The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015559	Pasteurella multocida strain USDA-ARS-USMARC-60215 chromosome, complete genome	2344126	337672	363442	2344126	tail,terminase,transposase,head	Mannheimia_phage(61.11%)	24	NA	NA
WP_005720092.1|337672_338089_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	3.3e-48
WP_064775610.1|338135_339272_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	58.0	3.8e-123
WP_064775609.1|339411_339738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081317749.1|339785_345680_-	DUF1983 domain-containing protein	NA	A0A0M3LQG1	Mannheimia_phage	36.1	1.6e-257
WP_042743292.1|345683_346274_-|tail	tail assembly protein	tail	A0A0M3LQC4	Mannheimia_phage	57.1	3.1e-52
WP_064775658.1|346216_346957_-	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	60.0	1.3e-84
WP_064775657.1|346959_347664_-|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	64.1	1.6e-82
WP_064775655.1|350497_351193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016533102.1|351497_351827_-|tail	phage tail protein	tail	A0A0M3LQW6	Mannheimia_phage	49.1	4.8e-26
WP_016533103.1|352196_352613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016533104.1|352685_353702_-	hypothetical protein	NA	A0A0M3LQ19	Mannheimia_phage	69.9	7.6e-131
WP_015691079.1|353714_354107_-	hypothetical protein	NA	A0A0M3LQB6	Mannheimia_phage	46.2	5.5e-29
WP_015691078.1|354106_354508_-	HK97 gp10 family phage protein	NA	A0A0M3LPJ5	Mannheimia_phage	61.4	2.1e-39
WP_015691077.1|354509_354884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015691076.1|354885_355353_-	hypothetical protein	NA	A0A0M3LSP7	Mannheimia_phage	55.7	1.4e-34
WP_015691075.1|355369_355606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015691074.1|355662_356820_-	hypothetical protein	NA	G8C7P7	Escherichia_phage	43.3	8.3e-81
WP_015691073.1|356837_357608_-	hypothetical protein	NA	A0A1V0DY60	Dinoroseobacter_phage	36.2	1.5e-25
WP_015691071.1|357943_358378_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	D0UIJ3	Aggregatibacter_phage	61.2	3.1e-41
WP_015691070.1|358352_358571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064775738.1|358573_360175_-|head	phage head morphogenesis protein	head	A0A0M3LQ07	Mannheimia_phage	52.1	3.3e-152
WP_064775653.1|360164_361568_-	DUF4055 domain-containing protein	NA	A0A0M3LQA1	Mannheimia_phage	59.6	4.4e-153
WP_064775652.1|361577_362849_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	61.7	8.6e-148
WP_081273988.1|362851_363442_-	hypothetical protein	NA	A0A2H4J1J5	uncultured_Caudovirales_phage	39.5	4.9e-21
>prophage 2
NZ_CP015559	Pasteurella multocida strain USDA-ARS-USMARC-60215 chromosome, complete genome	2344126	366725	395574	2344126	integrase,holin,transposase	Mannheimia_phage(20.69%)	44	362756:362771	398692:398707
362756:362771	attL	CCCATGTTTTTCCAGA	NA	NA	NA	NA
WP_016533462.1|366725_367310_-	glycoside hydrolase family 19 protein	NA	Q7Y5V0	Haemophilus_phage	55.3	6.5e-58
WP_016533461.1|367281_367647_-|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_143930513.1|367860_368046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016533470.1|368235_368601_-	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	27.3	3.5e-09
WP_064775605.1|368600_369203_-	recombinase NinG	NA	H6WRY9	Salmonella_phage	38.2	6.3e-32
WP_016533468.1|369290_369503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016569985.1|369576_370035_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	53.4	5.8e-38
WP_041423202.1|370024_370555_-	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	58.9	1.0e-54
WP_016533441.1|370564_371254_-	replication protein P	NA	D0UIL4	Aggregatibacter_phage	34.1	1.4e-32
WP_016533442.1|371253_372156_-	hypothetical protein	NA	A0A0U4JX08	Bacillus_phage	37.7	5.5e-32
WP_014390722.1|372157_372511_-	HNH endonuclease	NA	A0A1C9LVX4	Vibrio_phage	33.6	1.3e-08
WP_064775604.1|372507_373209_-	DNA-binding protein	NA	A0A2I7RHG4	Vibrio_phage	55.8	7.1e-35
WP_014391093.1|373266_373494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005720263.1|373562_373772_-	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	52.3	5.5e-12
WP_064775603.1|373899_374589_+	helix-turn-helix transcriptional regulator	NA	Q7Y5W5	Haemophilus_phage	58.2	1.7e-73
WP_016533478.1|374734_374998_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016533477.1|375000_375480_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	47.1	8.3e-19
WP_016533476.1|375476_375860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016533507.1|376478_376709_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	52.8	3.4e-10
WP_016533491.1|377300_377846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016570070.1|378111_378759_+	hypothetical protein	NA	Q7Y5V4	Haemophilus_phage	64.2	3.5e-36
WP_014390710.1|378820_379132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064775602.1|379198_379483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016570068.1|379469_379706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101766859.1|379883_380864_+	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	40.1	3.4e-51
WP_016533454.1|380867_381719_+	phage recombination protein Bet	NA	A0A2H4JAQ4	uncultured_Caudovirales_phage	63.9	4.8e-62
WP_064775601.1|381711_382323_+	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	76.4	6.3e-88
WP_016570065.1|382326_382791_+	single-stranded DNA-binding protein	NA	A0A2I7RK19	Vibrio_phage	69.0	6.1e-35
WP_016533530.1|382802_382994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016570064.1|383036_383390_+	hypothetical protein	NA	I6XKT1	Burkholderia_virus	31.8	1.7e-05
WP_014391448.1|383461_384250_+	DUF2303 family protein	NA	C5IHK3	Burkholderia_virus	29.2	3.2e-20
WP_064775647.1|384300_384900_+	hypothetical protein	NA	A0A218KC93	Bacillus_phage	34.2	3.9e-18
WP_016533502.1|384896_385262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080637896.1|385249_385462_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_064775646.1|385473_385962_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	51.2	3.2e-34
WP_015691048.1|386065_386974_+	hypothetical protein	NA	A0A0M4S6X1	Salmonella_phage	36.1	2.5e-40
WP_064775645.1|387218_387440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014391442.1|387450_388173_+	DNA-binding protein	NA	G0ZND1	Cronobacter_phage	52.5	3.3e-35
WP_075271365.1|388356_388659_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014391441.1|388562_389618_+|integrase	site-specific integrase	integrase	A0A077KGX2	Edwardsiella_phage	37.9	1.6e-62
WP_005725034.1|389992_390847_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	40.3	5.8e-31
WP_014325726.1|391423_391888_-|transposase	IS200/IS605 family transposase	transposase	A0A0A8WIU6	Clostridium_phage	36.1	2.3e-13
WP_005719438.1|392070_392571_-	single-stranded DNA-binding protein	NA	I3PUY5	Vibrio_phage	55.6	4.0e-40
WP_014326374.1|392742_395574_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.3	0.0e+00
398692:398707	attR	TCTGGAAAAACATGGG	NA	NA	NA	NA
>prophage 3
NZ_CP015559	Pasteurella multocida strain USDA-ARS-USMARC-60215 chromosome, complete genome	2344126	746592	755950	2344126		Planktothrix_phage(16.67%)	9	NA	NA
WP_014326208.1|746592_747591_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	2.3e-15
WP_005724065.1|747607_748588_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.4	1.3e-15
WP_005724066.1|748664_749450_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_010906540.1|749458_750250_-	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.7	4.4e-17
WP_005753553.1|750484_752038_+	murein DD-endopeptidase MepM	NA	A0A2K9VGT1	Pontimonas_phage	49.6	8.4e-20
WP_005724296.1|752113_753061_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.7	1.9e-43
WP_014326206.1|753130_754018_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_005753554.1|754017_754635_-	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_014326205.1|754675_755950_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	49.5	1.8e-92
>prophage 4
NZ_CP015559	Pasteurella multocida strain USDA-ARS-USMARC-60215 chromosome, complete genome	2344126	1719722	1822818	2344126	tRNA,terminase,integrase,transposase,tail	Mannheimia_phage(41.67%)	111	1776833:1776878	1822923:1822968
WP_014325726.1|1719722_1720187_-|transposase	IS200/IS605 family transposase	transposase	A0A0A8WIU6	Clostridium_phage	36.1	2.3e-13
WP_005717387.1|1720368_1721097_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	38.1	4.9e-31
WP_014325725.1|1721162_1721831_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_014325724.1|1721840_1722383_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	45.7	4.8e-23
WP_014325723.1|1722445_1723756_-	porin	NA	NA	NA	NA	NA
WP_005723236.1|1724000_1724291_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_005723238.1|1724338_1726000_-	putative transporter	NA	NA	NA	NA	NA
WP_005723242.1|1728089_1728644_+	DUF5358 domain-containing protein	NA	NA	NA	NA	NA
WP_010907004.1|1728861_1730517_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	34.9	7.4e-83
WP_014325722.1|1730606_1731686_-	endonuclease	NA	NA	NA	NA	NA
WP_014325721.1|1732166_1732721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005717426.1|1733028_1733817_+	hemin ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014325720.1|1733829_1734774_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_005723258.1|1734785_1735523_+	ABC transporter ATP-binding protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	32.5	1.5e-14
WP_016504262.1|1735668_1738098_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_014325718.1|1738562_1739588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014325717.1|1740605_1741844_+	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	25.6	1.0e-12
WP_014325716.1|1741857_1742430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014325715.1|1742845_1746739_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	53.4	1.7e-114
WP_005723276.1|1746963_1747263_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_005723278.1|1747243_1748248_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005717441.1|1748524_1749406_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_014325712.1|1749548_1750982_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_005723282.1|1750971_1751223_-	YhdT family protein	NA	NA	NA	NA	NA
WP_005723284.1|1751305_1752652_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_005717446.1|1752753_1753215_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_005717447.1|1753369_1753816_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_005717448.1|1753886_1754900_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_005723289.1|1755152_1756010_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_016504292.1|1756120_1757374_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_095177582.1|1757652_1758558_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_014325708.1|1758588_1758852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014325707.1|1758869_1759493_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005751822.1|1759623_1760004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014325706.1|1760033_1762103_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_014325705.1|1762238_1763657_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005723307.1|1763985_1765557_+	AbgT family transporter	NA	NA	NA	NA	NA
WP_005717460.1|1765687_1766158_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_005717461.1|1766246_1766537_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	40.0	4.5e-12
WP_014325704.1|1766632_1768267_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.6	1.7e-188
WP_016504294.1|1769119_1769917_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014325702.1|1769918_1770518_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.5	9.7e-17
WP_014325701.1|1770535_1771384_+	ModD protein	NA	NA	NA	NA	NA
WP_005754621.1|1771483_1773316_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.7	1.8e-53
WP_005723318.1|1773423_1774320_-	lipoprotein NlpI	NA	NA	NA	NA	NA
WP_005723319.1|1774403_1776548_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
1776833:1776878	attL	TGGTGGAGATAATCGGGATCGAACCGACGACCTCTTGCATGCCATG	NA	NA	NA	NA
WP_005720092.1|1777299_1777716_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	3.3e-48
WP_064775610.1|1777762_1778899_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	58.0	3.8e-123
WP_064775609.1|1779038_1779365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069359803.1|1779412_1784416_-	DUF1983 domain-containing protein	NA	A0A0M3LQ61	Mannheimia_phage	38.8	6.2e-250
WP_014667799.1|1784419_1785040_-|tail	tail assembly protein	tail	A0A0M3LQC4	Mannheimia_phage	57.4	1.1e-52
WP_016569980.1|1784982_1785726_-	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	59.6	7.4e-83
WP_023430089.1|1785730_1786444_-|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	63.9	2.1e-82
WP_014390756.1|1786533_1786863_-	Gifsy-1 prophage VmtM	NA	S5MW28	Escherichia_phage	37.1	3.2e-14
WP_042743193.1|1786865_1789310_-|tail	tail length tape measure protein	tail	A0A0M3LSE2	Mannheimia_phage	57.0	1.6e-150
WP_016533322.1|1789368_1789764_-	hypothetical protein	NA	A0A0M3LR23	Mannheimia_phage	83.2	7.7e-55
WP_016533321.1|1789831_1790296_-	hypothetical protein	NA	A0A0M3LR40	Mannheimia_phage	50.0	5.2e-34
WP_016533320.1|1790326_1790998_-	hypothetical protein	NA	A0A0M3LPR4	Mannheimia_phage	42.9	1.5e-42
WP_014390749.1|1791051_1791534_-|tail	phage tail protein	tail	A0A0M3LPR0	Mannheimia_phage	62.0	2.0e-44
WP_016533319.1|1791545_1791917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014390747.1|1791913_1792285_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	51.2	1.3e-24
WP_014390746.1|1792289_1792634_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	57.9	3.0e-31
WP_042743192.1|1792636_1793005_-	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	42.1	4.7e-22
WP_101766867.1|1792985_1793372_-	hypothetical protein	NA	A0A0M3LR32	Mannheimia_phage	73.9	4.2e-13
WP_016533288.1|1793382_1794381_-	hypothetical protein	NA	A0A0M3LQZ1	Mannheimia_phage	74.7	9.1e-145
WP_016533289.1|1794392_1794827_-	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	75.7	1.1e-54
WP_016533290.1|1794826_1796173_-	hypothetical protein	NA	A0A0M3LQ78	Mannheimia_phage	55.3	4.0e-127
WP_014390740.1|1796187_1797159_-	hypothetical protein	NA	F1C5D8	Cronobacter_phage	41.0	1.6e-53
WP_016533291.1|1797112_1798558_-	DUF1073 domain-containing protein	NA	A0A0M3LPQ5	Mannheimia_phage	58.6	2.4e-146
WP_016533292.1|1798572_1799799_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LTA2	Mannheimia_phage	77.0	9.4e-192
WP_014390737.1|1799782_1800280_-|terminase	terminase	terminase	C7U0W1	Enterobacteria_phage	70.7	7.4e-47
WP_016533497.1|1800362_1800545_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	54.2	3.8e-09
WP_014390736.1|1800573_1801008_+	CopG family transcriptional regulator	NA	A0A0R6PJ17	Moraxella_phage	38.0	1.0e-20
WP_014667795.1|1801229_1801553_-	DUF2570 family protein	NA	NA	NA	NA	NA
WP_014667794.1|1801525_1802056_-	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	50.9	9.7e-45
WP_014391475.1|1802052_1802313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143930513.1|1802526_1802712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016533470.1|1802901_1803267_-	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	27.3	3.5e-09
WP_064775605.1|1803266_1803869_-	recombinase NinG	NA	H6WRY9	Salmonella_phage	38.2	6.3e-32
WP_016533468.1|1803956_1804169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016569985.1|1804242_1804701_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	53.4	5.8e-38
WP_041423202.1|1804690_1805221_-	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	58.9	1.0e-54
WP_016533441.1|1805230_1805920_-	replication protein P	NA	D0UIL4	Aggregatibacter_phage	34.1	1.4e-32
WP_016533442.1|1805919_1806822_-	hypothetical protein	NA	A0A0U4JX08	Bacillus_phage	37.7	5.5e-32
WP_014390722.1|1806823_1807177_-	HNH endonuclease	NA	A0A1C9LVX4	Vibrio_phage	33.6	1.3e-08
WP_064775604.1|1807173_1807875_-	DNA-binding protein	NA	A0A2I7RHG4	Vibrio_phage	55.8	7.1e-35
WP_014391093.1|1807932_1808160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005720263.1|1808228_1808438_-	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	52.3	5.5e-12
WP_064775603.1|1808565_1809255_+	helix-turn-helix transcriptional regulator	NA	Q7Y5W5	Haemophilus_phage	58.2	1.7e-73
WP_016533478.1|1809400_1809664_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016533477.1|1809666_1810146_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	47.1	8.3e-19
WP_016533476.1|1810142_1810526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016533507.1|1811144_1811375_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	52.8	3.4e-10
WP_014391456.1|1811599_1811863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014391102.1|1811950_1812484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016569990.1|1812945_1813581_+	antirepressor	NA	A6XMM0	Bacillus_virus	53.3	2.1e-22
WP_014390710.1|1813642_1813954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064775602.1|1814020_1814305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016570068.1|1814291_1814528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101766859.1|1814705_1815686_+	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	40.1	3.4e-51
WP_016533454.1|1815689_1816541_+	phage recombination protein Bet	NA	A0A2H4JAQ4	uncultured_Caudovirales_phage	63.9	4.8e-62
WP_064775601.1|1816533_1817145_+	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	76.4	6.3e-88
WP_016570065.1|1817148_1817613_+	single-stranded DNA-binding protein	NA	A0A2I7RK19	Vibrio_phage	69.0	6.1e-35
WP_016533530.1|1817624_1817816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016570064.1|1817858_1818212_+	hypothetical protein	NA	I6XKT1	Burkholderia_virus	31.8	1.7e-05
WP_014391448.1|1818283_1819072_+	DUF2303 family protein	NA	C5IHK3	Burkholderia_virus	29.2	3.2e-20
WP_101766465.1|1819122_1819722_+	hypothetical protein	NA	A0A218KC93	Bacillus_phage	34.2	3.0e-18
WP_016570062.1|1819856_1820390_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	36.6	1.3e-20
WP_016533427.1|1820399_1820699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051127937.1|1820997_1821270_+	hypothetical protein	NA	A0A0M3LQA6	Mannheimia_phage	41.1	4.9e-08
WP_064775600.1|1821645_1822818_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A059VF45	Pseudomonas_phage	52.9	5.9e-111
1822923:1822968	attR	TGGTGGAGATAATCGGGATCGAACCGACGACCTCTTGCATGCCATG	NA	NA	NA	NA
