP_001140096.1|4006466_4006817_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	1.2e-62
WP_000738423.1|4007342_4007636_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_158296937.1|4007726_4007909_-|lysis	prophage lysis lipoprotein RzoD	lysis	NA	NA	NA	NA
WP_047668528.1|4008125_4008602_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.8	7.8e-86
WP_001120502.1|4008605_4008941_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	100.0	5.2e-60
WP_032246417.1|4009017_4010070_-	site-specific DNA-methyltransferase	NA	K7PKK9	Enterobacteria_phage	97.7	7.0e-204
WP_032192725.1|4010219_4010414_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	93.8	3.7e-26
WP_000737263.1|4010991_4012074_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	78.7	4.4e-161
WP_001204774.1|4012262_4012646_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	5.2e-56
WP_032145910.1|4012731_4012872_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001099516.1|4012868_4013231_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	94.0	2.3e-58
WP_000774490.1|4013227_4013518_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	2.5e-47
WP_097446270.1|4013510_4013606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947970.1|4013686_4014899_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_001240525.1|4017293_4018706_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088862.1|4018710_4019454_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_024238618.1|4019450_4022216_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.4e-81
WP_000343289.1|4022224_4022986_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_024238617.1|4022990_4024322_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|4024324_4024849_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113713.1|4024845_4026126_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|4026150_4027233_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393832.1|4027196_4029047_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|4029050_4029464_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056989.1|4029470_4030946_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|4030996_4031221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097562281.1|4031255_4031756_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|4032450_4032969_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_097562331.1|4033178_4035320_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.9	9.1e-25
WP_097562330.1|4035395_4039430_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.1e-22
WP_001101841.1|4040385_4040604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101981654.1|4041207_4042344_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP024127	Escherichia coli strain 14EC001 chromosome, complete genome	5072975	4061162	4078095	5072975	integrase,transposase	Enterobacteria_phage(31.82%)	24	4062473:4062486	4066697:4066710
WP_000749893.1|4061162_4062218_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	5.0e-117
4062473:4062486	attL	ATCATTTTTCCTAA	NA	NA	NA	NA
WP_001285288.1|4062505_4063609_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|4063620_4064874_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_000051905.1|4065078_4066242_-|integrase	site-specific integrase	integrase	S5FNS2	Shigella_phage	100.0	4.1e-229
WP_000446903.1|4066118_4066469_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	99.1	1.6e-59
WP_047668532.1|4066440_4066719_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.7	1.4e-47
4066697:4066710	attR	TTAGGAAAAATGAT	NA	NA	NA	NA
WP_000763373.1|4066766_4066985_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
WP_001386642.1|4067083_4067365_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000682559.1|4067927_4068086_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	96.2	1.5e-22
WP_024228451.1|4068082_4068763_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000100845.1|4068759_4069545_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_047668530.1|4069550_4069847_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	5.2e-48
WP_000233576.1|4069923_4070130_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000858975.1|4070725_4071415_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|4071519_4071750_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182903.1|4071819_4072359_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_001471439.1|4072445_4073375_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	62.8	4.9e-108
WP_024234463.1|4073371_4074073_+	hypothetical protein	NA	A0A0P0ZD31	Stx2-converting_phage	98.7	1.9e-128
WP_000145946.1|4074069_4074363_+	winged helix-turn-helix transcriptional regulator	NA	A0A0P0ZCJ0	Stx2-converting_phage	84.9	3.7e-38
WP_000371307.1|4074651_4075404_+	DUF4145 domain-containing protein	NA	A0A1S6L018	Salmonella_phage	36.5	3.9e-31
WP_000622057.1|4075660_4076143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072106870.1|4076234_4076336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001050829.1|4076332_4076788_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	5.4e-60
WP_085947970.1|4076881_4078095_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
>prophage 1
NZ_CP024129	Escherichia coli strain 14EC001 plasmid p14EC001b, complete sequence	123884	80	73589	123884	transposase	Escherichia_phage(30.0%)	48	NA	NA
WP_085947970.1|80_1293_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_001490748.1|1378_1693_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_000770132.1|2324_4985_+	peptidase M66	NA	NA	NA	NA	NA
WP_001368871.1|5068_5944_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_013009342.1|5944_7915_+	variant type II secretion system secretin EtpD	NA	A7BJX1	Enterobacteria_phage	27.6	2.0e-26
WP_001173149.1|9414_10638_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001231213.1|10668_11103_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_000082928.1|11099_11651_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_001420206.1|11665_12013_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_000082784.1|12009_12609_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_071526091.1|13620_14793_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_000998852.1|14779_15295_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_101981710.1|15462_16179_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_101981702.1|19263_19665_-	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_101981703.1|21703_21916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001490748.1|23392_23707_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_001418198.1|29881_31384_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001173149.1|31385_32609_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_000082928.1|33069_33621_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_001420206.1|33635_33983_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_000082784.1|33979_34579_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000842183.1|34575_35553_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_000998852.1|36752_37268_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_001222320.1|38247_38649_+	GspS family T2SS pilot lipoprotein variant EptO	NA	NA	NA	NA	NA
WP_101973092.1|39928_41142_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	1.0e-166
WP_001172748.1|41253_41643_-	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_000592771.1|41686_43897_-	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_085947970.1|44075_45288_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_101981704.1|45254_45350_+	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	2.4e-07
WP_000766060.1|46396_46693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001045657.1|47338_51241_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	38.5	1.4e-220
WP_101981705.1|53186_53474_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_101981706.1|53546_54755_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	99.8	8.8e-235
WP_000599533.1|55120_56326_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_000562370.1|56769_57090_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000460651.1|57082_57469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284954.1|57476_58163_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001322387.1|58140_58767_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089068.1|58845_60051_+	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_000428546.1|60163_60757_-	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_099490915.1|61270_62479_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.5	7.5e-234
WP_001089474.1|62631_62895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101973092.1|64262_65475_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	1.0e-166
WP_001302199.1|66932_67754_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|67753_68860_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|68953_70675_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_077629919.1|70748_71747_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_078165746.1|72050_73589_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	4.9e-299
>prophage 2
NZ_CP024129	Escherichia coli strain 14EC001 plasmid p14EC001b, complete sequence	123884	106141	113927	123884	integrase	Escherichia_phage(28.57%)	10	105798:105813	121253:121268
105798:105813	attL	CAGCCAGTGCCTGAAT	NA	NA	NA	NA
WP_000086184.1|106141_106825_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.7	8.7e-30
WP_077629925.1|107209_108112_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000618110.1|108529_108778_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_000109069.1|108774_109212_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	1.1e-25
WP_000457496.1|109211_110483_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.5	1.4e-142
WP_000340829.1|110487_110880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001103690.1|110884_111856_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	7.4e-67
WP_000633913.1|112084_112729_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
WP_000239529.1|112722_112998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016494.1|113135_113927_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	9.4e-52
121253:121268	attR	ATTCAGGCACTGGCTG	NA	NA	NA	NA
>prophage 1
NZ_CP024130	Escherichia coli strain 14EC001 plasmid p14EC001c, complete sequence	88460	7924	59323	88460	integrase,transposase	Escherichia_phage(40.0%)	42	43472:43531	59328:60110
WP_022631000.1|7924_8713_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.5e-52
WP_001326966.1|8770_8962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000639434.1|11441_11723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022631019.1|12631_13957_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	1.9e-113
WP_000612626.1|14891_15239_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000817038.1|20738_21710_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	1.4e-150
WP_000523812.1|21709_22876_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	3.0e-224
WP_000200070.1|23616_24627_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	54.3	3.0e-87
WP_101981713.1|24994_25084_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	2.3e-07
WP_085947970.1|25049_26263_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_033548869.1|27268_27685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001039462.1|28269_28605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001515192.1|28613_28805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807690.1|29932_30688_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	4.5e-136
WP_000079938.1|32025_32295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101968911.1|32312_33002_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.4	2.2e-89
WP_000888203.1|33103_33583_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_000347934.1|33652_36805_-	multidrug efflux RND transporter permease subunit OqxB	NA	NA	NA	NA	NA
WP_002914189.1|36828_38004_-	multidrug efflux RND transporter periplasmic adaptor subunit OqxA	NA	NA	NA	NA	NA
WP_001067858.1|38323_39028_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_063102497.1|39221_39608_+	bleomycin binding protein	NA	NA	NA	NA	NA
WP_000084745.1|40704_41097_-	NimC/NimA family protein	NA	NA	NA	NA	NA
WP_001452736.1|42851_43163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063107378.1|43198_43477_-	IncN plasmid KikA protein	NA	NA	NA	NA	NA
43472:43531	attL	CGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
WP_001067858.1|43535_44240_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000034420.1|45720_46512_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_001354008.1|46980_47226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612791.1|47263_48127_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_032492336.1|48272_49502_-	macrolide efflux MFS transporter Mef(B)	NA	A0A1B0RXG2	Streptococcus_phage	39.0	2.1e-74
WP_001067855.1|49951_50656_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|50806_51622_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067834.1|51811_52516_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000935452.1|52562_53867_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000204520.1|53905_54613_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|54609_54846_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|54842_55205_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|55222_56917_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|56968_57391_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|57426_57702_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|57715_58066_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|58137_58572_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001067858.1|58618_59323_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
59328:60110	attR	AGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGTTCTGCTCTGTCCAGAATCTGTTGGCGCAGATTTTCTTTCATGTGTTCGATTAATGGGCTGACCATCGGATTAGTGGCATAACCAGAAGCGCGTTCGTACACCATGGAATAGGCTTCCTGAATCGCGTTCTCAATGCTGACAGGATCGTTAGCATCGAAGTGGACATCATAACTTCCGTTTAATGCCTCTGTTGCTCTCTCAACCTCTTTTAGCTGTTTCTGCATTTTGTCTAAACCTGTGATTTTGACGCTCATAACAACCTCCGGACTAAGTGAGATGTATCAACCTTTATAGATAGCACGTTGGAGATGTGGGGTAAGGGATATCACTCAAATTCCATGTAATTTCATTAAGATCAGACTTAACCTTTTTTCGGATCTCCGATAAAAAAGAAAGAAATAGAGATATGCTAAACATATGCCTGGCATCTACATATGCTACCGCTATACATATGCCACACATCTGCCTATACTAAACATATGCACACACCCGGTGCTTTGAATATTCCGGATATGTTTCACATATCCATATGCTCGGGAGAGAAAAAACATGAGAACCGTATCGATATTCAAAAATGGCAACAACCGCGCCATCCGTCTGCCTCGTGATCTGGATTTTGAGGGGGTGAGCGAGCTCGAGATCGTCCGGGAAGGGGACAGCATCATCCTGCGCCCCGTCCGGCCAACCTGGGGATCATTCCTAGAGTACGAAAAAGCCGATCC	NA	NA	NA	NA
