The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022279	Escherichia coli strain STEC299 chromosome, complete genome	4907118	45004	57177	4907118	integrase	Enterobacteria_phage(88.89%)	13	46093:46115	57338:57360
WP_001280585.1|45004_46042_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	43.6	5.7e-73
46093:46115	attL	TTTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
WP_053895792.1|46590_48924_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
WP_000856729.1|48938_49259_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459294.1|49394_49850_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_001244665.1|49842_50130_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_001360858.1|50122_50722_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	81.8	3.0e-50
WP_001149160.1|50718_50985_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_101973404.1|51536_52271_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.0	1.3e-127
WP_000638628.1|52267_52768_+	transactivation protein	NA	NA	NA	NA	NA
WP_000446131.1|52841_53414_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	6.5e-95
WP_101973405.1|53736_55146_+	maturase	NA	NA	NA	NA	NA
WP_101973406.1|55244_55982_+	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_024229489.1|55998_57177_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	91.2	1.1e-208
57338:57360	attR	TTTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
>prophage 2
NZ_CP022279	Escherichia coli strain STEC299 chromosome, complete genome	4907118	1053545	1060685	4907118		Escherichia_phage(83.33%)	6	NA	NA
WP_001278992.1|1053545_1054184_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.8e-82
WP_000590376.1|1054180_1055443_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	3.7e-135
WP_000847998.1|1055439_1056348_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	5.1e-118
WP_001296319.1|1056543_1057311_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_001141304.1|1057361_1058018_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	8.6e-51
WP_000103863.1|1058123_1060685_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
>prophage 3
NZ_CP022279	Escherichia coli strain STEC299 chromosome, complete genome	4907118	1635684	1645126	4907118		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569384.1|1635684_1636611_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.2e-23
WP_000783106.1|1636615_1637347_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1637327_1637435_-	protein YohO	NA	NA	NA	NA	NA
WP_001240405.1|1637494_1638226_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.2e-111
WP_001334139.1|1638447_1640133_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	9.5e-304
WP_012311742.1|1640129_1640849_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1640895_1641366_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|1641406_1641868_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_021520892.1|1641992_1643993_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_021520891.1|1643989_1645126_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	98.0	7.7e-164
>prophage 4
NZ_CP022279	Escherichia coli strain STEC299 chromosome, complete genome	4907118	1845615	1971831	4907118	capsid,head,portal,integrase,transposase,terminase,holin,tail	Escherichia_phage(32.32%)	147	1958553:1958568	1978620:1978635
WP_033553439.1|1845615_1846878_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.0	6.2e-74
WP_001325918.1|1847215_1848013_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_044190935.1|1848248_1849274_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	56.7	7.5e-102
WP_087614020.1|1849273_1849477_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_101973493.1|1849535_1851971_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	54.4	2.0e-52
WP_101973494.1|1852066_1852255_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_101973495.1|1852251_1852440_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_158639737.1|1852808_1853213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101973863.1|1853202_1853583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101973496.1|1853594_1853747_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.5	3.3e-06
WP_101973497.1|1854021_1854312_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_101973498.1|1854311_1854503_-	antitoxin	NA	NA	NA	NA	NA
WP_101973499.1|1854520_1855021_-	helix-turn-helix transcriptional regulator	NA	A0A0U2QW76	Escherichia_phage	54.5	1.4e-16
WP_101973500.1|1855128_1855392_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_101973501.1|1855388_1855814_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_101973864.1|1855836_1856805_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	52.7	4.8e-74
WP_101973502.1|1856811_1857558_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.4	3.1e-113
WP_101973503.1|1857579_1858302_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.9	1.1e-80
WP_101973865.1|1858334_1858616_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.8e-29
WP_101973504.1|1858612_1858909_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	90.5	3.2e-45
WP_101973866.1|1859431_1859683_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	1.3e-12
WP_101973867.1|1859784_1859889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101973505.1|1860060_1860705_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.7	9.6e-55
WP_101973506.1|1860689_1861916_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	32.5	1.9e-59
WP_101973507.1|1862132_1862405_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	9.4e-12
WP_101973508.1|1862406_1863456_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	5.0e-109
WP_101973509.1|1863825_1864647_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	2.2e-80
WP_000917768.1|1864874_1865072_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	100.0	6.1e-29
WP_101973510.1|1865222_1866281_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	93.5	1.3e-197
WP_101973512.1|1866870_1867206_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	81.3	4.5e-48
WP_158639714.1|1868210_1869461_+	hypothetical protein	NA	A0A2R2Z342	Escherichia_phage	40.3	1.7e-79
WP_033553189.1|1869615_1869801_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	58.3	4.2e-11
WP_101973514.1|1869706_1870099_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_087906417.1|1870176_1870392_+|holin	holin	holin	G9L6J5	Escherichia_phage	97.2	1.7e-32
WP_101973515.1|1870396_1870930_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.9	1.4e-99
WP_000675931.1|1871151_1871265_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_158639715.1|1871652_1871838_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	74.6	2.1e-15
WP_033552860.1|1871923_1872148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101973517.1|1873157_1873328_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	1.3e-19
WP_101973518.1|1873370_1873736_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	87.6	4.9e-56
WP_101973519.1|1874029_1874593_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	78.0	6.9e-65
WP_101973520.1|1874589_1876251_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.4	0.0e+00
WP_101973521.1|1876314_1878252_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	97.8	0.0e+00
WP_101973522.1|1878296_1878518_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	89.0	1.1e-29
WP_000125988.1|1880882_1881209_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_101973523.1|1881219_1881570_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	98.3	1.0e-58
WP_101973524.1|1881566_1882013_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	97.3	2.9e-74
WP_101973525.1|1882009_1882354_+	DUF3168 domain-containing protein	NA	A0A0N7KZG1	Stx2-converting_phage	91.2	6.5e-50
WP_101973526.1|1882413_1883130_+|tail	phage tail protein	tail	B6DZA6	Enterobacteria_phage	96.6	1.4e-123
WP_101973527.1|1883144_1883519_+|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	96.8	2.1e-62
WP_158639738.1|1883614_1883824_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	91.3	1.4e-31
WP_101973529.1|1883887_1884301_+	hypothetical protein	NA	B9UDL3	Salmonella_phage	68.1	5.1e-49
WP_101973530.1|1884364_1887610_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	87.9	0.0e+00
WP_101973868.1|1887602_1887944_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	83.2	4.5e-51
WP_101973531.1|1887943_1888642_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	1.1e-128
WP_101973532.1|1888647_1889391_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	93.9	6.4e-143
WP_158639739.1|1889336_1889969_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	88.1	1.8e-93
WP_101973534.1|1890221_1893608_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	86.2	0.0e+00
WP_101973535.1|1893675_1894275_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	88.9	4.7e-96
WP_101973536.1|1894338_1895397_+|tail	phage tail protein	tail	Q9LA62	Enterobacterial_phage	69.9	1.0e-32
WP_101973869.1|1895479_1896013_+	DUF4376 domain-containing protein	NA	A0A2L1IV45	Escherichia_phage	44.7	1.2e-34
WP_158639716.1|1896170_1896374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101973538.1|1896571_1896793_-	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	45.8	3.7e-06
WP_101973539.1|1897354_1898485_+	hypothetical protein	NA	A0A2L1IV32	Escherichia_phage	55.6	3.5e-84
WP_101973540.1|1898576_1899104_+	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	73.9	1.6e-60
WP_101973541.1|1899347_1899680_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_044190935.1|1900003_1901029_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	56.7	7.5e-102
WP_087614020.1|1901028_1901232_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_101973493.1|1901290_1903726_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	54.4	2.0e-52
WP_101973494.1|1903821_1904010_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_101973495.1|1904006_1904195_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_158639737.1|1904563_1904968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101973863.1|1904957_1905338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101973496.1|1905349_1905502_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.5	3.3e-06
WP_000362152.1|1905769_1906189_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	4.0e-25
WP_000391948.1|1906289_1906571_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000693883.1|1906554_1906980_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_101973542.1|1907051_1908122_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	61.1	1.8e-58
WP_101973543.1|1908162_1908573_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.7	3.4e-61
WP_101973544.1|1908946_1911238_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000961821.1|1911715_1911928_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_000737636.1|1912071_1912464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001345469.1|1912760_1913039_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	2.2e-11
WP_101973545.1|1913040_1914096_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.8	1.7e-88
WP_101973546.1|1914096_1914477_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.8	4.2e-34
WP_000762902.1|1914473_1915295_+	hypothetical protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
WP_001344632.1|1915891_1916023_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_101973547.1|1916467_1918318_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000411813.1|1918761_1918968_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	1.2e-30
WP_101973548.1|1918972_1919593_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	90.0	7.1e-55
WP_001422849.1|1919771_1919960_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	74.2	3.8e-20
WP_096853710.1|1919996_1920530_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.7	2.5e-101
WP_032140280.1|1921084_1921171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012816791.1|1921392_1921578_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|1922105_1922420_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|1922501_1922726_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_000453576.1|1923114_1923660_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_101973549.1|1923634_1925560_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000198149.1|1925556_1925763_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001324962.1|1925759_1927361_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	1.9e-309
WP_000123236.1|1927341_1928661_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	9.0e-233
WP_001299443.1|1928670_1929003_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000063260.1|1929058_1930084_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.1	3.4e-187
WP_000158899.1|1930125_1930521_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.0e-55
WP_000753019.1|1930532_1930886_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000975054.1|1930897_1931476_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	3.5e-80
WP_000683105.1|1931472_1931868_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001349920.1|1931875_1932616_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000479153.1|1932631_1933054_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459457.1|1933035_1933470_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840258.1|1933462_1936024_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.6	0.0e+00
WP_000847401.1|1936020_1936350_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
WP_001152612.1|1936349_1937048_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_101973550.1|1937053_1937797_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.1e-146
WP_158639717.1|1937733_1938366_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	97.6	2.1e-94
WP_101973552.1|1938426_1941906_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.1	0.0e+00
WP_101973553.1|1941973_1942573_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	91.5	3.7e-101
WP_158639718.1|1942637_1944224_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	100.0	7.1e-59
WP_001118092.1|1944334_1944916_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.3	4.6e-48
WP_001359536.1|1944988_1945618_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	5.1e-77
WP_001143784.1|1945699_1946341_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_101973555.1|1947075_1947912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001519863.1|1948128_1948347_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	51.9	1.2e-09
WP_101973556.1|1948428_1948719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101973557.1|1948771_1949068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101973558.1|1949141_1949384_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_101973559.1|1949492_1949843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287374.1|1949907_1950312_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_044706493.1|1950469_1950949_-	DUF4756 family protein	NA	NA	NA	NA	NA
WP_001519857.1|1951103_1951649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024009117.1|1952551_1952821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101973560.1|1952904_1953291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101973561.1|1953346_1954327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001607568.1|1955290_1956160_-	hypothetical protein	NA	A0A2H4J8H9	uncultured_Caudovirales_phage	38.6	2.7e-15
WP_001764625.1|1956521_1957025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033552360.1|1957076_1959746_+	DotA/TraY family protein	NA	NA	NA	NA	NA
1958553:1958568	attL	GATACAACGGCAGCAA	NA	NA	NA	NA
WP_001607561.1|1960196_1960931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033552359.1|1961812_1962190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032334768.1|1962823_1963828_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001608347.1|1964689_1964998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001608346.1|1965001_1965880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021512051.1|1966184_1966550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021512052.1|1966546_1966852_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_000243502.1|1967248_1967806_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_021512053.1|1967858_1969322_+	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
WP_033553042.1|1969434_1970448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021512055.1|1970580_1971831_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.5	2.9e-79
1978620:1978635	attR	GATACAACGGCAGCAA	NA	NA	NA	NA
>prophage 5
NZ_CP022279	Escherichia coli strain STEC299 chromosome, complete genome	4907118	2052195	2104856	4907118	head,transposase,integrase,protease,tRNA,tail,plate	Shigella_phage(57.89%)	68	2059659:2059676	2111426:2111443
WP_001025326.1|2052195_2053929_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_021524240.1|2054144_2054711_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185734.1|2054724_2055471_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214286.1|2055858_2056959_+	cytochrome c	NA	NA	NA	NA	NA
WP_101973566.1|2057701_2058439_-	protein mom	NA	A0A0C4UQZ7	Shigella_phage	77.7	1.9e-102
WP_001443803.1|2058392_2058593_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001536755.1|2059248_2059449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101973567.1|2059523_2059769_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
2059659:2059676	attL	TTGTGCCTCAAAATCCTT	NA	NA	NA	NA
WP_101973568.1|2059804_2059987_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	56.1	3.5e-10
WP_101973569.1|2060115_2062248_-	sialate O-acetylesterase	NA	B6DZ89	Enterobacteria_phage	53.0	2.3e-169
WP_101973570.1|2062333_2062900_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	75.8	3.9e-76
WP_101973572.1|2063120_2063336_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_101973871.1|2063422_2063944_+|tail	phage tail protein	tail	A0A0U2QV64	Escherichia_phage	46.8	3.1e-43
WP_101973573.1|2063977_2064889_-|tail	phage tail protein	tail	C9DGQ8	Escherichia_phage	39.5	3.7e-28
WP_101973574.1|2064888_2065449_-	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.6	3.5e-45
WP_001146843.1|2065439_2066522_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000763302.1|2066521_2066959_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	57.6	1.6e-40
WP_077627266.1|2066951_2067566_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	50.8	1.2e-51
WP_101973575.1|2067555_2068683_-|tail	phage tail protein	tail	C9DGQ3	Escherichia_phage	47.7	5.7e-95
WP_101973576.1|2068666_2070025_-	multidrug DMT transporter permease	NA	A0A0C4UR32	Shigella_phage	29.9	2.8e-48
WP_101973577.1|2070011_2072069_-	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	38.9	8.3e-76
WP_000107489.1|2072196_2072673_-	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.4	9.4e-23
WP_046201616.1|2072687_2073053_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_101973578.1|2073061_2074543_-|tail	phage tail protein	tail	A0A0C4UQS0	Shigella_phage	52.7	2.2e-134
WP_101973579.1|2074542_2074821_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_101973580.1|2074824_2075388_-	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	48.3	5.7e-43
WP_001104953.1|2075384_2075804_-	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	54.3	6.1e-34
WP_158639719.1|2075800_2076208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101973581.1|2076251_2077199_-|head	head protein	head	A0A0C4UQR9	Shigella_phage	66.9	7.9e-122
WP_101973582.1|2077198_2078323_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.6	2.4e-77
WP_101973583.1|2078499_2078973_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	54.6	7.8e-38
WP_101973584.1|2079098_2080424_-|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	59.3	5.4e-153
WP_101973585.1|2080407_2081997_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.9	1.1e-168
WP_101973586.1|2081996_2083661_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	72.9	5.8e-229
WP_101973587.1|2083660_2083909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000360580.1|2083919_2084501_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	4.2e-49
WP_001279080.1|2084503_2084794_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	2.1e-25
WP_000270160.1|2084786_2085098_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_101973588.1|2085078_2085306_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_158639720.1|2085316_2085535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158639721.1|2085518_2085947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101973590.1|2085981_2086482_-	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.9e-27
WP_000852372.1|2086553_2086976_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_101973591.1|2087046_2087556_-	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	43.1	3.1e-24
WP_101973592.1|2087552_2087849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001086882.1|2087838_2088036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158639722.1|2088028_2088361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101973594.1|2088399_2088585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101973595.1|2088581_2089133_-	AsnC family protein	NA	NA	NA	NA	NA
WP_101973596.1|2089129_2089651_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	54.2	3.0e-46
WP_101973597.1|2089650_2090184_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.8	1.1e-67
WP_101973598.1|2090187_2090730_-	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	8.4e-28
WP_101973599.1|2090827_2091358_-	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	2.5e-48
WP_101973600.1|2091369_2091666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101973601.1|2091662_2091944_-	host nuclease inhibitor protein	NA	I6WB15	Burkholderia_virus	42.3	3.5e-09
WP_101973602.1|2091945_2092173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101973603.1|2092159_2092579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101973604.1|2092591_2092813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101973605.1|2092815_2093748_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	49.0	8.1e-71
WP_101973606.1|2093830_2095915_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	45.4	4.5e-154
WP_001448748.1|2095895_2096141_-	transcriptional regulator	NA	M1PVU4	Vibrio_phage	58.7	1.3e-12
WP_050866372.1|2096359_2096878_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000564725.1|2099192_2100164_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|2100160_2100904_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|2100944_2101340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000639284.1|2101392_2102211_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	98.4	3.2e-71
WP_000891620.1|2102207_2102774_-	hydrolase	NA	NA	NA	NA	NA
WP_001258675.1|2103083_2104856_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
2111426:2111443	attR	AAGGATTTTGAGGCACAA	NA	NA	NA	NA
>prophage 6
NZ_CP022279	Escherichia coli strain STEC299 chromosome, complete genome	4907118	2322647	2470240	4907118	capsid,head,portal,integrase,lysis,transposase,terminase,tRNA,protease,tail	Enterobacteria_phage(37.14%)	160	2340410:2340426	2458130:2458146
WP_001339629.1|2322647_2323922_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
WP_001296097.1|2323983_2324844_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_000765756.1|2324887_2325493_-	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_000100937.1|2325598_2327101_-	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_001030339.1|2327711_2328347_-	endonuclease III	NA	NA	NA	NA	NA
WP_001289646.1|2328346_2329042_-	electron transport complex subunit E	NA	NA	NA	NA	NA
WP_000920782.1|2329045_2329666_-	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_000231938.1|2329669_2330728_-	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_000915721.1|2330728_2332855_-	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_000991797.1|2332847_2333426_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_000133193.1|2333425_2334007_-	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_000214176.1|2334083_2334524_-	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_101973616.1|2334609_2334825_-	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_001296096.1|2335098_2335224_-	division septum protein Blr	NA	NA	NA	NA	NA
WP_001282537.1|2335466_2336507_+	oxidoreductase	NA	NA	NA	NA	NA
WP_021524188.1|2336542_2337544_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_000459358.1|2337647_2338820_-	bifunctional maltose regulon transcriptional repressor/cystathionine beta-lyase MalY	NA	NA	NA	NA	NA
WP_000125605.1|2338829_2340422_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
2340410:2340426	attL	TTTTCGCCGTCATAAAA	NA	NA	NA	NA
WP_101973617.1|2340596_2341625_+	Mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_000483379.1|2341736_2342504_+	7-alpha-hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
WP_101973618.1|2342732_2343323_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000945913.1|2343710_2345522_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.8	0.0e+00
WP_001075831.1|2345518_2346892_+	glucuronide transporter	NA	NA	NA	NA	NA
WP_001227065.1|2346930_2348196_+	glucuronide uptake porin UidC	NA	NA	NA	NA	NA
WP_001043378.1|2348240_2349749_-	YdgA family protein	NA	NA	NA	NA	NA
WP_001170646.1|2349849_2351025_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000066637.1|2351223_2352870_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_001099099.1|2353012_2354416_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_001327661.1|2354412_2355342_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_000732519.1|2355417_2356719_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.6	2.5e-17
WP_001298660.1|2356722_2357442_-	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000524861.1|2357570_2357906_+	GlpM family protein	NA	NA	NA	NA	NA
WP_000520812.1|2357902_2358625_-	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_000412379.1|2358661_2360044_-	amino acid permease	NA	NA	NA	NA	NA
WP_000769322.1|2360229_2361174_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001298661.1|2361697_2363230_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000014031.1|2363240_2364629_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000085275.1|2365735_2366965_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.4	4.6e-130
WP_000953271.1|2367339_2367528_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
WP_000226782.1|2368332_2368530_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_101973619.1|2368522_2368735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001368043.1|2368724_2368964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101973620.1|2368956_2369178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101973621.1|2369417_2369717_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_101973622.1|2369713_2371120_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	56.2	4.8e-107
WP_000192400.1|2371320_2371572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101973623.1|2371922_2372195_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_016241304.1|2372319_2372544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001137341.1|2372836_2373994_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.1e-137
WP_101973625.1|2374033_2374606_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	8.0e-61
WP_001398592.1|2374643_2375819_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	80.2	4.8e-185
WP_001020670.1|2375815_2376154_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	53.6	1.7e-31
WP_000134114.1|2376150_2376447_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	2.4e-32
WP_001145904.1|2376446_2376887_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	1.9e-62
WP_000113645.1|2377175_2377532_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_101973626.1|2377515_2379177_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.7	5.2e-278
WP_000133417.1|2379190_2379472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158639723.1|2379607_2379910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303517.1|2380846_2381017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000276149.1|2381123_2381489_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_000046660.1|2381475_2381805_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_001260849.1|2381843_2382665_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2382764_2382848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033553179.1|2382940_2383276_-	acid shock protein	NA	NA	NA	NA	NA
WP_000225276.1|2386063_2387284_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|2387408_2388104_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071780494.1|2388056_2389349_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148695.1|2389509_2390124_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	5.1e-29
WP_033553181.1|2390166_2391021_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_016265898.1|2391645_2394069_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	3.7e-208
WP_000778146.1|2396754_2397060_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001350228.1|2397167_2397878_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|2397880_2398441_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705201.1|2398475_2398817_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001304355.1|2398951_2399278_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.9e-23
WP_001298659.1|2399483_2400698_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.5	2.8e-47
WP_000836075.1|2400709_2401729_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	5.7e-17
WP_001513307.1|2401786_2401897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877001.1|2401916_2403197_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_001296941.1|2403231_2403468_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_021520755.1|2403555_2406027_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083280.1|2406120_2406312_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2406308_2406497_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_158639724.1|2406983_2407559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021526337.1|2407560_2407716_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.2e-07
WP_038354783.1|2407882_2408290_-	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000920568.1|2408373_2408604_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_095716202.1|2408587_2409109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042021323.1|2409089_2410055_+	phage O protein family	NA	U5P0A0	Shigella_phage	60.2	5.0e-55
WP_001151183.1|2410095_2410518_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.8	2.3e-65
WP_001366387.1|2410514_2410748_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	67.9	2.9e-17
WP_021568046.1|2410801_2411467_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000887491.1|2412025_2412238_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_001455283.1|2412791_2413814_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	5.4e-201
WP_080360997.1|2413810_2414593_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.0e-138
WP_095716204.1|2414731_2415010_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_024223300.1|2415011_2416061_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.9	2.0e-113
WP_001047121.1|2416074_2416827_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	96.8	2.1e-133
WP_101973629.1|2417987_2418173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795389.1|2418798_2418888_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|2418942_2419155_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066485.1|2419455_2419671_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	7.7e-25
WP_000839590.1|2420424_2420640_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189921.1|2420644_2420956_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	63.6	1.0e-25
WP_001092973.1|2420952_2421486_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	92.7	8.4e-97
WP_001071769.1|2421482_2421980_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|2422343_2422556_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2422566_2422755_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|2422757_2422823_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|2422902_2423058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019139.1|2423230_2423404_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001531698.1|2423555_2423966_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	91.2	5.0e-65
WP_001031431.1|2424266_2424473_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
WP_000421825.1|2425018_2425558_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_101973630.1|2425566_2427666_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	98.9	0.0e+00
WP_001072975.1|2427662_2427875_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985947.1|2427874_2429383_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	1.6e-289
WP_077780990.1|2429327_2431355_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.5	0.0e+00
WP_001097050.1|2431441_2431765_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283158.1|2431757_2432033_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	6.6e-45
WP_000677120.1|2432044_2432635_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.1	7.2e-81
WP_001079419.1|2432631_2433033_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_000211128.1|2433043_2433787_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.0	1.6e-130
WP_001298500.1|2433847_2434234_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
WP_001161009.1|2434242_2434572_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_101973631.1|2434543_2437600_+|tail	phage tail tape measure protein	tail	A5LH38	Enterobacteria_phage	98.1	0.0e+00
WP_000447253.1|2437599_2437929_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001545203.1|2437938_2438637_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.0e-134
WP_000194743.1|2438641_2439385_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	2.7e-149
WP_001445893.1|2439282_2439930_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	98.1	2.7e-113
WP_101973632.1|2439990_2443386_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.2	0.0e+00
WP_101973633.1|2443444_2445817_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.0	1.1e-167
WP_033560585.1|2445816_2446098_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	1.8e-18
WP_021560598.1|2446107_2447148_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.6	4.9e-125
WP_000355601.1|2447190_2447484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071528129.1|2447524_2447614_+	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	82.8	1.1e-06
WP_000087134.1|2447711_2448302_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	35.9	2.8e-24
WP_000836765.1|2448620_2448854_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	3.2e-32
WP_120795384.1|2448922_2449036_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347479.1|2449639_2450923_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_021540982.1|2451011_2452472_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	3.9e-43
WP_000214712.1|2452507_2452711_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000215549.1|2452888_2453575_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296081.1|2453663_2454410_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_012601503.1|2454546_2456592_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_001357327.1|2456683_2456845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000592831.1|2457098_2457989_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	39.0	9.6e-21
WP_000901367.1|2458208_2458304_-	protein MgtS	NA	NA	NA	NA	NA
2458130:2458146	attR	TTTTCGCCGTCATAAAA	NA	NA	NA	NA
WP_101973634.1|2458430_2459618_-	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000087205.1|2459812_2460712_+	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_000577184.1|2460756_2461455_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000722574.1|2461652_2461964_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_101973635.1|2462078_2463401_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_001334386.1|2463428_2463740_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_021524180.1|2463794_2465468_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_000803537.1|2466987_2467206_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091198.1|2467237_2467621_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000843419.1|2467641_2468076_-	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000885033.1|2468287_2468953_+	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_032334768.1|2469235_2470240_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP022279	Escherichia coli strain STEC299 chromosome, complete genome	4907118	2680302	2745609	4907118	capsid,head,portal,transposase,lysis,integrase,terminase,holin,protease,tail	Escherichia_phage(31.25%)	73	2685020:2685035	2752974:2752989
WP_000422063.1|2680302_2681352_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559258.1|2681571_2682330_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	9.7e-06
WP_001278898.1|2682326_2682917_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291206.1|2682956_2683832_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001298087.1|2684044_2685934_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
2685020:2685035	attL	AAAACCTTTATCGTCG	NA	NA	NA	NA
WP_001295575.1|2685961_2686582_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285692.1|2686578_2687460_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2687597_2687642_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194643.1|2687733_2689296_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_016237963.1|2689295_2690891_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	2.9e-52
WP_001541273.1|2690894_2692253_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000209513.1|2692264_2693458_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443098.1|2693457_2694264_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_072145561.1|2694608_2695091_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079498.1|2695136_2695643_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_101973649.1|2696193_2696865_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	81.4	2.0e-103
WP_101973875.1|2697374_2697908_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	46.6	8.3e-36
WP_101973650.1|2697990_2699094_-|tail	phage tail protein	tail	Q9LA62	Enterobacterial_phage	69.9	1.0e-32
WP_101973535.1|2699157_2699757_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	88.9	4.7e-96
WP_101973651.1|2699824_2703211_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	86.1	0.0e+00
WP_101973652.1|2703344_2703872_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_157941823.1|2704140_2704773_-|tail	tail assembly protein	tail	A0A0N7KZG2	Stx2-converting_phage	98.1	6.9e-98
WP_101973654.1|2704718_2705462_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	94.3	9.8e-144
WP_101973655.1|2705467_2706166_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.8	2.6e-130
WP_101973656.1|2706175_2706505_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	92.7	2.4e-54
WP_101973657.1|2706501_2709096_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	70.1	0.0e+00
WP_101973658.1|2709076_2709490_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	2.1e-42
WP_101973659.1|2709516_2709948_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	66.7	5.8e-40
WP_101973660.1|2709967_2710717_-|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	94.8	5.6e-131
WP_101973661.1|2710724_2711120_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	8.8e-59
WP_101973662.1|2711116_2711650_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	1.3e-57
WP_001204533.1|2711665_2712019_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_101973663.1|2712011_2712380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101973664.1|2712432_2713461_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	5.0e-114
WP_101973665.1|2713518_2713866_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_101973666.1|2713902_2715408_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.0	1.3e-99
WP_101973667.1|2715397_2716990_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	1.0e-182
WP_032277387.1|2716986_2717193_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	58.5	1.6e-11
WP_101973668.1|2717176_2719105_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	1.8e-261
WP_101973669.1|2719076_2719586_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.2	2.7e-12
WP_101973670.1|2720289_2720823_+	DUF1398 family protein	NA	NA	NA	NA	NA
WP_158639726.1|2720975_2721164_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	81.4	2.9e-20
WP_101973515.1|2721682_2722216_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.9	1.4e-99
WP_087906417.1|2722220_2722436_-|holin	holin	holin	G9L6J5	Escherichia_phage	97.2	1.7e-32
WP_101973514.1|2722513_2722906_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_033553189.1|2722811_2722997_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	58.3	4.2e-11
WP_158639727.1|2723151_2725137_-	DUF1737 domain-containing protein	NA	A0A0P0ZBH7	Stx2-converting_phage	54.2	1.5e-199
WP_101973673.1|2725471_2725789_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	64.5	1.7e-36
WP_101973674.1|2728319_2728517_-	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	98.5	4.0e-28
WP_042022582.1|2728691_2729405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033552371.1|2729658_2730324_-	antiterminator	NA	I6PDF8	Cronobacter_phage	52.0	3.9e-59
WP_101973675.1|2730320_2730686_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.7	5.5e-39
WP_101973676.1|2730686_2731745_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	47.1	2.2e-88
WP_101973677.1|2731746_2732025_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	9.7e-12
WP_000813254.1|2732192_2732348_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_101973877.1|2732592_2732934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033552788.1|2732981_2733677_-	B3/4 domain-containing protein	NA	NA	NA	NA	NA
WP_101973678.1|2733720_2734323_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_101973679.1|2734855_2735044_-	DUF977 family protein	NA	NA	NA	NA	NA
WP_001317493.1|2735056_2735839_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_101973680.1|2735835_2736858_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	6.0e-200
WP_101973681.1|2737325_2738396_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	64.6	9.4e-63
WP_101973682.1|2738467_2738893_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747951.1|2738876_2739119_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001397087.1|2739510_2739849_+	peptidase S24-like family protein	NA	H9C160	Pectobacterium_phage	30.7	2.5e-06
WP_101973878.1|2740141_2740297_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	6.8e-07
WP_001171942.1|2740456_2740675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331716.1|2740678_2740843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2741246_2741435_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001365098.1|2741431_2741623_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_101973684.1|2741716_2744188_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	2.5e-58
WP_059320127.1|2744252_2744501_+	excisionase	NA	NA	NA	NA	NA
WP_059320128.1|2744478_2745609_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	52.0	1.8e-104
2752974:2752989	attR	CGACGATAAAGGTTTT	NA	NA	NA	NA
>prophage 8
NZ_CP022279	Escherichia coli strain STEC299 chromosome, complete genome	4907118	2832130	2875416	4907118	head,capsid,portal,integrase,terminase,tRNA,protease	uncultured_Caudovirales_phage(64.29%)	56	2828765:2828780	2840305:2840320
2828765:2828780	attL	AATTTTCCTCATCAGC	NA	NA	NA	NA
WP_032325769.1|2832130_2833129_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_089557530.1|2834112_2835336_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000993248.1|2835376_2835895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032325772.1|2835907_2836762_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_032325773.1|2836897_2838079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101973688.1|2838075_2840304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016243535.1|2840321_2840477_-	protein umuC	NA	I6RSM4	Salmonella_phage	74.5	3.6e-16
2840305:2840320	attR	AATTTTCCTCATCAGC	NA	NA	NA	NA
WP_000897376.1|2840476_2840896_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	61.3	6.9e-38
WP_097511820.1|2841092_2841488_+	hemolysin E	NA	NA	NA	NA	NA
WP_000807618.1|2841694_2842156_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|2842232_2842892_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|2842963_2843257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000693755.1|2843498_2843900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001056851.1|2844019_2844388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295990.1|2844907_2845603_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|2845626_2846439_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|2846442_2846709_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_001131456.1|2847459_2847579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001331738.1|2847539_2847725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000120100.1|2847825_2847999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000726974.1|2848000_2848345_+	glycine zipper family protein	NA	NA	NA	NA	NA
WP_001295611.1|2848354_2848684_+	YmgD family protein	NA	NA	NA	NA	NA
WP_001304450.1|2850081_2850261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065862.1|2850658_2850877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072105022.1|2851008_2851776_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001065750.1|2852199_2852448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000888771.1|2852560_2852827_-	biofilm/acid-resistance regulator AriR	NA	NA	NA	NA	NA
WP_000858013.1|2852855_2853128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000554153.1|2853170_2853407_-	two-component-system connector protein YcgZ	NA	NA	NA	NA	NA
WP_001298110.1|2853719_2854931_+	blue light-responsive regulator BluF	NA	NA	NA	NA	NA
WP_000332310.1|2855135_2855867_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	51.0	9.3e-54
WP_000373104.1|2856087_2856492_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_001445545.1|2856544_2856670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000444487.1|2856753_2858004_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248695.1|2858175_2858829_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|2858838_2859300_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001298466.1|2859353_2860460_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001295971.1|2860495_2861137_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423737.1|2861140_2862511_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.6e-107
WP_001265481.1|2862679_2863351_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000734671.1|2863350_2864811_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_024166344.1|2865154_2865337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001475705.1|2865593_2865875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101973690.1|2865888_2867550_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.4	2.0e-277
WP_000113645.1|2867533_2867890_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_001145908.1|2868180_2868621_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	67.8	7.8e-56
WP_000134111.1|2868620_2868917_-	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_101973691.1|2868913_2869252_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	3.0e-31
WP_021521615.1|2869248_2870424_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.9	1.4e-184
WP_101973881.1|2870461_2871019_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	2.0e-61
WP_001137341.1|2871074_2872232_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.1e-137
WP_158639728.1|2872524_2872749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024166342.1|2872874_2873147_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_101973694.1|2873157_2873568_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_101973882.1|2873564_2873816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101973695.1|2874018_2875416_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	59.2	4.4e-113
>prophage 9
NZ_CP022279	Escherichia coli strain STEC299 chromosome, complete genome	4907118	3003444	3066398	4907118	transposase,head,lysis,integrase,terminase,holin,protease,tail,plate	Edwardsiella_phage(24.24%)	86	3016933:3016950	3066815:3066832
WP_033816087.1|3003444_3004023_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	1.3e-95
WP_101973708.1|3005068_3005707_-	DUF2612 domain-containing protein	NA	A0A077K9U8	Edwardsiella_phage	72.9	2.9e-88
WP_001602024.1|3005717_3006947_-	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	68.9	1.0e-158
WP_000222449.1|3006943_3007303_-	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	71.1	4.9e-40
WP_000360790.1|3007299_3007992_-|plate	phage baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	46.9	3.2e-56
WP_001311527.1|3007984_3008938_-	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	44.2	9.2e-62
WP_000633904.1|3008858_3009161_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	67.0	5.2e-35
WP_001609809.1|3009157_3009973_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	66.4	2.1e-94
WP_001085226.1|3010023_3010245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101973709.1|3010244_3010973_-	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	66.4	2.0e-80
WP_101973884.1|3011061_3011718_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	75.6	2.0e-87
WP_021518013.1|3011761_3011935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101973710.1|3012034_3012676_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_101973711.1|3012784_3014599_-	transglycosylase SLT domain-containing protein	NA	A0A077KC92	Edwardsiella_phage	30.4	1.5e-49
WP_001311526.1|3014595_3014799_-	hypothetical protein	NA	A0A077KAX1	Edwardsiella_phage	64.6	5.0e-10
WP_000101345.1|3014810_3015218_-	hypothetical protein	NA	A0A077KC08	Edwardsiella_phage	68.7	3.1e-43
WP_001121033.1|3015217_3015652_-	hypothetical protein	NA	A0A077K9T0	Edwardsiella_phage	69.4	2.2e-55
WP_101973712.1|3015663_3017154_-	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	73.1	2.6e-204
3016933:3016950	attL	ATTTTCGTATCCGTTAAA	NA	NA	NA	NA
WP_001438160.1|3017150_3017465_-	hypothetical protein	NA	A0A077KC88	Edwardsiella_phage	71.0	7.0e-35
WP_001053571.1|3017662_3018034_-	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	82.1	1.7e-56
WP_001609802.1|3018008_3018575_-	hypothetical protein	NA	A0A077KC03	Edwardsiella_phage	45.7	1.7e-31
WP_101973713.1|3018574_3019006_-	DUF4054 domain-containing protein	NA	Q2NPC6	Xanthomonas_phage	46.4	7.2e-22
WP_101973885.1|3018993_3019200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001057675.1|3019368_3020409_-	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	54.9	1.9e-97
WP_000012785.1|3020412_3020892_-	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	54.2	1.5e-36
WP_101973714.1|3020895_3022122_-	DUF2213 domain-containing protein	NA	A0A219YBB9	Aeromonas_phage	38.7	4.5e-61
WP_101973886.1|3022256_3022895_-|head	phage head morphogenesis protein	head	A0A077KGU5	Edwardsiella_phage	53.9	2.3e-56
WP_001455283.1|3023507_3024530_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	5.4e-201
WP_001317493.1|3024526_3025309_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_000896529.1|3026490_3028011_-|terminase	phage terminase large subunit	terminase	Q7Y5U7	Haemophilus_phage	49.4	3.7e-129
WP_023156762.1|3027964_3028555_-|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	67.2	1.1e-62
WP_096998697.1|3029886_3030324_-|lysis	lysis protein	lysis	I6RSJ6	Salmonella_phage	97.2	8.5e-71
WP_101973716.1|3030320_3030818_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	98.8	3.8e-91
WP_000839574.1|3030817_3031033_-|holin	holin	holin	M1FN85	Enterobacteria_phage	100.0	2.4e-34
WP_101973718.1|3031549_3032164_-	hypothetical protein	NA	A0A2H4FND2	Salmonella_phage	88.2	4.5e-102
WP_101973719.1|3032303_3032666_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKF0	Enterobacteria_phage	99.2	2.0e-62
WP_101973721.1|3032930_3033440_-	HNH endonuclease	NA	U5PWK7	Bacillus_phage	40.4	2.4e-24
WP_122994737.1|3033432_3033627_-	protein ninF	NA	A0A0K2FJ27	Escherichia_phage	96.6	4.8e-26
WP_101973722.1|3033599_3033776_-	NinE family protein	NA	I6RSI9	Salmonella_phage	74.1	6.3e-17
WP_014532161.1|3033742_3033916_-	hypothetical protein	NA	I6S1V2	Salmonella_phage	100.0	3.2e-29
WP_016063039.1|3033912_3034353_-	recombination protein NinB	NA	K7PGZ3	Enterobacteria_phage	100.0	1.6e-80
WP_158639729.1|3034429_3035866_-	AAA family ATPase	NA	K7PGR8	Enterobacteria_phage	99.6	3.3e-273
WP_101973724.1|3035855_3036755_-	DNA replication protein	NA	A0A0N7C1Z7	Escherichia_phage	98.7	3.3e-162
WP_000166207.1|3036747_3036894_-	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000438538.1|3036926_3037226_-	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	99.0	4.8e-49
WP_001054987.1|3037332_3037557_-	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	86.3	1.4e-29
WP_000092876.1|3037701_3038376_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	84.4	3.1e-104
WP_101973725.1|3038413_3038755_+	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	97.3	1.6e-61
WP_089550570.1|3038821_3039313_+	hypothetical protein	NA	A0A2H4J8G2	uncultured_Caudovirales_phage	45.7	1.2e-28
WP_101973726.1|3039302_3040079_+	DUF1828 domain-containing protein	NA	A0A2H4JC42	uncultured_Caudovirales_phage	43.9	3.7e-61
WP_059216141.1|3040574_3040910_+	hypothetical protein	NA	F1C5C1	Cronobacter_phage	67.6	4.6e-32
WP_001317493.1|3041015_3041798_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_001455283.1|3041794_3042817_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	5.4e-201
WP_101973729.1|3042913_3043327_+	hypothetical protein	NA	I6RSN8	Salmonella_phage	86.9	1.9e-64
WP_032156067.1|3043461_3043737_+	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	87.9	2.4e-39
WP_000604108.1|3043982_3044291_+	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	97.1	4.8e-52
WP_042353382.1|3044287_3045190_+	recombinase RecT	NA	K7PKG9	Enterobacteria_phage	88.1	8.8e-147
WP_000041322.1|3045173_3045656_+	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	99.4	8.4e-80
WP_000753557.1|3045667_3045982_+	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	99.0	3.5e-50
WP_101973730.1|3045998_3046166_+	DUF2737 family protein	NA	Q716F2	Shigella_phage	98.2	3.0e-24
WP_101973731.1|3046162_3046417_+	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	98.8	7.7e-40
WP_101973732.1|3046403_3047048_+	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	66.8	1.1e-71
WP_101973733.1|3047049_3047313_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	71.3	3.3e-30
WP_101973734.1|3047323_3047980_+	hypothetical protein	NA	A5LH60	Enterobacteria_phage	71.4	1.4e-69
WP_158639730.1|3047972_3048257_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	94.7	8.5e-48
WP_101973736.1|3048328_3048535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303849.1|3048663_3048882_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_063270735.1|3048859_3049933_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9G075	Enterobacteria_phage	99.2	4.1e-199
WP_101973737.1|3050027_3052760_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.5	2.4e-38
WP_000818456.1|3052842_3053916_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|3053964_3054138_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_012896763.1|3054127_3054358_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|3054332_3054521_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|3054531_3054744_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_000087763.1|3055029_3055242_+	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_101973887.1|3055229_3056540_-	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_000270305.1|3056619_3056712_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_000460803.1|3056724_3057861_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_101973738.1|3057872_3059417_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_033553228.1|3059550_3060408_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000063990.1|3060404_3060803_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000003639.1|3060799_3061387_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186413.1|3061383_3062091_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107378.1|3062109_3063903_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001058323.1|3063899_3065018_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000375136.1|3065738_3066398_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
3066815:3066832	attR	TTTAACGGATACGAAAAT	NA	NA	NA	NA
>prophage 10
NZ_CP022279	Escherichia coli strain STEC299 chromosome, complete genome	4907118	3479745	3510751	4907118	transposase,integrase,protease,tRNA,tail	Escherichia_phage(25.0%)	31	3468675:3468690	3506721:3506736
3468675:3468690	attL	GATACATCGGGTCGTA	NA	NA	NA	NA
WP_001201852.1|3479745_3480699_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000239890.1|3480930_3481599_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000259980.1|3481653_3481959_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	63.6	1.2e-42
WP_016237765.1|3482016_3482316_+|integrase	tyrosine-type recombinase/integrase	integrase	B9UDL9	Salmonella_phage	81.2	1.7e-30
WP_001455283.1|3482449_3483472_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	5.4e-201
WP_001317493.1|3483468_3484251_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_000729155.1|3484957_3485824_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|3485825_3486038_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143501.1|3486145_3486667_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|3486702_3488088_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_000256006.1|3488261_3488756_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000212245.1|3488758_3489481_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_001188438.1|3489591_3489921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304818.1|3490016_3490526_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000815579.1|3490522_3491590_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000855388.1|3491722_3492616_-	carbamate kinase	NA	NA	NA	NA	NA
WP_001313637.1|3492612_3493428_-	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_101973757.1|3493438_3494698_-	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000580880.1|3494694_3496362_-	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_089622478.1|3496640_3497660_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000401115.1|3497862_3499317_-	putative allantoin permease	NA	NA	NA	NA	NA
WP_000765828.1|3499486_3500365_-	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000943566.1|3500464_3501241_-	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_101973758.1|3501253_3503035_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.2	4.6e-38
WP_000141274.1|3503124_3503940_-	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_000776388.1|3504017_3504500_-	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000460117.1|3504729_3505656_+	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_001157949.1|3505724_3506819_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
3506721:3506736	attR	TACGACCCGATGTATC	NA	NA	NA	NA
WP_000561824.1|3507059_3509474_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001110573.1|3509470_3510157_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_001313633.1|3510127_3510751_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
>prophage 11
NZ_CP022279	Escherichia coli strain STEC299 chromosome, complete genome	4907118	3764539	3804492	4907118	transposase,plate	Escherichia_phage(33.33%)	32	NA	NA
WP_000543509.1|3764539_3764860_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000093934.1|3765212_3765962_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.5e-19
WP_001225679.1|3766273_3767014_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|3766984_3767752_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|3767956_3768535_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973130.1|3768774_3771219_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000532690.1|3771261_3771735_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118054.1|3771888_3772659_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_001298174.1|3772929_3773418_-	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_000227711.1|3773511_3774015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101973680.1|3775986_3777009_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	6.0e-200
WP_001317493.1|3777005_3777788_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_001518352.1|3779321_3779864_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_032144418.1|3779848_3780373_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_000633877.1|3781368_3782145_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_101973778.1|3782157_3784389_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	8.0e-24
WP_020244783.1|3784407_3784692_-	type VI secretion system PAAR protein	NA	NA	NA	NA	NA
WP_001683597.1|3784707_3785499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021513480.1|3785771_3787328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001683606.1|3789112_3790075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101973779.1|3790189_3791761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021513478.1|3791782_3792622_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_101973780.1|3792621_3794580_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.3	5.4e-24
WP_001142963.1|3794800_3795319_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000041480.1|3796024_3796528_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000111582.1|3796550_3798035_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000946068.1|3798039_3798465_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000863402.1|3798470_3800312_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000896713.1|3800275_3801325_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000433564.1|3801329_3802622_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001013423.1|3802618_3803143_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000224516.1|3803145_3804492_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 12
NZ_CP022279	Escherichia coli strain STEC299 chromosome, complete genome	4907118	4058502	4144216	4907118	transposase,head,capsid,portal,integrase,terminase,holin,tRNA,tail	Enterobacteria_phage(30.65%)	95	4103855:4103870	4145898:4145913
WP_001223199.1|4058502_4059189_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001295754.1|4059588_4059729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|4059824_4060541_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_033553090.1|4060600_4061953_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001219580.1|4062010_4063435_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.9	2.5e-10
WP_101973790.1|4063434_4064124_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	6.7e-30
WP_000875487.1|4064136_4064610_-	protein CreA	NA	NA	NA	NA	NA
WP_000371658.1|4064820_4065690_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000942350.1|4065686_4066334_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_001339518.1|4066385_4066913_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000068677.1|4066985_4067312_-	trp operon repressor	NA	NA	NA	NA	NA
WP_001682549.1|4067401_4069339_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046754.1|4069545_4071213_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.7	1.0e-39
WP_000007436.1|4071268_4071553_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000513549.1|4071554_4071887_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000093834.1|4071978_4073211_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
WP_001029698.1|4073231_4074614_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132964.1|4074662_4075631_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_000124608.1|4075736_4076381_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_000105871.1|4076408_4077425_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_001293112.1|4077425_4078757_-	type II toxin-antitoxin system HipA family toxin YjjJ	NA	NA	NA	NA	NA
WP_000224879.1|4078923_4079643_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816471.1|4079699_4080923_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_001552365.1|4080974_4082297_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.5	5.2e-79
WP_001295412.1|4082374_4083154_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001143243.1|4083411_4084962_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001088368.1|4084933_4085797_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_000563046.1|4086013_4086793_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001298490.1|4086789_4087863_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|4087984_4088146_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|4088272_4088878_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202563.1|4089270_4090857_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_101973791.1|4090985_4091201_+	DinI family protein	NA	S5MQI1	Escherichia_phage	91.4	4.3e-28
WP_101973792.1|4091506_4092478_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_101973869.1|4092720_4093254_-	DUF4376 domain-containing protein	NA	A0A2L1IV45	Escherichia_phage	44.7	1.2e-34
WP_101973650.1|4093336_4094440_-|tail	phage tail protein	tail	Q9LA62	Enterobacterial_phage	69.9	1.0e-32
WP_101973535.1|4094503_4095103_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	88.9	4.7e-96
WP_101973793.1|4095170_4098557_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	86.3	0.0e+00
WP_158639742.1|4099040_4099670_-|tail	tail assembly protein	tail	A0A0N7KZG2	Stx2-converting_phage	97.1	1.9e-95
WP_101973654.1|4099615_4100359_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	94.3	9.8e-144
WP_101973655.1|4100364_4101063_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.8	2.6e-130
WP_101973656.1|4101072_4101402_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	92.7	2.4e-54
WP_101973796.1|4101398_4103972_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	77.6	0.0e+00
4103855:4103870	attL	TTTTTCTGGCGTCAGT	NA	NA	NA	NA
WP_101973797.1|4104019_4104343_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	85.4	1.6e-42
WP_101973798.1|4104369_4104801_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.1	6.2e-42
WP_101973799.1|4104817_4105570_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	96.8	1.9e-131
WP_101973800.1|4105577_4105973_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.1	2.0e-58
WP_101973801.1|4105969_4106503_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.6	1.6e-58
WP_001204533.1|4106518_4106872_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_101973663.1|4106864_4107233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101973802.1|4107285_4108314_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	8.6e-114
WP_101973803.1|4108371_4108719_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	2.6e-22
WP_101973804.1|4108755_4110261_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.4	2.3e-99
WP_101973805.1|4110250_4111843_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	9.3e-184
WP_032277387.1|4111839_4112046_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	58.5	1.6e-11
WP_101973668.1|4112029_4113958_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	1.8e-261
WP_101973669.1|4113929_4114439_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.2	2.7e-12
WP_101973806.1|4115353_4115887_+	DUF1398 family protein	NA	NA	NA	NA	NA
WP_158639733.1|4116043_4116229_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	78.7	4.6e-18
WP_001441792.1|4116456_4116588_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	90.7	8.5e-11
WP_001303555.1|4116600_4116783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101973808.1|4116938_4117472_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.9	1.4e-99
WP_087906417.1|4118601_4118817_-|holin	holin	holin	G9L6J5	Escherichia_phage	97.2	1.7e-32
WP_101973809.1|4118894_4119200_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_033553189.1|4119222_4119408_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	58.3	4.2e-11
WP_158639734.1|4119541_4121539_-	DUF1737 domain-containing protein	NA	A0A0P0ZBH7	Stx2-converting_phage	54.8	2.8e-201
WP_101973673.1|4121873_4122191_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	64.5	1.7e-36
WP_101973811.1|4122528_4122792_-	Shiga toxin Stx2 subunit B	NA	Q6DWK8	Enterobacteria_phage	89.7	1.3e-37
WP_101973812.1|4122804_4123764_-	Shiga toxin Stx2 subunit A	NA	Q6DWN9	Enterobacteria_phage	94.0	1.0e-164
WP_158639743.1|4124146_4124374_-	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	94.7	3.8e-22
WP_001317493.1|4124386_4125169_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_001455283.1|4125165_4126188_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	5.4e-201
WP_052907895.1|4127753_4128506_-	antitermination protein	NA	Q8SBE4	Shigella_phage	99.2	1.5e-136
WP_101973813.1|4128519_4129509_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	97.6	3.2e-190
WP_101973814.1|4129516_4130332_-	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	98.2	2.7e-147
WP_044717961.1|4130513_4130879_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.6e-65
WP_000210178.1|4130875_4131202_-	LexA repressor	NA	U5P451	Shigella_phage	97.2	2.9e-52
WP_021576994.1|4131201_4131696_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	99.4	2.5e-87
WP_101973815.1|4131692_4132511_-	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	98.9	8.9e-122
WP_101973816.1|4132507_4132732_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	85.1	9.8e-31
WP_101973817.1|4132728_4132923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101973895.1|4132919_4134155_-	hypothetical protein	NA	A0A1C9IHV9	Salmonella_phage	68.4	2.7e-98
WP_101973818.1|4134126_4134435_+	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	96.1	1.7e-46
WP_071829521.1|4134456_4134630_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	98.2	4.1e-29
WP_101973819.1|4134775_4135327_-	hypothetical protein	NA	A0A0P0ZE62	Stx2-converting_phage	98.9	2.2e-100
WP_001191669.1|4135319_4135580_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_001311077.1|4135677_4136370_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	2.9e-121
WP_000135689.1|4137072_4137435_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	2.5e-60
WP_101973821.1|4137500_4138325_+	DUF2303 family protein	NA	U5P439	Shigella_phage	98.9	1.1e-148
WP_101973822.1|4138452_4138989_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	97.8	6.9e-99
WP_024195021.1|4139023_4139218_+	hypothetical protein	NA	A5LH59	Enterobacteria_phage	95.3	2.2e-31
WP_033552412.1|4139351_4140236_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158639735.1|4140484_4141543_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_101973824.1|4141720_4142914_+	MFS transporter	NA	NA	NA	NA	NA
WP_101973825.1|4142992_4144216_-|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	98.8	9.5e-237
4145898:4145913	attR	TTTTTCTGGCGTCAGT	NA	NA	NA	NA
>prophage 1
NZ_CP022280	Escherichia coli strain STEC299 plasmid pSTEC299_1, complete sequence	191691	12659	76593	191691	plate,transposase,integrase,bacteriocin	Moraxella_phage(25.0%)	49	53556:53615	68462:68589
WP_032334768.1|12659_13664_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_158639744.1|14800_15658_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001365705.1|15650_15725_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083830.1|15962_16217_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_101973907.1|16456_17047_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_101973908.1|17084_17294_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_101973909.1|17339_17801_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	36.4	6.1e-19
WP_001299730.1|18046_18259_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001567328.1|18394_18955_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_101973910.1|19009_19756_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	29.3	1.3e-07
WP_000904945.1|26657_27281_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	49.7	3.4e-41
WP_101973910.1|28827_29574_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	29.3	1.3e-07
WP_001567328.1|29628_30189_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001299730.1|30324_30537_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_101973909.1|30782_31244_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	36.4	6.1e-19
WP_101973908.1|31289_31499_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_101973907.1|31536_32127_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_101973911.1|32281_32746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001312851.1|33001_33151_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000083830.1|33434_33689_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_032144212.1|33925_34000_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_101973912.1|33992_35015_+	replication initiation protein	NA	NA	NA	NA	NA
WP_101973913.1|35940_36225_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_101973914.1|36212_36698_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_158639745.1|37316_37589_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_101973916.1|37662_39435_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_158639746.1|39447_49272_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	36.2	2.8e-28
WP_101973917.1|49273_49579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045148685.1|50495_50738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001016257.1|51625_52372_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	48.5	5.0e-55
WP_101973680.1|52526_53549_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	6.0e-200
WP_001317493.1|53545_54328_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
53556:53615	attL	AACTGCAACATCAACGACTGATGGCGCTCGCCGGGCAGTTGCAACTGGAAAGCCTTATAA	NA	NA	NA	NA
WP_101973919.1|54337_55888_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.6	1.2e-124
WP_101973920.1|58435_59059_-	recombinase family protein	NA	NA	NA	NA	NA
WP_016233052.1|60336_60864_-	colicin B immunity protein	NA	NA	NA	NA	NA
WP_001382745.1|61107_61923_+|bacteriocin	lipid II-degrading bacteriocin colicin M	bacteriocin	NA	NA	NA	NA
WP_000864812.1|61972_62326_-	colicin M immunity protein	NA	NA	NA	NA	NA
WP_077125144.1|62498_63281_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
WP_000465043.1|63282_63696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343099.1|64262_64520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101973921.1|64519_65110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101973922.1|65388_66708_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_101973923.1|66735_67898_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.3	1.2e-52
WP_000072546.1|70955_71432_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
68462:68589	attR	AACTGCAACATCAACGACTGATGGCGCTCGCCGGGCAGTTGCAACTGGAAAGCCTTATAAGCGCAGCGCCTGCGCTGTCACAACAGGCAGTAGACCAGGAATGGAGTTATATGGACTTCCTGGAGCAT	NA	NA	NA	NA
WP_000150696.1|71434_72913_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_087896586.1|72922_73444_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_000555553.1|73452_73875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101973924.1|73867_75670_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000268398.1|75660_76593_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 2
NZ_CP022280	Escherichia coli strain STEC299 plasmid pSTEC299_1, complete sequence	191691	81088	142888	191691	plate,transposase,integrase	Escherichia_phage(40.0%)	47	104215:104232	155327:155344
WP_101973929.1|81088_82453_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_101973985.1|82806_83424_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_101973931.1|83430_86835_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_000109202.1|86838_89367_+	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	34.0	6.4e-94
WP_101973932.1|90068_91214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101973933.1|91400_91901_+	kinesin	NA	NA	NA	NA	NA
WP_101973934.1|91939_92503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101973935.1|92918_93323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101973936.1|93509_94100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033800623.1|96394_96901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101973987.1|97212_97512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101973937.1|97797_98394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101973938.1|98449_98656_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_101973988.1|98730_99237_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_101973939.1|99925_100573_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	4.1e-21
WP_032211263.1|100572_100884_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	78.4	7.4e-45
WP_101973940.1|102600_102966_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_101973941.1|103423_103810_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	50.4	2.5e-26
WP_000493532.1|103806_104031_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	43.2	1.1e-05
104215:104232	attL	GTAGGGGGCCGCTTGGAA	NA	NA	NA	NA
WP_101973943.1|104757_105738_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	51.7	5.5e-86
WP_000774832.1|105740_106163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101973944.1|106166_106478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101973945.1|106561_107281_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_101973946.1|107296_108079_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.9	3.6e-136
WP_101973947.1|108075_109098_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	92.1	4.4e-187
WP_101973948.1|109993_110416_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_101973949.1|110462_110765_-	antirestriction protein	NA	NA	NA	NA	NA
WP_101973950.1|111870_112305_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104887.1|112316_112538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101973951.1|112538_113222_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.5e-29
WP_089622478.1|113500_114520_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001358230.1|115470_115614_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_101973954.1|116791_117754_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.2	2.3e-113
WP_000817644.1|117750_118956_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.4	5.6e-205
WP_032334873.1|119329_119542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001132895.1|119714_119966_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_001270417.1|119962_120250_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	47.4	2.2e-19
WP_158639709.1|122415_123643_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	7.0e-171
WP_101973955.1|123720_124461_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_101973989.1|126228_130761_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_020219205.1|131514_132207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020219146.1|135476_135665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020219148.1|136266_136680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101973990.1|136785_137271_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_101973956.1|137437_137848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101973991.1|137955_139017_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_101973680.1|141865_142888_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	6.0e-200
155327:155344	attR	TTCCAAGCGGCCCCCTAC	NA	NA	NA	NA
