The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024056	Escherichia coli strain SMN197SH3 chromosome, complete genome	5267207	775675	805719	5267207	transposase,tRNA,integrase,protease	Stx2-converting_phage(50.0%)	32	776262:776279	812572:812589
WP_101974164.1|775675_776827_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
776262:776279	attL	AGATGCTGTATATTCAGG	NA	NA	NA	NA
WP_101975615.1|777071_778610_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.4	2.5e-298
WP_000612591.1|778659_779007_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|779003_779384_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_062881820.1|779669_780692_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	8.6e-199
WP_158638453.1|780718_780988_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	E5AGD0	Erwinia_phage	48.8	1.6e-16
WP_000234519.1|781366_782074_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_096851696.1|782471_784607_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_001049791.1|784656_785913_-	nucleoside permease	NA	NA	NA	NA	NA
WP_001298916.1|786114_787194_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_000091700.1|787258_787534_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001365010.1|787562_788615_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000786911.1|788775_789495_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001107564.1|789494_789821_+	YggL family protein	NA	NA	NA	NA	NA
WP_062882547.1|789843_789984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000984796.1|790004_790724_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_000394125.1|790899_791946_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_062882548.1|792062_793070_+	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000577033.1|794426_794930_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_085949012.1|795603_796297_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_000239924.1|797078_798215_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001174743.1|798207_798801_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001277222.1|798808_799099_-	YggU family protein	NA	NA	NA	NA	NA
WP_062882099.1|799095_799662_-	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_000997795.1|799679_800384_-	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_074434025.1|800401_801382_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000017111.1|801557_801974_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001053178.1|801973_802537_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_062882100.1|802645_803596_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001222508.1|803608_804340_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000286500.1|804419_805127_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001300769.1|805221_805719_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
812572:812589	attR	AGATGCTGTATATTCAGG	NA	NA	NA	NA
>prophage 2
NZ_CP024056	Escherichia coli strain SMN197SH3 chromosome, complete genome	5267207	1121256	1175758	5267207	lysis,terminase,integrase,capsid,tail,tRNA,portal,plate,head	Salmonella_phage(67.92%)	68	1129453:1129497	1164487:1164531
WP_062881838.1|1121256_1123029_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	98.8	0.0e+00
WP_095585894.1|1124319_1124919_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	96.5	3.1e-108
WP_101975617.1|1125070_1126384_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.0	5.9e-75
WP_001101698.1|1126385_1126655_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	4.9e-45
WP_062882638.1|1126765_1127347_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	55.3	2.1e-48
WP_074434107.1|1127419_1128049_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	2.1e-78
WP_062882639.1|1128130_1128772_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	98.6	4.8e-107
WP_062882640.1|1128932_1129181_-	DinI family protein	NA	A5LH55	Enterobacteria_phage	98.8	5.4e-38
1129453:1129497	attL	TGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_096851621.1|1129613_1130645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021534483.1|1130647_1131667_-|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	94.0	6.4e-186
WP_096851622.1|1131670_1132300_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	55.5	2.1e-62
WP_000102105.1|1132423_1132666_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_096851623.1|1132698_1133208_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	94.1	7.3e-82
WP_000956176.1|1133215_1133512_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
WP_001747374.1|1133629_1133971_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	97.3	6.6e-55
WP_001244228.1|1134038_1134272_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_000752613.1|1134271_1134499_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000145290.1|1134495_1134798_+	DUF3850 domain-containing protein	NA	A0A0A8WI22	Clostridium_phage	42.1	9.8e-10
WP_096851624.1|1134794_1135652_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.8	7.8e-161
WP_096851625.1|1135648_1138063_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.8	0.0e+00
WP_001154434.1|1138216_1138405_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|1138415_1138649_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_096851626.1|1138970_1140863_+	NTPase KAP	NA	NA	NA	NA	NA
WP_032344223.1|1141346_1141640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096211030.1|1141685_1142711_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.1	2.1e-173
WP_001098462.1|1142710_1144477_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000216248.1|1144619_1145453_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	8.2e-123
WP_024046822.1|1145469_1146528_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
WP_096851627.1|1146531_1147182_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	94.0	4.7e-110
WP_096851628.1|1147277_1147742_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	88.3	7.9e-75
WP_000868175.1|1147741_1147945_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|1147948_1148164_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001341072.1|1148183_1148657_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
WP_000730948.1|1148658_1149036_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	39.2	1.1e-15
WP_024225818.1|1149032_1149461_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.2	4.2e-46
WP_001039936.1|1149556_1149988_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	1.3e-71
WP_024225817.1|1149980_1150427_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.1e-62
WP_000993752.1|1150495_1151074_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	8.8e-92
WP_000177597.1|1151070_1151430_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.7	2.8e-51
WP_000268279.1|1151416_1152325_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.1	1.3e-142
WP_001086824.1|1152317_1152923_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	93.0	1.8e-111
WP_101975618.1|1152919_1154320_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	78.4	7.5e-153
WP_021546685.1|1154346_1154787_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	69.7	4.7e-53
WP_040072409.1|1154758_1155361_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.4	6.6e-98
WP_024184674.1|1155360_1155864_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	54.3	1.8e-40
WP_000905030.1|1155936_1156503_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	3.2e-86
WP_000046120.1|1156645_1157818_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	2.1e-204
WP_001207660.1|1157827_1158343_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281009.1|1158397_1158700_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|1158714_1158834_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_096851630.1|1158826_1161988_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	59.6	1.8e-308
WP_000980416.1|1161984_1162470_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	8.3e-67
WP_096851631.1|1162466_1163567_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.5	3.4e-177
WP_000980501.1|1163635_1163854_+	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	77.8	7.5e-28
WP_000391795.1|1163880_1164363_-	hypothetical protein	NA	Q19UP0	Mannheimia_phage	34.3	2.7e-17
WP_000162571.1|1165063_1165546_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1164487:1164531	attR	TGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000600190.1|1165677_1166154_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|1166143_1166434_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|1166495_1166837_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|1166985_1168647_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|1168732_1169611_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001364786.1|1169733_1170327_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_077879218.1|1170381_1171668_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001338897.1|1171688_1172480_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_062882641.1|1172646_1174008_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|1174144_1174393_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|1174411_1174960_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|1174990_1175758_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP024056	Escherichia coli strain SMN197SH3 chromosome, complete genome	5267207	1387453	1564653	5267207	transposase,holin,integrase,protease,tail,capsid,bacteriocin,tRNA,portal,plate	Escherichia_phage(40.8%)	184	1452744:1452768	1516771:1516795
WP_000695657.1|1387453_1388869_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_024226072.1|1388919_1389312_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000472021.1|1389313_1389673_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_062881724.1|1390292_1392482_+	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_000376337.1|1392531_1393734_-	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_000186380.1|1394069_1395308_+	Mn(2+) uptake NRAMP transporter MntH	NA	NA	NA	NA	NA
WP_000490072.1|1395448_1395775_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_062881725.1|1395889_1397146_-	ion channel protein	NA	NA	NA	NA	NA
WP_062881726.1|1397349_1398315_+	glucokinase	NA	NA	NA	NA	NA
WP_000038456.1|1398534_1398861_+	fructose-like phosphotransferase enzyme IIB component 1	NA	NA	NA	NA	NA
WP_062881727.1|1398882_1400130_+	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000173242.1|1400144_1401230_+	aminopeptidase	NA	NA	NA	NA	NA
WP_024226596.1|1401229_1402267_+	aminopeptidase	NA	NA	NA	NA	NA
WP_062881729.1|1402291_1404787_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_001295458.1|1405659_1406394_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
WP_062881730.1|1406408_1408106_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000785931.1|1408482_1409721_+	alanine transaminase	NA	NA	NA	NA	NA
WP_010723117.1|1409785_1409857_-	membrane protein YpdK	NA	NA	NA	NA	NA
WP_000484404.1|1410212_1411133_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
WP_000639883.1|1411485_1411728_+	YfdY family protein	NA	NA	NA	NA	NA
WP_000867637.1|1411804_1412080_-	colanic acid biosynthesis lipoprotein YpdI	NA	NA	NA	NA	NA
WP_000825599.1|1412375_1413008_+	YfdX family protein	NA	NA	NA	NA	NA
WP_000106759.1|1413520_1414771_+	formyl-CoA transferase	NA	NA	NA	NA	NA
WP_062881731.1|1414824_1416519_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	4.7e-24
WP_000955028.1|1416588_1417533_+	transporter YfdV	NA	NA	NA	NA	NA
WP_085949012.1|1417665_1418360_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_074465645.1|1418431_1419526_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_074433971.1|1419581_1423175_-	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	1.3e-36
WP_000991370.1|1423179_1423794_-	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
WP_024226601.1|1424209_1425373_+	multidrug efflux MFS transporter periplasmic adaptor subunit EmrK	NA	NA	NA	NA	NA
WP_001018714.1|1425372_1426911_+	multidrug efflux MFS transporter permease subunit EmrY	NA	NA	NA	NA	NA
WP_062881732.1|1427018_1428347_-	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_001344440.1|1428813_1429809_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_024231033.1|1429816_1431250_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	9.1e-29
WP_085952403.1|1432137_1433351_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_064234920.1|1435106_1435808_+	Replication protein P	NA	A0A1U9AJJ8	Stx1_converting_phage	100.0	3.4e-130
WP_000145931.1|1435804_1436095_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_001000127.1|1436165_1436444_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000103679.1|1436576_1436792_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001281772.1|1436802_1437039_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000814576.1|1436995_1437442_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_000153269.1|1437438_1437966_+	phage N-6-adenine-methyltransferase	NA	H6WZI7	Escherichia_phage	99.4	1.2e-100
WP_074433983.1|1437962_1438103_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	1.0e-14
WP_101974057.1|1438138_1438834_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	97.8	3.1e-131
WP_062882575.1|1439194_1439929_+	antirepressor	NA	A0A0N7C203	Escherichia_phage	99.6	5.5e-123
WP_001004008.1|1440003_1440726_+	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	99.6	3.9e-129
WP_001108006.1|1440725_1441331_+	recombination protein NinG	NA	Q8VNP2	Enterobacteria_phage	100.0	1.9e-97
WP_000144764.1|1441327_1441522_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204862.1|1441514_1441949_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	99.3	1.8e-81
WP_001356551.1|1442197_1442350_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_101974058.1|1443060_1444998_+	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	96.4	0.0e+00
WP_000142777.1|1445134_1445314_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	96.6	1.4e-24
WP_001290217.1|1445354_1445627_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
WP_000284506.1|1445703_1445919_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_101974059.1|1446305_1447037_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	99.6	4.2e-123
WP_101975621.1|1447103_1447703_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.0	8.2e-109
WP_101974060.1|1447767_1449081_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.9	4.8e-77
WP_001101698.1|1449082_1449352_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	4.9e-45
WP_101974061.1|1449457_1450339_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	89.4	1.1e-144
WP_001247930.1|1450569_1451268_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_062881455.1|1451364_1452531_-|integrase	prophage integrase IntS	integrase	Q716F9	Shigella_phage	98.7	1.6e-220
1452744:1452768	attL	TTATATCCATTTAACTAAGAGGACA	NA	NA	NA	NA
WP_096851722.1|1452962_1454132_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	99.7	3.7e-230
WP_000453637.1|1454115_1454298_-	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_096851721.1|1454376_1454754_-	DUF1627 domain-containing protein	NA	A0A2R2Z2X7	Escherichia_phage	98.4	1.7e-51
WP_001291843.1|1454789_1455002_-	DUF1382 family protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
WP_000163444.1|1454961_1455588_-	adenine methylase	NA	A0A2R2Z304	Escherichia_phage	100.0	1.0e-122
WP_044164933.1|1455584_1456016_-	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	99.3	2.1e-74
WP_000203834.1|1456071_1456710_-	phage antirepressor Ant	NA	A0A0P0ZG08	Escherichia_phage	99.5	5.5e-119
WP_032344420.1|1457033_1457762_-	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	100.0	7.9e-130
WP_096851720.1|1457857_1458454_-	DUF551 domain-containing protein	NA	Q6H9Z7	Enterobacteria_phage	99.5	6.3e-117
WP_001014300.1|1458456_1458648_-	hypothetical protein	NA	Q6H9Z6	Enterobacteria_phage	100.0	1.2e-26
WP_101975622.1|1458649_1459420_-	ead/Ea22-like family protein	NA	Q08J58	Stx2-converting_phage	100.0	1.5e-142
WP_096851708.1|1459416_1460076_-	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	61.5	3.4e-39
WP_096851709.1|1460084_1460495_-	hypothetical protein	NA	A0A076G6X8	Escherichia_phage	72.1	2.0e-29
WP_096851710.1|1460491_1461106_-	hypothetical protein	NA	A0A0P0ZFU9	Escherichia_phage	71.7	9.2e-55
WP_001214452.1|1461102_1461267_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	4.6e-22
WP_032346988.1|1461277_1461574_-	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	98.0	9.5e-50
WP_032346989.1|1461597_1462185_-	hypothetical protein	NA	G9L666	Escherichia_phage	99.0	5.4e-105
WP_000536228.1|1462181_1462862_-	AAA family ATPase	NA	G9L667	Escherichia_phage	100.0	3.4e-127
WP_000613346.1|1462870_1463059_-	hypothetical protein	NA	G9L668	Escherichia_phage	100.0	2.2e-28
WP_000361831.1|1463055_1463169_-	host cell division inhibitory peptide Kil	NA	G9L669	Escherichia_phage	100.0	2.7e-13
WP_001198866.1|1463161_1463302_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q9AZ26	Salmonella_phage	100.0	3.3e-21
WP_096851711.1|1463493_1463964_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.8e-87
WP_000088203.1|1464023_1464296_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|1464273_1464456_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|1465024_1465546_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_001302016.1|1466047_1466743_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|1466818_1467034_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_062882649.1|1467175_1467475_+	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	99.0	3.7e-49
WP_001244621.1|1467497_1467770_+	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_096851712.1|1467832_1468720_+	replication protein	NA	A5VW95	Enterobacteria_phage	98.0	4.9e-142
WP_044861139.1|1468716_1470093_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.1	2.4e-252
WP_000103679.1|1470574_1470790_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001281772.1|1470800_1471037_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000814576.1|1470993_1471440_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_000153269.1|1471436_1471964_+	phage N-6-adenine-methyltransferase	NA	H6WZI7	Escherichia_phage	99.4	1.2e-100
WP_001254256.1|1471960_1472143_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_101975623.1|1472418_1473096_+	phage antirepressor Ant	NA	A0A0P0ZC44	Stx2-converting_phage	98.7	4.0e-128
WP_097736163.1|1473170_1473893_+	DNA-binding protein	NA	A0A0P0ZBS6	Stx2-converting_phage	99.6	3.0e-129
WP_000002243.1|1473892_1474183_+	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
WP_096851781.1|1474179_1474557_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	64.9	1.1e-37
WP_000762928.1|1474553_1475375_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_096851804.1|1475601_1475799_+	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	96.9	9.8e-27
WP_001358663.1|1475868_1477065_-|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_001358663.1|1477320_1478517_-|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_001358663.1|1478772_1479969_-|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_101975624.1|1480295_1481009_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_101975625.1|1481818_1483756_+	SASA family carbohydrate esterase	NA	A0A1I9LJQ8	Stx_converting_phage	99.8	0.0e+00
WP_000143458.1|1483890_1484070_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290212.1|1484110_1484383_+	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000284506.1|1484459_1484675_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087461.1|1484679_1485213_+	lysozyme	NA	V5USG4	Shigella_phage	100.0	7.9e-103
WP_001056876.1|1485487_1486054_+	hypothetical protein	NA	A0A0H4IQ87	Shigella_phage	100.0	1.4e-105
WP_000622438.1|1486068_1486203_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	100.0	4.2e-13
WP_071535903.1|1486430_1486637_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	66.1	2.1e-11
WP_001505200.1|1486858_1487356_+	kilA-N domain protein	NA	A0A0H4IPL1	Shigella_phage	100.0	2.4e-93
WP_001283921.1|1487352_1487610_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_001086076.1|1488009_1488816_+	hypothetical protein	NA	A0A1U9AJA9	Stx1_converting_phage	100.0	1.7e-133
WP_000143991.1|1488796_1490503_+	hypothetical protein	NA	A0A1U9AJA6	Stx1_converting_phage	100.0	0.0e+00
WP_000787521.1|1490502_1492647_+|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	99.9	0.0e+00
WP_096851698.1|1492804_1493812_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	99.7	1.5e-179
WP_000214474.1|1493835_1495050_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140442.1|1495105_1495495_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_001290743.1|1495544_1496006_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_000829200.1|1495989_1496553_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_000207919.1|1496552_1497203_+	hypothetical protein	NA	A0A0H4J3F2	Shigella_phage	99.5	3.9e-120
WP_101975626.1|1497199_1499137_+|tail	phage tail protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_001023433.1|1499138_1499408_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	98.9	6.4e-45
WP_001370566.1|1499546_1499726_+	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	2.8e-28
WP_001146329.1|1500029_1501655_+	hypothetical protein	NA	A0A088CBK0	Shigella_phage	99.8	0.0e+00
WP_000162954.1|1501651_1502920_+	host specificity protein J	NA	A0A2L1IV54	Escherichia_phage	89.5	2.6e-213
WP_000455634.1|1502934_1503213_+	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_001301884.1|1503218_1503836_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000835360.1|1503926_1504661_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_000078907.1|1504893_1505034_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035558.1|1505090_1505492_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000509481.1|1505585_1506242_+	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000455649.1|1506244_1506691_+	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	100.0	6.2e-77
WP_000540391.1|1506700_1506952_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000012449.1|1506962_1508228_+	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	98.8	9.9e-205
WP_096851649.1|1508296_1516648_+	hypothetical protein	NA	Q08J70	Stx2-converting_phage	94.3	0.0e+00
WP_062881454.1|1516869_1517802_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	2.1e-167
1516771:1516795	attR	TTATATCCATTTAACTAAGAGGACA	NA	NA	NA	NA
WP_000776768.1|1518095_1518851_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_062881453.1|1519032_1520091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296861.1|1520456_1521797_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_001296869.1|1522168_1522453_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_062881452.1|1522633_1523944_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_062881451.1|1523943_1526088_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_001195819.1|1526290_1526776_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_062881450.1|1527450_1528014_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_157911462.1|1530759_1530999_+	fimbrial protein	NA	NA	NA	NA	NA
WP_062881449.1|1530995_1531520_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001323815.1|1531521_1532379_+	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_062881448.1|1532500_1533052_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001298774.1|1533217_1534150_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000918470.1|1534184_1535270_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001043819.1|1535273_1536098_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000447361.1|1536097_1536907_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_001089241.1|1536906_1537455_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000559764.1|1537488_1537767_+	YfcL family protein	NA	NA	NA	NA	NA
WP_062881447.1|1537887_1539894_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000817183.1|1540052_1541273_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000127772.1|1541581_1542760_+	MFS transporter	NA	NA	NA	NA	NA
WP_000615813.1|1542756_1543752_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_001539236.1|1544020_1544914_-	type VI secretion-associated protein	NA	NA	NA	NA	NA
WP_001173929.1|1544918_1545251_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_000078920.1|1545513_1545654_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_062881446.1|1545845_1546106_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_085952403.1|1548108_1549322_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_000132789.1|1549470_1549794_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	100.0	1.1e-43
WP_000005431.1|1549951_1551136_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	8.1e-225
WP_000290450.1|1551135_1551648_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665314.1|1551702_1552068_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_001391627.1|1552103_1552232_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	95.2	1.5e-15
WP_062881740.1|1552218_1555026_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	95.8	0.0e+00
WP_000979946.1|1555038_1555527_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	8.8e-85
WP_000954205.1|1555683_1556256_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000144022.1|1556299_1556878_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	2.9e-95
WP_000108515.1|1556877_1559340_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	97.2	8.1e-110
WP_000071702.1|1559342_1559873_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	5.1e-94
WP_001111955.1|1559865_1560762_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.1e-154
WP_001435533.1|1560765_1561116_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	2.7e-59
WP_085952403.1|1561189_1562402_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_074434101.1|1563495_1564653_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.3	1.7e-22
>prophage 4
NZ_CP024056	Escherichia coli strain SMN197SH3 chromosome, complete genome	5267207	1755388	1872803	5267207	transposase,lysis,terminase,integrase,holin,capsid,tail,tRNA	Enterobacteria_phage(36.62%)	115	1753099:1753115	1834477:1834493
1753099:1753115	attL	GAATTATTTAGAGTATA	NA	NA	NA	NA
WP_000968208.1|1755388_1756084_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_001295452.1|1756080_1756479_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_062882626.1|1756718_1757669_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_000691708.1|1758056_1758140_-	protein YohP	NA	NA	NA	NA	NA
WP_001078129.1|1758363_1759800_+	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
WP_000079520.1|1759852_1760614_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001296821.1|1760743_1761322_-	DedA family protein	NA	NA	NA	NA	NA
WP_001295454.1|1761491_1762079_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_001295432.1|1762252_1763185_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_062882579.1|1763222_1764938_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_101975628.1|1765133_1767431_+	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_001131274.1|1767682_1768600_+	glycine betaine ABC transporter substrate-binding protein OsmF	NA	NA	NA	NA	NA
WP_000220837.1|1768606_1769764_+	glycine betaine ABC transporter permease YehY	NA	NA	NA	NA	NA
WP_062882576.1|1769756_1770683_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G9BWD6	Planktothrix_phage	35.1	3.3e-24
WP_000783120.1|1770687_1771419_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1771399_1771507_-	protein YohO	NA	NA	NA	NA	NA
WP_029208472.1|1771566_1772268_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.9e-102
WP_000063648.1|1772288_1773575_-|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1773608_1773863_-	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1773881_1774016_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1774019_1774262_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_095585854.1|1774349_1774610_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	82.3	1.5e-43
WP_021351746.1|1775100_1775871_-	ead/Ea22-like family protein	NA	Q6H9Z5	Enterobacteria_phage	98.8	6.2e-141
WP_000763383.1|1775867_1776089_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001443983.1|1776187_1776469_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000548537.1|1776479_1776671_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149544.1|1776643_1776826_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000611716.1|1776822_1777503_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000100847.1|1777499_1778285_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|1778290_1778587_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_085952403.1|1778766_1779980_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_000198444.1|1780091_1780475_-	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_096851726.1|1781130_1782177_-	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	99.4	1.3e-205
WP_096851725.1|1782170_1782632_-	hypothetical protein	NA	G9L674	Escherichia_phage	99.3	1.9e-76
WP_029793531.1|1782698_1783040_-	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	98.2	2.8e-61
WP_000250473.1|1783100_1783808_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_001180318.1|1783886_1784114_+	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000438542.1|1784252_1784549_+	hypothetical protein	NA	Q6H9X8	Enterobacteria_phage	100.0	5.2e-48
WP_000185454.1|1784581_1785520_+	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	100.0	1.3e-172
WP_101974068.1|1785516_1786218_+	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.1	8.4e-129
WP_000145931.1|1786214_1786505_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000736913.1|1786578_1787019_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_096851738.1|1787015_1787543_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	98.9	2.3e-99
WP_000335902.1|1787724_1788774_+	hypothetical protein	NA	Q9T208	Enterobacteria_phage	100.0	1.3e-181
WP_101974069.1|1788925_1789648_+	DNA-binding protein	NA	O48426	Enterobacteria_phage	96.7	3.6e-127
WP_101974070.1|1789647_1790253_+	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	99.0	8.1e-96
WP_001028864.1|1790249_1790921_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	96.9	1.6e-129
WP_096851751.1|1790911_1791400_+	antiterminator	NA	Q5TJL7	Enterobacteria_phage	99.4	7.7e-89
WP_101974071.1|1792477_1794328_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_000411802.1|1794620_1794827_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_001135289.1|1794826_1795324_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	97.0	2.4e-90
WP_000092313.1|1795320_1795758_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	96.6	4.2e-70
WP_000839224.1|1795960_1796458_+	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|1796454_1796712_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095736.1|1797174_1797402_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279804.1|1797443_1797809_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	4.0e-66
WP_000958372.1|1798098_1798662_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.5	3.3e-83
WP_101974072.1|1798658_1800320_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	98.6	0.0e+00
WP_000173079.1|1800383_1802321_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	100.0	0.0e+00
WP_001063025.1|1802365_1802587_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000573391.1|1805790_1806237_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1806233_1806578_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_158638991.1|1807373_1807526_+	hypothetical protein	NA	A0A0P0ZE84	Stx2-converting_phage	100.0	1.5e-11
WP_158638992.1|1807455_1807749_+	hypothetical protein	NA	A0A0N7KZA2	Stx2-converting_phage	98.9	1.6e-44
WP_001513217.1|1807844_1808054_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_158638993.1|1808101_1808977_+	tape measure protein	NA	A0A0P0ZCJ4	Stx2-converting_phage	98.5	1.8e-133
WP_158638994.1|1808927_1810229_+	hypothetical protein	NA	A0A0P0ZCJ4	Stx2-converting_phage	95.8	8.1e-194
WP_101975629.1|1811333_1811675_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	96.5	6.9e-60
WP_001152185.1|1811674_1812373_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.7	3.1e-131
WP_122997399.1|1813073_1813706_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	95.7	3.5e-102
WP_101975630.1|1813941_1817418_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.3	0.0e+00
WP_001230412.1|1817484_1818084_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	100.0	1.0e-111
WP_101975631.1|1818148_1819462_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.9	4.8e-77
WP_001101698.1|1819463_1819733_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	4.9e-45
WP_096851743.1|1819843_1820425_+	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	60.0	4.3e-54
WP_096851744.1|1820756_1822001_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	91.1	2.0e-229
WP_072148138.1|1822653_1823064_-	secretion protein EspV	NA	Q6H9S1	Enterobacteria_phage	99.3	5.5e-72
WP_085949012.1|1823850_1824544_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_062882067.1|1824742_1826428_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.3	8.1e-303
WP_000598641.1|1826424_1827144_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_062882068.1|1827190_1827661_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.6e-81
WP_062882069.1|1827700_1828162_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	2.4e-76
WP_062882070.1|1828286_1829684_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	67.0	2.9e-237
WP_062882071.1|1829680_1830817_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.2e-162
WP_096851674.1|1830809_1833089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024226433.1|1833099_1834188_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636938.1|1834493_1834811_-	hypothetical protein	NA	NA	NA	NA	NA
1834477:1834493	attR	GAATTATTTAGAGTATA	NA	NA	NA	NA
WP_001343818.1|1838260_1838503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295427.1|1842447_1844481_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_062882073.1|1844612_1845722_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_024177741.1|1845984_1846266_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|1846557_1847100_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677395.1|1847180_1847855_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_085949012.1|1849265_1849960_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_062881463.1|1851138_1852173_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153074.1|1852254_1852593_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_024231052.1|1852814_1853660_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1853780_1854053_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195589.1|1854275_1855064_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822274.1|1855060_1855861_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001351455.1|1855925_1856744_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
WP_000434038.1|1856795_1857542_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062881585.1|1858477_1859482_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	2.2e-13
WP_071796522.1|1859478_1860690_-	MFS transporter	NA	NA	NA	NA	NA
WP_062881586.1|1861011_1862064_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000289788.1|1862371_1863226_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000182904.1|1864531_1864984_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_062881587.1|1865014_1865299_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_024226538.1|1865302_1866658_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_085949012.1|1866813_1867507_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_062882553.1|1867512_1868520_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_072146912.1|1868619_1869399_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_062882552.1|1869480_1870380_-	lipid kinase YegS	NA	NA	NA	NA	NA
WP_001318299.1|1870793_1871111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062882551.1|1871441_1872803_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	1.6e-216
>prophage 5
NZ_CP024056	Escherichia coli strain SMN197SH3 chromosome, complete genome	5267207	1889773	1900606	5267207	terminase,tail	Escherichia_phage(36.36%)	16	NA	NA
WP_001097238.1|1889773_1890463_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_158638458.1|1890646_1891390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|1891475_1891634_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_134792477.1|1891714_1891948_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	4.0e-11
WP_100224537.1|1892627_1892858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062881662.1|1893016_1893550_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	95.5	2.4e-99
WP_001303555.1|1893705_1893888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|1893900_1894032_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|1894259_1894445_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|1894970_1895285_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|1895366_1895591_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_062881478.1|1895985_1896483_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.5	1.0e-11
WP_021351651.1|1897931_1898303_+	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
WP_096851758.1|1898426_1899215_-	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.1	1.6e-144
WP_000950982.1|1899481_1900363_-	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_074433962.1|1900468_1900606_-|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	95.6	3.7e-17
>prophage 6
NZ_CP024056	Escherichia coli strain SMN197SH3 chromosome, complete genome	5267207	1978074	2067654	5267207	transposase,integrase,holin,protease,tail,plate,head	Escherichia_phage(40.3%)	105	1992990:1993006	2077103:2077119
WP_001254932.1|1978074_1979226_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001200891.1|1979716_1980775_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|1980946_1981276_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_158638995.1|1981434_1981902_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_085952403.1|1981968_1983181_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_000973176.1|1985161_1985707_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_024226617.1|1985703_1986447_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_024226619.1|1986458_1987538_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986346.1|1987599_1988535_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011483.1|1988991_1989909_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011017.1|1990010_1990961_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122985555.1|1991078_1992722_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
1992990:1993006	attL	TTTTTTGATTTCTGTGT	NA	NA	NA	NA
WP_000532912.1|1993350_1994067_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|1994409_1995864_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_062882557.1|1995965_1997282_-	shikimate transporter	NA	NA	NA	NA	NA
WP_062882558.1|1997596_1998649_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_101974093.1|2002206_2003420_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.0	3.5e-167
WP_001515476.1|2007788_2008586_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000693883.1|2009525_2009951_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_101975632.1|2010022_2011093_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.7	8.5e-64
WP_101974178.1|2011099_2011846_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	82.8	1.8e-113
WP_000450617.1|2011867_2012584_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
WP_000603384.1|2012616_2012898_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2012894_2013122_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2013114_2013426_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_044809747.1|2013522_2013771_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	78.6	2.2e-23
WP_000104474.1|2013772_2014330_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2014563_2014776_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2014895_2015240_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_062882007.1|2015361_2015634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265233.1|2015635_2016685_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.4e-110
WP_001217447.1|2016697_2017057_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_062882008.1|2017065_2017620_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	66.9	6.8e-65
WP_101974095.1|2017844_2018042_+	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	95.4	7.5e-27
WP_000301785.1|2018176_2018890_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000528251.1|2019643_2020381_-	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
WP_001310452.1|2020334_2020535_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_115801860.1|2020649_2021114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001114104.1|2021152_2021398_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000144787.1|2021433_2021616_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_010917876.1|2021762_2023802_-	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000904930.1|2023901_2024462_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917875.1|2024683_2024887_+|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000420351.1|2024966_2025488_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_000469162.1|2025522_2026434_-|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000301577.1|2026433_2026994_-	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_001146835.1|2026984_2028067_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000763330.1|2028066_2028504_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_000980532.1|2028496_2029111_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000098807.1|2029100_2030225_-|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000146116.1|2030208_2031558_-	DMT family permease	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000113523.1|2031544_2033620_-	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	3.7e-71
WP_000213225.1|2033746_2034223_-	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000015473.1|2034237_2034603_-|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000606747.1|2034611_2036114_-|tail	tail protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000848437.1|2036110_2036356_-	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000627431.1|2036356_2036917_-	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_001104956.1|2036913_2037333_-	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_032311118.1|2037329_2037734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001142982.1|2037777_2038725_-|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_000850822.1|2038724_2039849_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.9	2.9e-78
WP_032311117.1|2040025_2040499_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	1.7e-37
WP_000046901.1|2040620_2041952_-|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.8	3.9e-151
WP_000532592.1|2041935_2043525_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	1.4e-168
WP_001057665.1|2043524_2045189_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	8.1e-231
WP_000360581.1|2045188_2045770_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001279082.1|2045772_2046063_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	4.7e-25
WP_000270159.1|2046059_2046368_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_000342747.1|2046348_2046576_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001122256.1|2046585_2046804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801859.1|2046787_2047216_-	endopeptidase	NA	NA	NA	NA	NA
WP_001125304.1|2047250_2047751_-	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_000852377.1|2047822_2048248_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001214366.1|2048317_2048827_-	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	41.9	1.1e-26
WP_000378480.1|2048823_2049120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001086886.1|2049109_2049307_-	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_001310453.1|2049299_2049632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310341.1|2049647_2049998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633440.1|2050012_2050324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973023.1|2050320_2050872_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000465562.1|2050875_2051391_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	1.2e-47
WP_000578573.1|2051390_2051924_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	66.7	5.9e-66
WP_050863685.1|2051927_2052470_-	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	39.4	4.9e-28
WP_001129553.1|2052567_2053098_-	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000049306.1|2053109_2053403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049432.1|2053407_2053680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|2053676_2053958_-	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_001057199.1|2053959_2054214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000257930.1|2054226_2054448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000129790.1|2054450_2055383_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_001512118.1|2055454_2057545_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	47.4	4.0e-166
WP_001310454.1|2057546_2057795_-	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_001056416.1|2057962_2058547_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	39.8	4.2e-17
WP_074434003.1|2058823_2059078_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	98.8	1.0e-36
WP_101975633.1|2059555_2061493_+	DUF1737 domain-containing protein	NA	A0A0P0ZBP4	Stx2-converting_phage	96.7	0.0e+00
WP_000143462.1|2061628_2061808_+	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_001290230.1|2061848_2062094_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072901.1|2062171_2062387_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_062881865.1|2062391_2062925_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	97.7	1.3e-100
WP_001056883.1|2063199_2063769_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	99.5	1.5e-104
WP_000455406.1|2063768_2063918_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_129014757.1|2064145_2064331_+	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	4.9e-20
WP_001302717.1|2064856_2065171_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_085952403.1|2065237_2066450_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_001079070.1|2067123_2067654_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	99.1	1.6e-55
2077103:2077119	attR	ACACAGAAATCAAAAAA	NA	NA	NA	NA
>prophage 7
NZ_CP024056	Escherichia coli strain SMN197SH3 chromosome, complete genome	5267207	2457414	2538232	5267207	transposase,terminase,holin,integrase,protease,tail,portal	Enterobacteria_phage(31.15%)	90	2463439:2463454	2523332:2523347
WP_085949012.1|2457414_2458109_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_000938103.1|2458634_2459204_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_001303943.1|2460370_2460649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|2461076_2461223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|2461359_2462007_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|2462190_2462781_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
2463439:2463454	attL	GAGAATATTTTTCATT	NA	NA	NA	NA
WP_074433998.1|2465548_2465767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113671.1|2466253_2467384_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.1	1.7e-102
WP_000113189.1|2467361_2467610_-	excisionase	NA	NA	NA	NA	NA
WP_000102168.1|2467674_2470119_-	exonuclease	NA	V5UQJ3	Shigella_phage	58.3	8.4e-176
WP_000092782.1|2470211_2470400_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|2470396_2470585_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001302137.1|2470982_2471147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171938.1|2471150_2471369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|2471528_2471684_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001003379.1|2471873_2472281_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000476986.1|2472358_2472586_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705370.1|2472569_2473121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020565.1|2473092_2474133_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.2	6.7e-90
WP_157837342.1|2474044_2474587_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.4	2.9e-84
WP_096851718.1|2474621_2475380_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	68.4	1.2e-80
WP_000215514.1|2475439_2475625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211435.1|2475972_2476521_+	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	75.4	1.4e-41
WP_000882662.1|2476735_2476948_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000042395.1|2477050_2477368_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001217944.1|2477360_2477732_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001452497.1|2477955_2478183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024177817.1|2478236_2478506_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	52.5	2.7e-11
WP_001265189.1|2478507_2479557_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.4e-110
WP_000904171.1|2479569_2479944_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	4.2e-34
WP_000762902.1|2479940_2480762_+	hypothetical protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
WP_000917733.1|2480988_2481186_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
WP_000483509.1|2481337_2482396_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	2.6e-206
WP_101975635.1|2482990_2484937_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.3	0.0e+00
WP_000143464.1|2485071_2485251_+	DUF1378 family protein	NA	G9L6J3	Escherichia_phage	100.0	1.3e-25
WP_001290212.1|2485291_2485564_+	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000284518.1|2485640_2485856_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001041949.1|2485859_2486651_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_001092902.1|2487162_2487696_+	lysozyme	NA	G9L6J6	Escherichia_phage	96.6	2.1e-100
WP_012816791.1|2488214_2488400_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000373407.1|2488874_2489351_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_001077626.1|2489347_2491471_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000102415.1|2491467_2491680_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974554.1|2491679_2493182_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	99.8	3.1e-290
WP_001114424.1|2493126_2495151_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|2495238_2495565_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|2495557_2495839_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974960.1|2495841_2496465_+	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	99.5	2.5e-100
WP_000682716.1|2496477_2496876_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|2496883_2497636_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_044707580.1|2497649_2498072_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	3.3e-72
WP_000532075.1|2498098_2498407_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_000847298.1|2501091_2501421_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_080025938.1|2501420_2502119_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	1.5e-130
WP_101975636.1|2502129_2502873_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	1.5e-147
WP_072065989.1|2502818_2503451_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	98.1	5.8e-105
WP_101975637.1|2503686_2507163_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.3	0.0e+00
WP_101974156.1|2507229_2507829_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.0	5.9e-107
WP_101974170.1|2507893_2509207_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	3.6e-80
WP_001101699.1|2509208_2509478_+|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	98.9	1.9e-44
WP_001131657.1|2509590_2510166_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	1.8e-89
WP_101975638.1|2510238_2510868_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.8	4.6e-78
WP_001143784.1|2510949_2511591_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001261939.1|2511752_2512001_-	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001278450.1|2512824_2512929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902693.1|2513118_2513331_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	6.8e-26
WP_072184779.1|2513498_2513777_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	4.8e-11
WP_001265156.1|2513778_2514828_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.9e-108
WP_096851745.1|2514840_2515200_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.1	6.8e-34
WP_096851746.1|2515196_2515886_+	antiterminator	NA	I6PDF8	Cronobacter_phage	47.6	2.7e-55
WP_000917733.1|2516098_2516296_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
WP_101974173.1|2518951_2520802_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000411802.1|2521249_2521456_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_001208680.1|2522164_2522350_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001303878.1|2522876_2523191_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000074669.1|2523272_2523497_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
2523332:2523347	attR	GAGAATATTTTTCATT	NA	NA	NA	NA
WP_001303046.1|2523538_2523904_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_095585824.1|2524192_2524663_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.1	1.3e-77
WP_053274549.1|2525835_2527284_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.4	8.4e-06
WP_062881678.1|2527296_2527476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000414564.1|2527513_2528437_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062881679.1|2528653_2529997_+	VOC family protein	NA	NA	NA	NA	NA
WP_062881680.1|2530221_2531877_+	glucan biosynthesis protein	NA	NA	NA	NA	NA
WP_001296778.1|2532016_2532241_+	YdcH family protein	NA	NA	NA	NA	NA
WP_000140884.1|2532303_2532840_+	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_062881681.1|2532834_2533815_-	LbetaH domain-containing protein	NA	NA	NA	NA	NA
WP_074433957.1|2533938_2534931_+	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_000586728.1|2534927_2535521_+	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001261013.1|2535823_2536492_+	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_074433958.1|2537023_2538232_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.5	3.2e-208
>prophage 8
NZ_CP024056	Escherichia coli strain SMN197SH3 chromosome, complete genome	5267207	2583171	2664727	5267207	transposase	Escherichia_phage(20.0%)	59	NA	NA
WP_001358663.1|2583171_2584368_-|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_101975640.1|2584476_2584659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296726.1|2586268_2586535_+	type II toxin-antitoxin system antitoxin HipB	NA	NA	NA	NA	NA
WP_024226200.1|2586534_2587857_+	type II toxin-antitoxin system serine/threonine protein kinase toxin HipA	NA	NA	NA	NA	NA
WP_101974107.1|2588310_2589583_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.3	7.5e-176
WP_001296758.1|2590145_2590709_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001195166.1|2591069_2591780_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_062881588.1|2591821_2594473_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000876770.1|2594486_2595017_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000825464.1|2595029_2595533_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_062881589.1|2595591_2596506_+	fimbrial protein	NA	NA	NA	NA	NA
WP_062881590.1|2596840_2599120_+	acid resistance putative oxidoreductase YdeP	NA	NA	NA	NA	NA
WP_000543401.1|2599367_2599565_+	two-component system connector SafA	NA	NA	NA	NA	NA
WP_000060479.1|2599638_2600400_+	acid stress response transcriptional regulator YdeO	NA	NA	NA	NA	NA
WP_024226203.1|2600801_2602484_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_001295683.1|2602535_2603693_+	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_120795387.1|2603658_2603781_-	protein YneP	NA	NA	NA	NA	NA
WP_101974108.1|2607534_2608935_+	glutamate decarboxylase	NA	NA	NA	NA	NA
WP_000246019.1|2609090_2610626_+	acid resistance gamma-aminobutyrate antiporter GadC	NA	NA	NA	NA	NA
WP_000350400.1|2610756_2612076_+	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_000426277.1|2612447_2613830_+	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
WP_074433598.1|2613854_2616254_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_001285855.1|2616511_2617093_+	D-alanyl-D-alanine dipeptidase	NA	NA	NA	NA	NA
WP_062881438.1|2617106_2618657_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_062881439.1|2618658_2619681_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000979613.1|2619677_2620574_+	D,D-dipeptide ABC transporter permease	NA	NA	NA	NA	NA
WP_062881440.1|2621539_2622466_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	9.1e-14
WP_000152305.1|2622521_2622953_-	peroxiredoxin OsmC	NA	NA	NA	NA	NA
WP_000495771.1|2623315_2623531_+	biofilm-dependent modulation protein	NA	NA	NA	NA	NA
WP_000841554.1|2623632_2623770_+	stationary-phase-induced ribosome-associated protein	NA	NA	NA	NA	NA
WP_000433464.1|2623926_2625624_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_000642420.1|2625757_2626768_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	1.2e-24
WP_000781370.1|2626913_2627198_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000045648.1|2627248_2627902_-	formate dehydrogenase-N subunit gamma	NA	NA	NA	NA	NA
WP_062881441.1|2627894_2628779_-	formate dehydrogenase N subunit beta	NA	NA	NA	NA	NA
WP_077879179.1|2628791_2631839_-	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_071998535.1|2632070_2632952_+	aromatic amino acid efflux DMT transporter YddG	NA	NA	NA	NA	NA
WP_001295648.1|2633211_2633502_+	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.7e-25
WP_001207905.1|2635180_2636569_+	NarK family nitrate/nitrite MFS transporter	NA	NA	NA	NA	NA
WP_062881443.1|2636650_2640391_+	nitrate reductase Z subunit alpha	NA	NA	NA	NA	NA
WP_062881444.1|2640387_2641932_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
WP_001166350.1|2641931_2642627_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_024225927.1|2642623_2643304_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000804414.1|2643383_2644277_+	PhzF family isomerase	NA	NA	NA	NA	NA
WP_000187917.1|2644372_2645218_-	N-hydroxyarylamine O-acetyltransferase	NA	NA	NA	NA	NA
WP_000085930.1|2645392_2645962_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_001120145.1|2645965_2646193_-	tautomerase PptA	NA	NA	NA	NA	NA
WP_032312347.1|2646292_2647429_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001358663.1|2648197_2649394_+|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_096851760.1|2649388_2649631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062881864.1|2653443_2655102_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.2	8.3e-26
WP_085949012.1|2655681_2656376_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_062881819.1|2656600_2656813_-	YncH family protein	NA	NA	NA	NA	NA
WP_062881818.1|2656888_2657506_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_001295649.1|2657772_2659272_+	L-asparagine permease	NA	NA	NA	NA	NA
WP_000550675.1|2659386_2660448_-	YncE family protein	NA	NA	NA	NA	NA
WP_062881817.1|2660689_2662792_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	1.1e-134
WP_062881816.1|2662827_2663493_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_085949012.1|2664032_2664727_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP024056	Escherichia coli strain SMN197SH3 chromosome, complete genome	5267207	2669187	2704658	5267207	transposase,head,capsid,tail	Stx2-converting_phage(45.45%)	35	NA	NA
WP_000214712.1|2669187_2669391_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_062881606.1|2671381_2672032_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	98.6	4.6e-121
WP_062881604.1|2672256_2673132_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.3	2.1e-161
WP_101975641.1|2673272_2673542_-|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	98.9	1.1e-44
WP_101974109.1|2673543_2674857_-|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.9	4.8e-77
WP_101974110.1|2674921_2675521_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	4.2e-105
WP_101975642.1|2675587_2678980_-	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	88.0	0.0e+00
WP_000649829.1|2679113_2679641_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_122994999.1|2679828_2680461_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.0	2.6e-97
WP_101975643.1|2680406_2681150_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	6.8e-145
WP_101975644.1|2681160_2681859_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	96.6	8.4e-129
WP_000807964.1|2681858_2682200_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001453698.1|2685482_2685692_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2685787_2686162_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_101975645.1|2686167_2686884_-|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	2.8e-127
WP_000133388.1|2686942_2687287_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2687283_2687730_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2687726_2688077_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2688086_2688413_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063096.1|2690939_2691161_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_097469946.1|2691205_2693143_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.8	0.0e+00
WP_001303046.1|2694163_2694529_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000095749.1|2694570_2694798_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_000736096.1|2695166_2695391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|2695476_2695662_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_001043239.1|2695883_2696102_-	hypothetical protein	NA	Q687G2	Enterobacteria_phage	93.3	1.0e-16
WP_000992122.1|2696179_2696713_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_000731236.1|2696763_2697108_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_101974116.1|2697765_2699616_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_000216644.1|2699930_2700098_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	68.6	1.2e-09
WP_000961821.1|2701729_2701942_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_096851637.1|2702019_2703388_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	6.3e-112
WP_001320773.1|2703488_2703638_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|2703709_2703883_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_000428998.1|2704127_2704658_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
>prophage 10
NZ_CP024056	Escherichia coli strain SMN197SH3 chromosome, complete genome	5267207	2751060	2802406	5267207	terminase,holin,integrase,protease,tail,tRNA,portal	Escherichia_phage(41.38%)	63	2751695:2751720	2797044:2797069
WP_001364706.1|2751060_2751495_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	4.0e-28
2751695:2751720	attL	AAGAAAGAACAATACAACCTGAACAA	NA	NA	NA	NA
WP_001143784.1|2752075_2752717_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|2752798_2753428_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001131659.1|2753500_2754076_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001023406.1|2754188_2754458_-|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	97.8	2.4e-44
WP_000279065.1|2754459_2755782_-|tail	tail fiber protein	tail	Q687E6	Enterobacteria_phage	98.6	2.0e-75
WP_001228289.1|2755846_2756446_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_101975646.1|2756513_2759987_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_096851774.1|2760227_2760857_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	2.3e-101
WP_053903785.1|2760802_2761546_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	2.8e-146
WP_096851779.1|2761551_2762250_-|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	97.4	5.8e-130
WP_000847298.1|2762249_2762579_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001303163.1|2762575_2765221_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.7	0.0e+00
WP_000532075.1|2765264_2765573_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_044707580.1|2765599_2766022_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	3.3e-72
WP_000235090.1|2766035_2766788_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|2766795_2767194_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_001450644.1|2767206_2767830_-|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	98.6	2.9e-104
WP_001281347.1|2767832_2768114_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	98.9	1.3e-45
WP_001097065.1|2768106_2768433_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114429.1|2768520_2770545_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
WP_000974564.1|2770489_2771992_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102415.1|2771991_2772204_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077625.1|2772200_2774324_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000348565.1|2774320_2774797_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001302882.1|2774829_2775102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012816791.1|2775313_2775499_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2775726_2775873_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2775872_2776442_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|2776712_2777246_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001072899.1|2777250_2777466_-|holin	holin	holin	A0A0P0ZFW5	Escherichia_phage	100.0	9.0e-34
WP_001290230.1|2777543_2777789_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|2777829_2778009_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_101975647.1|2778145_2780092_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.6	0.0e+00
WP_000640110.1|2780793_2781336_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.3	3.9e-73
WP_000228017.1|2781332_2781623_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	8.2e-46
WP_000940305.1|2781622_2782222_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.5	1.0e-106
WP_071525388.1|2782293_2782545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000902698.1|2782781_2782994_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.2e-17
WP_000418464.1|2783116_2784238_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_001138877.1|2784224_2784875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014164.1|2785029_2785260_-	hypothetical protein	NA	A0A2R2Z315	Escherichia_phage	76.8	4.1e-16
WP_001151116.1|2785256_2785679_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.8e-63
WP_000450718.1|2785694_2786456_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.7	1.0e-116
WP_000788984.1|2786478_2787225_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	4.8e-114
WP_001356605.1|2787231_2788020_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.0	5.1e-42
WP_000702017.1|2788097_2788520_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	5.9e-69
WP_001033914.1|2788516_2788759_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_000410105.1|2788855_2789275_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_000379547.1|2789581_2789734_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000887681.1|2790145_2790994_+	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	60.8	5.9e-60
WP_000560226.1|2791040_2791262_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	6.9e-37
WP_001427414.1|2791261_2791432_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	3.3e-23
WP_000102194.1|2791512_2794182_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	61.3	4.2e-205
WP_000166315.1|2794174_2794984_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_042853000.1|2795040_2795235_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_001356607.1|2795227_2795416_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_000079604.1|2795515_2795731_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_096851543.1|2795732_2796968_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.0	4.3e-237
WP_096851542.1|2797019_2797955_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	99.2	1.2e-146
2797044:2797069	attR	AAGAAAGAACAATACAACCTGAACAA	NA	NA	NA	NA
WP_024226008.1|2798083_2799457_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	1.5e-52
WP_000387388.1|2799935_2800919_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_024226007.1|2801173_2802406_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	4.0e-17
>prophage 11
NZ_CP024056	Escherichia coli strain SMN197SH3 chromosome, complete genome	5267207	2973226	3137666	5267207	transposase,lysis,terminase,holin,integrase,protease,tail,capsid,tRNA,head	Stx2-converting_phage(26.19%)	190	3123602:3123622	3147750:3147770
WP_101974122.1|2973226_2973920_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_062881475.1|2974084_2974996_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|2975202_2975664_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284270.1|2975740_2976400_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001297679.1|2976471_2976765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062881471.1|2977006_2977408_+	inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
WP_001056859.1|2977527_2977896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062881472.1|2978418_2979114_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|2979137_2979950_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|2979953_2980220_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_001131446.1|2980969_2981089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001328621.1|2981049_2981235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122462.1|2981335_2981509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000726974.1|2981510_2981855_+	glycine zipper family protein	NA	NA	NA	NA	NA
WP_001295611.1|2981864_2982194_+	YmgD family protein	NA	NA	NA	NA	NA
WP_077879182.1|2982250_2984572_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	43.3	1.8e-90
WP_062881474.1|2985298_2985517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065752.1|2987501_2987750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000888772.1|2987862_2988129_-	biofilm/acid-resistance regulator AriR	NA	NA	NA	NA	NA
WP_000858002.1|2988157_2988430_-	two-component-system connector protein YmgA	NA	NA	NA	NA	NA
WP_000554153.1|2988472_2988709_-	two-component-system connector protein YcgZ	NA	NA	NA	NA	NA
WP_096851686.1|2989022_2990234_+	blue light-responsive regulator BluF	NA	NA	NA	NA	NA
WP_000332308.1|2990438_2991170_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373101.1|2991390_2991795_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_062881502.1|2991847_2991958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062881503.1|2992490_2992811_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	64.7	1.1e-38
WP_000539892.1|2992878_2993031_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	1.6e-21
WP_001298108.1|2993510_2993948_+	acetyltransferase	NA	NA	NA	NA	NA
WP_096851685.1|2994204_2994558_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001171554.1|2994840_2995221_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2995217_2995565_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_032205137.1|2997511_2998465_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_062881457.1|2998651_3000136_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000937499.1|3000319_3000625_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_000239870.1|3000681_3001350_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3001847_3002030_+	general stress protein	NA	NA	NA	NA	NA
WP_062881458.1|3002108_3002609_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_062881459.1|3002645_3003152_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488336.1|3003170_3004061_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_062881460.1|3004180_3004762_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	1.5e-102
WP_095585866.1|3004761_3007833_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	1.9e-68
WP_095585867.1|3007897_3008419_-|tail	phage tail tape measure protein	tail	A0A291AWV3	Escherichia_phage	100.0	2.2e-41
WP_000198149.1|3009868_3010075_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_062881689.1|3010071_3011997_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453622.1|3011971_3012517_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	3.1e-94
WP_062881690.1|3012905_3013100_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	3.7e-26
WP_001031427.1|3013264_3013471_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3013756_3014167_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|3014458_3014752_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_012738274.1|3014842_3015025_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	100.0	1.7e-17
WP_001180491.1|3015241_3015718_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.8	1.0e-85
WP_000544528.1|3015704_3016010_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_000088653.1|3017150_3017387_+	excisionase	NA	NA	NA	NA	NA
WP_062881691.1|3017376_3018519_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	99.4	1.2e-204
WP_062881692.1|3018632_3019883_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.1	1.9e-22
WP_001248692.1|3020054_3020708_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476089.1|3020717_3021179_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001297484.1|3021232_3022339_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|3022374_3023016_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_062881693.1|3023019_3024390_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	3.2e-108
WP_001265481.1|3024558_3025230_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_062881694.1|3025229_3026690_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001295435.1|3026765_3027887_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359446.1|3027935_3029162_-	peptidase T	NA	NA	NA	NA	NA
WP_000531601.1|3029411_3030548_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_062881695.1|3030531_3031395_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.2	2.0e-10
WP_001144080.1|3032441_3033092_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001299273.1|3033166_3034225_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_012816780.1|3034352_3034988_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_001118085.1|3035055_3035637_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_001023452.1|3035748_3036018_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_101975648.1|3036019_3037333_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	7.4e-78
WP_032271866.1|3037397_3038021_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.9	8.7e-69
WP_101975649.1|3038089_3041569_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	94.5	0.0e+00
WP_137534157.1|3041804_3042437_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	89.4	1.2e-97
WP_101974128.1|3042382_3043126_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	7.3e-147
WP_001335877.1|3043136_3043835_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_101975650.1|3043834_3044176_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	93.8	6.4e-58
WP_158638996.1|3046758_3047406_-	tape measure protein	NA	A0A0P0ZCJ4	Stx2-converting_phage	98.0	9.6e-95
WP_001513217.1|3047453_3047663_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_101975679.1|3047758_3048154_-|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	97.6	7.7e-63
WP_000133388.1|3048918_3049263_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3049259_3049706_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|3049702_3050053_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000126029.1|3050063_3050390_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	99.1	2.0e-53
WP_101975651.1|3052914_3053136_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	2.9e-35
WP_058157541.1|3053180_3055118_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.8	0.0e+00
WP_101974129.1|3055181_3056843_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.5	0.0e+00
WP_000958380.1|3056839_3057403_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000279816.1|3057693_3058059_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.0	7.8e-62
WP_001341372.1|3058100_3058286_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	88.5	6.4e-20
WP_000347013.1|3058415_3058556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3058912_3059137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3059201_3059408_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_001443546.1|3059785_3059977_-	hypothetical protein	NA	A0A0M4S639	Salmonella_phage	63.9	7.8e-05
WP_001003112.1|3060054_3060588_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	2.1e-100
WP_000138558.1|3060747_3061020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411804.1|3061275_3061482_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
WP_101975652.1|3061772_3063623_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.0	0.0e+00
WP_001359877.1|3064193_3064625_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	3.6e-66
WP_000498122.1|3064803_3065025_-	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	65.2	2.0e-20
WP_000735807.1|3065077_3065302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096851733.1|3065681_3066740_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	91.5	1.2e-192
WP_001429230.1|3066890_3067088_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	4.0e-28
WP_001064890.1|3067306_3067990_-	antiterminator	NA	I6PDF8	Cronobacter_phage	48.9	1.2e-55
WP_000904126.1|3067986_3068346_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	65.8	1.7e-37
WP_016241288.1|3068358_3069408_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.5e-110
WP_024184173.1|3069409_3069688_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	6.3e-11
WP_072127062.1|3069628_3069826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000818169.1|3069803_3070289_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000119357.1|3070307_3070487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206829.1|3070818_3071163_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	92.1	9.7e-54
WP_000212748.1|3071166_3071454_-	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	95.8	2.5e-47
WP_001429226.1|3071456_3071816_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	78.6	1.3e-37
WP_001224669.1|3071981_3072164_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	95.0	1.0e-25
WP_016241289.1|3072311_3072617_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.0	1.5e-50
WP_000017336.1|3072613_3072931_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	71.6	3.0e-33
WP_000450619.1|3072927_3073644_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.4	1.0e-73
WP_000788764.1|3073665_3074412_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.2	8.1e-114
WP_064717445.1|3074418_3075387_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	52.4	9.0e-73
WP_000693817.1|3075409_3075835_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261756.1|3075831_3076059_-	cell division protein	NA	NA	NA	NA	NA
WP_000444609.1|3076158_3076803_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	25.9	4.7e-09
WP_000379549.1|3077076_3077229_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_000450219.1|3077618_3077807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000199482.1|3077803_3077992_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_032185406.1|3078084_3080628_+	exonuclease	NA	V5UQJ3	Shigella_phage	69.8	7.1e-234
WP_000003739.1|3080689_3080959_+	excisionase	NA	NA	NA	NA	NA
WP_101974131.1|3080927_3082046_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.7	3.5e-84
WP_001113310.1|3082122_3082590_-	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	35.0	4.4e-09
WP_000824186.1|3082567_3082771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|3083452_3084814_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3084874_3085150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301834.1|3085229_3085355_-	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_122994997.1|3085377_3085953_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_085949012.1|3087545_3088239_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_096851723.1|3090887_3093236_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3093255_3093345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023356.1|3093451_3093721_-|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
WP_101975654.1|3093722_3095036_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	2.0e-78
WP_025404308.1|3095100_3095700_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	99.0	2.0e-110
WP_101975655.1|3095766_3099243_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.4	0.0e+00
WP_130069576.1|3099489_3100122_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	88.9	2.6e-97
WP_053921656.1|3100067_3100811_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	99.6	9.2e-150
WP_001298836.1|3100821_3101520_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	1.7e-129
WP_101975657.1|3101519_3101861_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	96.5	2.0e-59
WP_001513217.1|3105138_3105348_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_096089446.1|3105443_3105806_-|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.3	4.6e-62
WP_000133388.1|3106599_3106944_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3106940_3107387_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_101975659.1|3107307_3107733_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	2.8e-58
WP_000126029.1|3107743_3108070_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	99.1	2.0e-53
WP_001063096.1|3110425_3110647_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_101975660.1|3110691_3112629_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.2	0.0e+00
WP_001457603.1|3112692_3114354_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	100.0	0.0e+00
WP_000958387.1|3114350_3114914_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_000279796.1|3115205_3115571_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000095736.1|3115612_3115840_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|3116269_3116455_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3116682_3116829_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_101975661.1|3116828_3117380_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	96.3	2.3e-97
WP_000992168.1|3117650_3118184_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	99.4	4.3e-101
WP_000731236.1|3118234_3118579_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000411811.1|3118583_3118790_-|holin	holin	holin	O48430	Enterobacteria_phage	100.0	1.8e-31
WP_101975662.1|3119233_3121084_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
WP_001359877.1|3121654_3122086_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	3.6e-66
WP_000762928.1|3122651_3123473_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_101975663.1|3123469_3123844_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.3e-32
3123602:3123622	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_101975664.1|3123856_3124906_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	7.7e-110
WP_000191872.1|3124907_3125180_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|3125301_3125646_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_101975665.1|3125765_3125978_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	98.6	8.6e-29
WP_000104474.1|3126211_3126769_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_096848963.1|3126770_3126989_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	70.8	3.1e-21
WP_001289673.1|3127116_3127428_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|3127420_3127648_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_096851728.1|3127644_3127926_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	3.6e-30
WP_096948413.1|3127958_3128675_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.0	1.6e-71
WP_000788759.1|3128696_3129443_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	1.4e-113
WP_001262372.1|3129449_3130520_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	66.2	4.5e-65
WP_000693928.1|3130591_3131017_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3131000_3131324_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3131448_3131925_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000379610.1|3132243_3132396_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.7e-07
WP_001358566.1|3132885_3133074_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001365098.1|3133070_3133262_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048280.1|3133355_3135827_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_000003742.1|3135888_3136158_+	excisionase	NA	NA	NA	NA	NA
WP_101975666.1|3136126_3137245_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	2.9e-83
WP_096851754.1|3137321_3137666_-	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	35.5	4.3e-09
3147750:3147770	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 12
NZ_CP024056	Escherichia coli strain SMN197SH3 chromosome, complete genome	5267207	3233429	3309289	5267207	transposase,terminase,holin,integrase,protease,tail	Escherichia_phage(28.12%)	80	3297511:3297526	3315007:3315022
WP_085949012.1|3233429_3234123_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_001365086.1|3234267_3238230_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004993148.1|3238269_3238908_-	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_158638998.1|3239195_3240287_+	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_001307100.1|3240286_3240979_+	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_062882336.1|3240990_3241377_+	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_001307099.1|3241384_3242185_+	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001001183.1|3242194_3242785_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001028096.1|3242795_3243290_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
WP_001365093.1|3243310_3244639_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	2.8e-234
WP_001273658.1|3244721_3244895_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_062882335.1|3245267_3245864_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001143120.1|3245884_3246112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044273.1|3246149_3247391_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_062882334.1|3247681_3248941_-	YccE family protein	NA	NA	NA	NA	NA
WP_000420617.1|3249201_3250122_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
WP_062882333.1|3250121_3250427_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209866.1|3250519_3251119_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_062882332.1|3251115_3253662_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.5	1.2e-71
WP_062882331.1|3253661_3254834_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120112.1|3254963_3255656_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264919.1|3255628_3256657_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_074434056.1|3256739_3259484_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_000818470.1|3259555_3260629_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|3260677_3260851_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_021292990.1|3260840_3261071_-	protein YmcE	NA	NA	NA	NA	NA
WP_071528578.1|3261045_3261234_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|3261244_3261457_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_000087763.1|3261742_3261955_+	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_001295358.1|3262396_3262702_+	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_062882329.1|3262808_3263453_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001038079.1|3263449_3264196_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000742345.1|3264195_3266292_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001343234.1|3266337_3267477_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000057871.1|3267464_3267911_+	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_000208650.1|3267930_3270111_+	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_024226935.1|3270225_3271524_-	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_000270305.1|3271603_3271696_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_000460803.1|3271708_3272845_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_062882328.1|3272856_3274401_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_062882327.1|3274534_3275392_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000063978.1|3275388_3275787_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_062882326.1|3275783_3276371_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186423.1|3276367_3277075_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_062882325.1|3277093_3278887_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001058323.1|3278883_3280002_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_096248247.1|3281715_3281985_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	95.5	7.8e-43
WP_062882369.1|3283364_3283988_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.4	1.3e-69
WP_101975669.1|3284056_3285739_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	98.8	7.0e-307
WP_000235436.1|3286561_3287071_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_032243757.1|3287473_3287698_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303878.1|3287779_3288094_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|3288621_3288807_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|3289028_3289142_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|3289362_3289896_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|3290055_3290328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411814.1|3290583_3290790_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_101974181.1|3292457_3293682_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.1e-176
WP_062881813.1|3294957_3295731_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|3296096_3296234_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_001013642.1|3296278_3296491_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_074433979.1|3296658_3296937_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265133.1|3296938_3297988_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
3297511:3297526	attL	GGCGGAAAAAATCCGC	NA	NA	NA	NA
WP_001217436.1|3298000_3298372_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090265.1|3298361_3298733_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_000265267.1|3298884_3299703_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917737.1|3299989_3300187_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000887453.1|3300812_3301085_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3301193_3301595_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3301622_3301814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3301813_3302101_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3302377_3302533_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_032205089.1|3302674_3303064_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	30.0	1.5e-05
WP_032205087.1|3303250_3303436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3304009_3304198_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3304194_3304386_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_101975670.1|3304479_3306915_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	6.4e-59
WP_000273151.1|3306982_3307225_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3307202_3308222_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_062882278.1|3308629_3309289_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	48.5	6.2e-41
3315007:3315022	attR	GGCGGAAAAAATCCGC	NA	NA	NA	NA
>prophage 13
NZ_CP024056	Escherichia coli strain SMN197SH3 chromosome, complete genome	5267207	3471575	3507364	5267207	transposase,protease	Stx2-converting_phage(36.36%)	32	NA	NA
WP_001182418.1|3471575_3472655_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_000797372.1|3472654_3473611_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000506898.1|3473621_3474830_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176766.1|3474847_3475315_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000042916.1|3475575_3475905_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000957249.1|3475891_3476272_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_095585846.1|3477175_3478789_-|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.2	2.0e-165
WP_000624701.1|3478819_3479170_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000435663.1|3479166_3479592_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_000397130.1|3481929_3482601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135715.1|3483471_3483612_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_000803992.1|3483913_3484177_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001021388.1|3485388_3486006_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_062882318.1|3486017_3486692_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_000966485.1|3486692_3487157_-	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_000065682.1|3487166_3488870_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_000612150.1|3488862_3489183_-	urease subunit beta	NA	NA	NA	NA	NA
WP_000424145.1|3489191_3489494_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_000886249.1|3489503_3490283_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000591995.1|3491162_3492782_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000024297.1|3492874_3493234_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_101974067.1|3493609_3494822_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.0	8.4e-169
WP_001304211.1|3495232_3495523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062882370.1|3495546_3495798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028913479.1|3495845_3496451_-	conjugal transfer protein TraT	NA	NA	NA	NA	NA
WP_001171554.1|3497842_3498223_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3498219_3498567_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000233452.1|3500914_3503275_-	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_074433978.1|3503429_3503786_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_085949012.1|3503845_3504539_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_000934041.1|3504736_3507013_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3507043_3507364_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 14
NZ_CP024056	Escherichia coli strain SMN197SH3 chromosome, complete genome	5267207	3621582	3636977	5267207	transposase,holin,integrase,tail	Enterobacteria_phage(41.18%)	23	3623498:3623512	3637051:3637065
WP_024225839.1|3621582_3622872_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.2e-18
WP_000767391.1|3622930_3623407_+	kinase inhibitor	NA	NA	NA	NA	NA
3623498:3623512	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_052915805.1|3623910_3624564_+	EspJ family T3SS effector ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_000354291.1|3624576_3624798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001002868.1|3624881_3625262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062881704.1|3625261_3625507_-|tail	phage tail protein	tail	Q687E6	Enterobacteria_phage	98.5	2.4e-30
WP_000284515.1|3625731_3625947_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_033816266.1|3626089_3626488_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3626568_3626727_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3626813_3627557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|3627809_3628433_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_095585803.1|3628429_3629095_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	98.6	7.2e-130
WP_032205168.1|3629247_3629430_+	hypothetical protein	NA	A0A1I9LJN0	Stx_converting_phage	98.3	7.2e-24
WP_095585804.1|3629426_3630107_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	97.3	5.6e-130
WP_000682294.1|3630103_3630265_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	96.0	7.7e-22
WP_000129285.1|3630257_3630815_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_001386642.1|3630825_3631107_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_096851764.1|3631205_3631463_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	97.1	2.0e-32
WP_101974067.1|3631468_3632681_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.0	8.4e-169
WP_074433965.1|3633648_3634257_+	ead/Ea22-like family protein	NA	Q9MCR3	Enterobacteria_phage	96.4	5.0e-21
WP_000789829.1|3634387_3635086_+	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	81.9	1.5e-101
WP_001303965.1|3635322_3635622_+	hypothetical protein	NA	G9L655	Escherichia_phage	100.0	2.4e-53
WP_000533642.1|3635906_3636977_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
3637051:3637065	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 15
NZ_CP024056	Escherichia coli strain SMN197SH3 chromosome, complete genome	5267207	4073332	4116014	5267207	transposase,integrase	Enterobacteria_phage(33.33%)	36	4073275:4073334	4102208:4102974
4073275:4073334	attL	GGGTGATGCCTCTAATTAGTTGAATCTGATGTATAATACGGGCTTTTGAGGTTATCTCAT	NA	NA	NA	NA
WP_085949012.1|4073332_4074026_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_122994995.1|4074906_4075764_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024230918.1|4075884_4080138_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_001174461.1|4080703_4081555_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.2e-47
WP_001172290.1|4081581_4082571_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_062881659.1|4082602_4083496_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000662258.1|4083958_4084060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803999.1|4084423_4084687_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_024226489.1|4084686_4084827_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147277.1|4084861_4085089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085949012.1|4086047_4086742_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_000150119.1|4087253_4087889_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|4087946_4088615_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_085952403.1|4088800_4090014_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_062882561.1|4090065_4090218_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000772643.1|4090646_4091861_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	9.7e-133
WP_000893278.1|4092216_4093470_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_001285288.1|4093481_4094585_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000174677.1|4095965_4096367_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189543.1|4096424_4097669_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4097760_4098219_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293016.1|4098479_4099937_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_062882562.1|4099993_4100608_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_085949012.1|4102265_4102959_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_001226164.1|4103211_4104267_-	DNA polymerase IV	NA	NA	NA	NA	NA
4102208:4102974	attR	GGGTGATGCCTCTAATTAGTTGAATCTGATGTATAATACGGGCTTTTGAGGTTATCTCATGGCCAGCGTTAATATTCATTGTCCCCGTTGTCAGTCAGCTCAGGTTTACCGCCATGGTCAGAACCCTAAAGGCCGTGACAGATTTCGCTGCCGTGACTGCCACCGTGTGTTTCAGCTCACTTATACTTATCAAGCACGTAAGCCGGGTATGAAAGAGCTGATAACTGAAATGGCCTTTAATGGTGCCGGGGTTCGCGATACCGCCAGGACACTGAAAATTGGTATTAACACCGTCATCCGGACTTTAAAAAACTCGCGCCAAAGCGAATAACGTCTTCGCCTGTTGCCCATGCTGATGTGGCGCTTATCTGCGAGCTTGATGAGCAATGGAGCTACGTTGGCAGTAAAGCCCGGCAACACTGGCTCTGGTACGCGTACAACACCAAAACAGGCGGTGTACTGGCCTACACTTTTGGTCCCCGAACCGATCAAACGTGCCGGGAGCTACTGGCACTGCTTACACCCTTCAACATCGGCATGCTGACCAGCGATGACTGGGGCAGCTATGGCCGGGAGGTGCCGAAGAATAAGCATCTGACCGGCAAAATATTCACCCAACGCATTGAGCGTAATAATCTGACGCTACGCACCCGCATTAAGCGGTTGGCTCGTAAAACAATCTGCTTCTCACGCTCAGTTGAGATCCACGAAAAAGTGATCGGAGCGTTTATCGAAAAACACATGTTCTACTAATTGGATGCACTACC	NA	NA	NA	NA
WP_095585890.1|4104337_4105108_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_000729704.1|4105742_4106003_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615979.1|4106005_4106284_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4106439_4107180_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001365365.1|4107150_4107918_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_062882565.1|4108123_4108702_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	31.4	3.3e-14
WP_000973081.1|4108941_4111386_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000532698.1|4111428_4111902_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_062882566.1|4112055_4112826_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_074434005.1|4114413_4114713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085949012.1|4115320_4116014_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP024056	Escherichia coli strain SMN197SH3 chromosome, complete genome	5267207	4121453	4192546	5267207	transposase,plate,tRNA,protease	Enterobacteria_phage(11.11%)	56	NA	NA
WP_000611742.1|4121453_4121867_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_062882456.1|4121870_4123721_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_085952403.1|4125387_4126601_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_062882458.1|4128057_4128801_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_062882459.1|4128805_4130218_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122994993.1|4130326_4133761_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_062882461.1|4133771_4134053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|4135147_4135630_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908057.1|4135673_4136588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096851690.1|4136597_4137077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086140.1|4137213_4137999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297205.1|4138537_4139269_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|4139333_4139801_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297210.1|4139797_4140520_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052727.1|4140553_4141309_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_062882466.1|4141380_4142739_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	1.3e-08
WP_000016005.1|4142787_4143411_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001230983.1|4143414_4144215_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_085949012.1|4144472_4145167_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_001140187.1|4151062_4151638_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_096851513.1|4151825_4152857_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	1.2e-35
WP_001294600.1|4152849_4153503_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|4153542_4154358_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|4154475_4154880_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_032178897.1|4154876_4155584_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260711.1|4155694_4157413_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_062881393.1|4158443_4159154_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635545.1|4159167_4159590_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000417058.1|4160017_4160218_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|4160204_4160465_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_062881392.1|4160513_4161812_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|4161876_4162266_-	VOC family protein	NA	NA	NA	NA	NA
WP_096851512.1|4162322_4164464_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|4164562_4165522_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_062881391.1|4165534_4169017_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	1.1e-208
WP_000569419.1|4169053_4169650_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	3.9e-26
WP_062881390.1|4169646_4170795_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565967.1|4170794_4171583_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|4171586_4172042_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139282.1|4172146_4173172_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|4173175_4173661_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|4173782_4176215_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001295561.1|4176244_4177597_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_000922436.1|4177608_4178466_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001295562.1|4178478_4179237_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
WP_000811923.1|4179425_4180622_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_000622418.1|4180713_4181271_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_000224573.1|4181562_4182288_-	UMP kinase	NA	NA	NA	NA	NA
WP_000818114.1|4182434_4183286_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_000246884.1|4183543_4184269_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_001018194.1|4184636_4185431_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_062881389.1|4185492_4188165_+	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_062881388.1|4188195_4189020_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_000272188.1|4189334_4189721_+	DUF3461 family protein	NA	NA	NA	NA	NA
WP_000929439.1|4189809_4190967_-	CdaR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000753946.1|4191121_4192546_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 17
NZ_CP024056	Escherichia coli strain SMN197SH3 chromosome, complete genome	5267207	4373522	4414709	5267207	tRNA,tail	Enterobacteria_phage(23.53%)	40	NA	NA
WP_001223181.1|4373522_4374209_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001303782.1|4374608_4374749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|4374844_4375561_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_062881915.1|4375620_4376973_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_062881916.1|4377030_4378455_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	3.6e-09
WP_001188659.1|4378454_4379144_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_000875487.1|4379156_4379630_-	protein CreA	NA	NA	NA	NA	NA
WP_000371666.1|4379840_4380710_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_062881918.1|4380706_4381354_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_024177800.1|4381405_4381918_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000068679.1|4382064_4382391_-	trp operon repressor	NA	NA	NA	NA	NA
WP_062881919.1|4382480_4384418_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.7	2.3e-11
WP_000046749.1|4384628_4386296_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093813.1|4386602_4387835_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
WP_001029692.1|4387855_4389238_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132955.1|4389286_4390255_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_062881920.1|4390360_4391005_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_000105843.1|4391032_4392049_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_062881921.1|4392049_4393381_-	type II toxin-antitoxin system HipA family toxin YjjJ	NA	NA	NA	NA	NA
WP_000224877.1|4393547_4394267_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816471.1|4394323_4395547_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_062881922.1|4395598_4396921_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	6.8e-79
WP_062881923.1|4397087_4397867_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_062881924.1|4398125_4399676_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_077879197.1|4399647_4399800_+	4Fe-4S cluster-binding domain-containing protein	NA	NA	NA	NA	NA
WP_062881925.1|4399806_4400511_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_062881926.1|4400623_4401406_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001299187.1|4401402_4402476_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|4402597_4402759_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295410.1|4402885_4403491_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202564.1|4403883_4405470_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001217539.1|4405689_4405938_+	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_001023420.1|4406306_4406576_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_101974155.1|4406577_4407891_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.2	3.2e-81
WP_101974156.1|4407955_4408555_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.0	5.9e-107
WP_101975672.1|4408621_4412101_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	96.4	0.0e+00
WP_072141513.1|4412337_4412970_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	89.9	1.4e-98
WP_101974159.1|4412915_4413659_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.3	9.8e-144
WP_044723117.1|4413669_4414368_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.8	2.0e-130
WP_000807940.1|4414367_4414709_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
>prophage 18
NZ_CP024056	Escherichia coli strain SMN197SH3 chromosome, complete genome	5267207	4417989	4594432	5267207	transposase,lysis,terminase,holin,integrase,capsid,tail,protease,tRNA,plate,head	Stx2-converting_phage(32.98%)	174	4429011:4429041	4595172:4595202
WP_101975673.1|4417989_4418118_-|tail	phage tail protein	tail	H6WZM0	Escherichia_phage	100.0	2.5e-15
WP_085949012.1|4418194_4418889_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_096851663.1|4419667_4422304_+	fimbrial biogenesis usher protein FimD	NA	NA	NA	NA	NA
WP_001244822.1|4422313_4422844_+	type 1 fimbria minor subunit FimF	NA	NA	NA	NA	NA
WP_000870589.1|4422856_4423360_+	type 1 fimbria minor subunit FimG	NA	NA	NA	NA	NA
WP_096851664.1|4423379_4424282_+	type 1 fimbria D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_000558251.1|4424454_4425798_-	gluconate permease GntP	NA	NA	NA	NA	NA
WP_062881601.1|4426137_4427322_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_062881600.1|4427402_4428863_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.4	1.9e-50
4429011:4429041	attL	GCCGGATAAGGCGTTCACGCCGCATCCGGCA	NA	NA	NA	NA
WP_000833691.1|4429077_4429851_+	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_062881599.1|4429991_4430819_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_120795393.1|4431411_4431495_+	iraD leader peptide	NA	NA	NA	NA	NA
WP_001297236.1|4431491_4431884_+	anti-adapter protein IraD	NA	NA	NA	NA	NA
WP_000340758.1|4431876_4432788_-	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_096851662.1|4432852_4434025_-	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_000211971.1|4434037_4434499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295597.1|4434495_4435179_-	nucleoside recognition pore and gate family inner membrane transporter	NA	NA	NA	NA	NA
WP_062881598.1|4435428_4435983_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.0e-37
WP_001141195.1|4435995_4437174_-	MFS transporter	NA	NA	NA	NA	NA
WP_001298932.1|4437241_4438102_-	YjiK family protein	NA	NA	NA	NA	NA
WP_000657675.1|4438166_4438424_-	DUF3343 domain-containing protein	NA	NA	NA	NA	NA
WP_000222496.1|4438420_4439188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299707.1|4439197_4440349_-	2-hydroxyacyl-CoA dehydratase subunit D	NA	NA	NA	NA	NA
WP_062881597.1|4440464_4441745_-	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_062881596.1|4441785_4443018_-	multidrug efflux MFS transporter MdtM	NA	NA	NA	NA	NA
WP_001380871.1|4443275_4443488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062881595.1|4443484_4444429_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.7	5.9e-61
WP_000199311.1|4444671_4446084_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000394278.1|4446260_4446425_+	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_062881594.1|4446522_4448616_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000132623.1|4448662_4449004_-	endoribonuclease SymE	NA	NA	NA	NA	NA
WP_085949012.1|4449114_4449809_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_062881360.1|4449992_4453256_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	26.8	5.2e-48
WP_000535016.1|4453350_4454748_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_062881361.1|4454737_4456357_-	type I restriction-modification system subunit M	NA	A0A2H4UVW8	Bodo_saltans_virus	21.9	8.5e-07
WP_062881362.1|4456420_4457587_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_000063156.1|4457899_4458202_+	BrnA antitoxin family protein	NA	NA	NA	NA	NA
WP_062881364.1|4458235_4459192_-	GTPase	NA	NA	NA	NA	NA
WP_000467859.1|4459202_4459406_-	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_001295524.1|4459455_4461606_-	pyruvate/proton symporter BtsT	NA	NA	NA	NA	NA
WP_062881365.1|4461982_4463647_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	7.3e-14
WP_000410144.1|4463695_4465057_-	MFS transporter	NA	NA	NA	NA	NA
WP_000091572.1|4465271_4466186_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106043.1|4466324_4467347_+	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
WP_001765401.1|4467484_4469776_-	phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase	NA	NA	NA	NA	NA
WP_001308243.1|4470029_4470524_-	DUF2501 domain-containing protein	NA	NA	NA	NA	NA
WP_000799911.1|4470572_4471310_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_062881366.1|4471312_4471852_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.2e-28
WP_000538191.1|4471958_4472432_-	threonine/serine exporter	NA	NA	NA	NA	NA
WP_062881367.1|4472422_4473193_-	threonine/serine exporter ThrE family protein	NA	NA	NA	NA	NA
WP_085949012.1|4473732_4474427_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_047082098.1|4474587_4475313_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001300509.1|4475270_4475948_+	DNA-binding transcriptional activator BglJ	NA	NA	NA	NA	NA
WP_062881368.1|4475984_4476773_-	siderophore-iron reductase FhuF	NA	NA	NA	NA	NA
WP_001558501.1|4476913_4477150_+	DUF1435 domain-containing protein	NA	NA	NA	NA	NA
WP_062881369.1|4477710_4478742_-	16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC	NA	NA	NA	NA	NA
WP_000204018.1|4478844_4479258_+	DNA polymerase III subunit psi	NA	NA	NA	NA	NA
WP_001092461.1|4479226_4479673_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_000870712.1|4479687_4480365_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_001218294.1|4480750_4481974_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	98.0	1.3e-233
WP_024201788.1|4482145_4483051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096851707.1|4484118_4484451_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	100.0	1.5e-43
WP_101974162.1|4484953_4485640_-	ead/Ea22-like family protein	NA	H6WZG2	Escherichia_phage	87.1	3.7e-121
WP_000763383.1|4485636_4485858_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001447493.1|4485956_4486238_-	cell division protein ZapA	NA	Q6H9Z3	Enterobacteria_phage	100.0	3.2e-47
WP_000548531.1|4486248_4486440_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_074434105.1|4486417_4486594_-	DUF1317 family protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	1.3e-22
WP_044804878.1|4486590_4487271_-	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	98.2	1.9e-130
WP_062882635.1|4487267_4488218_-	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	96.8	2.0e-173
WP_000995345.1|4488234_4488516_-	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
WP_000934197.1|4488536_4488818_-	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	100.0	3.0e-45
WP_000917252.1|4488829_4489042_-	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
WP_071526579.1|4489112_4490012_-	hypothetical protein	NA	A0A0P0ZG86	Escherichia_phage	96.2	1.4e-139
WP_001064714.1|4490515_4491469_-	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_000939560.1|4491465_4492935_-	SAM-dependent methyltransferase	NA	A0A2L1IV91	Escherichia_phage	99.6	1.9e-284
WP_001056250.1|4493029_4493743_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_001240875.1|4493838_4494042_+	hypothetical protein	NA	A0A2R2Z333	Escherichia_phage	98.5	9.8e-30
WP_001302923.1|4494212_4494407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001271434.1|4494573_4494951_+	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	98.4	7.6e-60
WP_021500588.1|4494944_4496465_+	DEAD/DEAH box helicase	NA	A0A2R2Z335	Escherichia_phage	99.8	8.3e-307
WP_001694414.1|4496454_4497426_+	toprim domain protein	NA	A0A0H4IPK0	Shigella_phage	100.0	1.9e-195
WP_000402092.1|4497425_4497875_+	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
WP_000813671.1|4497882_4498446_+	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
WP_044164955.1|4498442_4498637_+	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	98.4	1.4e-30
WP_001204859.1|4498629_4499064_+	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_001356551.1|4499312_4499465_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_062881835.1|4499853_4500813_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	99.7	9.6e-176
WP_000738080.1|4500824_4501094_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|4501390_4501714_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_085949012.1|4501901_4502596_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_101974160.1|4502731_4504669_+	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	99.1	0.0e+00
WP_000143458.1|4504805_4504985_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|4505025_4505298_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|4505374_4505590_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_001135289.1|4505589_4506087_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	97.0	2.4e-90
WP_000092313.1|4506083_4506521_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	96.6	4.2e-70
WP_000839224.1|4506723_4507221_+	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|4507217_4507475_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095736.1|4507937_4508165_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279804.1|4508206_4508572_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	4.0e-66
WP_000958416.1|4508861_4509425_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_096957675.1|4509421_4511083_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.5	0.0e+00
WP_053904683.1|4511146_4513084_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.5	0.0e+00
WP_001063025.1|4513128_4513350_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|4515870_4516197_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_101975674.1|4516207_4516558_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	1.0e-58
WP_000573391.1|4516554_4517001_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_071587642.1|4517068_4517341_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	98.9	3.9e-42
WP_001275466.1|4517406_4518123_+|tail	tail protein	tail	B6DZA6	Enterobacteria_phage	99.6	2.8e-127
WP_000710949.1|4518137_4518512_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_158638997.1|4518863_4520129_+	tape measure protein	NA	A0A0P0ZCJ4	Stx2-converting_phage	98.3	4.3e-200
WP_000807940.1|4522093_4522435_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_044723117.1|4522434_4523133_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.8	2.0e-130
WP_101974159.1|4523143_4523887_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.3	9.8e-144
WP_101975672.1|4524700_4528180_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	96.4	0.0e+00
WP_101974156.1|4528246_4528846_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.0	5.9e-107
WP_101974170.1|4528910_4530224_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	3.6e-80
WP_001101700.1|4530225_4530495_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	1.9e-44
WP_122988840.1|4530605_4530683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122993102.1|4530897_4531911_+	peptidase M85	NA	NA	NA	NA	NA
WP_062881456.1|4532282_4532498_-	DinI family protein	NA	Q687E4	Enterobacteria_phage	98.6	1.9e-31
WP_001171554.1|4532596_4532977_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|4532973_4533321_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_101974169.1|4533370_4534909_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	6.5e-299
WP_096851742.1|4537722_4537869_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	55.3	1.9e-06
WP_085949012.1|4537908_4538602_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_001114107.1|4538711_4538957_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_001444515.1|4539571_4539772_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000528254.1|4539725_4540463_+	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	79.0	7.5e-104
WP_000543828.1|4540916_4541954_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000904930.1|4542880_4543441_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_077819749.1|4543566_4543890_+|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	56.4	1.2e-21
WP_000420351.1|4543924_4544446_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_010917875.1|4544525_4544729_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000301578.1|4545412_4545973_-	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	49.1	3.9e-44
WP_001146835.1|4545963_4547046_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000063646.1|4547193_4548480_-|integrase	site-specific integrase	integrase	A0A0N7KZF5	Stx2-converting_phage	100.0	5.8e-253
WP_001193437.1|4548513_4548768_-	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|4548786_4548921_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_001242742.1|4550048_4550399_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	100.0	7.0e-60
WP_000008181.1|4550389_4550926_-	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	100.0	9.7e-101
WP_000081298.1|4551053_4551878_-	YfdQ family protein	NA	A0A0P0ZBZ4	Stx2-converting_phage	100.0	2.7e-150
WP_000135680.1|4551943_4552306_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_085949012.1|4552399_4553093_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_106879271.1|4553707_4557799_-|protease	serine protease autotransporter EspI	protease	Q9LA58	Enterobacterial_phage	44.6	9.0e-311
WP_085949012.1|4559059_4559754_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_024225922.1|4559844_4561107_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.2	1.7e-79
WP_014639402.1|4561573_4562593_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.1	2.4e-44
WP_001295681.1|4564386_4565469_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584117.1|4565468_4566569_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_062882097.1|4566835_4568347_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	1.0e-46
WP_122994985.1|4568441_4568924_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_062882096.1|4568923_4571779_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	7.9e-141
WP_062882095.1|4571834_4573031_-	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_044867122.1|4573223_4573727_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|4573772_4574189_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_000012907.1|4574350_4575355_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_096851600.1|4575427_4577056_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_062882094.1|4577775_4578369_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062882093.1|4578439_4579153_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000230281.1|4579283_4579679_+	RidA family protein	NA	NA	NA	NA	NA
WP_001296693.1|4579959_4580094_+	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000013046.1|4580097_4581033_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|4581045_4581507_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|4581579_4581966_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_096851601.1|4582171_4584868_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|4585008_4585062_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181324.1|4585246_4586194_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001297258.1|4586312_4587734_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_062882091.1|4587783_4589439_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_000187776.1|4589832_4591971_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001106233.1|4592129_4592594_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	3.8e-53
WP_001232246.1|4592638_4593025_-	cytochrome b562	NA	NA	NA	NA	NA
WP_001162171.1|4593079_4594432_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
4595172:4595202	attR	TGCCGGATGCGGCGTGAACGCCTTATCCGGC	NA	NA	NA	NA
>prophage 19
NZ_CP024056	Escherichia coli strain SMN197SH3 chromosome, complete genome	5267207	4631850	4677299	5267207	transposase,tRNA,protease	Ralstonia_phage(12.5%)	45	NA	NA
WP_085949012.1|4631850_4632544_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_106879272.1|4632549_4633164_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4633234_4633684_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4633725_4633953_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4633957_4634272_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|4634278_4634674_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_062882078.1|4635000_4635276_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_096851693.1|4635350_4635902_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_001170827.1|4635998_4636685_-	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_000949540.1|4636684_4637539_-	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_000056760.1|4637548_4638199_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_096851694.1|4638212_4638677_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218360.1|4638686_4638992_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001350568.1|4639007_4640405_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001301370.1|4640759_4641824_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|4641931_4642687_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569726.1|4642683_4643433_-	esterase	NA	NA	NA	NA	NA
WP_000254642.1|4643614_4643944_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_024225902.1|4644092_4644368_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001299838.1|4644484_4646110_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_062882075.1|4646192_4647344_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.6	3.1e-80
WP_029785204.1|4647993_4648335_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_101974164.1|4649569_4650721_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000220137.1|4651058_4651460_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|4651586_4652318_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_062882710.1|4652498_4654940_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	2.9e-67
WP_001177639.1|4654978_4655404_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4655608_4656907_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4657010_4657208_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4657289_4658294_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4658296_4659556_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_062882709.1|4659641_4660922_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|4660998_4661307_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280345.1|4661392_4662343_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_062882708.1|4662335_4664183_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	3.4e-60
WP_000990262.1|4664192_4665527_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|4665545_4666007_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_001295189.1|4665978_4667526_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_062882707.1|4667524_4668664_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_010723271.1|4668646_4668700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|4669564_4670110_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041970.1|4670204_4671257_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_000934912.1|4671353_4672322_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_032204757.1|4672343_4675667_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_085949012.1|4676605_4677299_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP024056	Escherichia coli strain SMN197SH3 chromosome, complete genome	5267207	4825223	4876840	5267207	transposase,terminase,holin,tail	Enterobacteria_phage(31.11%)	54	NA	NA
WP_085949012.1|4825223_4825918_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_001295689.1|4826674_4826956_+	membrane protein	NA	NA	NA	NA	NA
WP_000168305.1|4827054_4827591_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_062881699.1|4827845_4830668_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000155657.1|4830702_4831059_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000270372.1|4831062_4831479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001226928.1|4831589_4832303_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_024225944.1|4833428_4834622_-	aromatic amino acid transaminase	NA	NA	NA	NA	NA
WP_062881698.1|4834874_4835954_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	4.0e-29
WP_000918363.1|4836006_4837422_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_000235516.1|4837504_4838488_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_096851731.1|4840832_4843547_+	DUF4765 family protein	NA	A0A0N7KZG3	Stx2-converting_phage	100.0	0.0e+00
WP_085949012.1|4843582_4844276_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_001101699.1|4847186_4847456_-|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	98.9	1.9e-44
WP_101975676.1|4847457_4848771_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	5.5e-81
WP_101975677.1|4848835_4849435_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.5	2.0e-110
WP_101975678.1|4849501_4852978_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.2	0.0e+00
WP_101974172.1|4852982_4853246_-	hypothetical protein	NA	A0A0N7KZG0	Stx2-converting_phage	100.0	3.7e-45
WP_000958416.1|4853242_4853806_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001303046.1|4854093_4854459_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000095749.1|4854500_4854728_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_012578895.1|4855152_4855338_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_001043239.1|4855559_4855778_-	hypothetical protein	NA	Q687G2	Enterobacteria_phage	93.3	1.0e-16
WP_000992122.1|4855855_4856389_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_000731236.1|4856439_4856784_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000411809.1|4856788_4856995_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_101974173.1|4857442_4859293_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001344632.1|4859735_4859867_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_062882414.1|4860737_4861796_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	86.7	4.9e-181
WP_000917723.1|4861946_4862150_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	98.5	1.8e-31
WP_096851713.1|4862420_4862867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001577385.1|4862951_4863317_-	antitermination protein Q	NA	Q777W5	Enterobacteria_phage	81.8	7.9e-54
WP_062882412.1|4863334_4864324_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	4.7e-194
WP_001072673.1|4864331_4865147_-	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.6	2.9e-149
WP_062882411.1|4865309_4865705_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	96.0	9.1e-64
WP_000066918.1|4865701_4866355_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	99.5	3.3e-127
WP_044806531.1|4866449_4867256_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	88.1	7.9e-123
WP_024185668.1|4867252_4867477_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	94.6	8.5e-35
WP_001542463.1|4867481_4868027_-	ash family protein	NA	Q8SBF3	Shigella_phage	98.9	4.0e-94
WP_071593530.1|4867989_4868169_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	94.9	5.0e-30
WP_000521508.1|4868315_4868867_-	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
WP_000649477.1|4868910_4869111_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_062881953.1|4869201_4869876_+	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	99.1	8.6e-131
WP_000135680.1|4870544_4870907_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081287.1|4870971_4871796_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008232.1|4871923_4872460_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	100.0	7.4e-101
WP_062881955.1|4872450_4872813_+	hypothetical protein	NA	S5MC15	Escherichia_phage	99.2	2.1e-67
WP_062881956.1|4872809_4873013_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	5.2e-31
WP_000476212.1|4873005_4873245_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	100.0	4.4e-37
WP_040092683.1|4873241_4873796_+	ead/Ea22-like family protein	NA	K7PJQ4	Enterobacteria_phage	99.5	4.1e-102
WP_001014289.1|4873797_4873989_+	hypothetical protein	NA	K7PKJ7	Enterobacteria_phage	98.4	1.6e-26
WP_001061345.1|4874998_4875571_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	100.0	2.4e-110
WP_001093917.1|4875607_4875889_+	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	96.8	2.8e-43
WP_062881958.1|4876306_4876840_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	99.4	5.3e-99
>prophage 1
NZ_CP024055	Escherichia coli strain SMN197SH3 plasmid pO177A3, complete sequence	88839	3623	68417	88839	integrase,transposase,protease	Stx2-converting_phage(40.0%)	49	NA	NA
WP_101974169.1|3623_5162_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	6.5e-299
WP_000612591.1|5211_5559_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|5555_5936_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_032205206.1|6169_6535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000789660.1|6545_6737_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	41.3	3.5e-05
WP_062881749.1|7041_10944_-|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	5.5e-238
WP_101974169.1|11386_12925_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	6.5e-299
WP_000612591.1|12974_13322_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|13581_13962_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|13958_14306_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_101974169.1|14355_15894_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	6.5e-299
WP_001302181.1|16487_17486_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000550559.1|17559_19281_-	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_064769442.1|19370_20477_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001302199.1|20476_21298_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001014904.1|21564_21807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101974067.1|22753_23967_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.0	8.4e-169
WP_000850423.1|24601_25333_-	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_096851682.1|25855_27017_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_096851683.1|27031_29809_-	conjugal transfer mating pair stabilization protein TraG	NA	NA	NA	NA	NA
WP_062881573.1|29805_31179_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_074433934.1|31165_31591_-	F-type conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_074433933.1|31544_31886_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_000059833.1|31815_32361_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_062881570.1|32347_32632_-	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
WP_001287908.1|32989_33337_-	conjugal transfer protein TrbA	NA	NA	NA	NA	NA
WP_062881569.1|33352_34096_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_000864318.1|34088_34346_-	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_074433935.1|34372_35764_-	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_062881567.1|36174_36462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062881565.1|36702_37089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001027495.1|37207_37399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271685.1|37395_37818_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_010891293.1|37864_38167_-	antirestriction protein	NA	NA	NA	NA	NA
WP_000085939.1|39955_40639_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.9e-29
WP_062881562.1|40715_41021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096851684.1|41024_41927_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000817031.1|42578_43550_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000772446.1|43549_44716_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_101974067.1|45365_46579_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.0	8.4e-169
WP_000361612.1|47363_48341_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	3.9e-100
WP_062882567.1|48625_49366_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_032204852.1|49876_50161_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001172748.1|51261_51651_-	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_000592771.1|51694_53905_-	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_101974067.1|54080_55293_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.0	8.4e-169
WP_106879220.1|55963_56017_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_101974185.1|62398_67102_+	DUF3491 domain-containing protein	NA	NA	NA	NA	NA
WP_085952403.1|67204_68417_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
