The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025627	Escherichia coli strain SCEC020007 chromosome, complete genome	4800548	1121244	1134427	4800548		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|1121244_1122006_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1121999_1122626_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|1122765_1123905_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1123967_1124960_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|1125053_1126418_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136934.1|1126506_1127283_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1127287_1127926_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|1127922_1129185_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847984.1|1129181_1130090_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	5.1e-118
WP_001300386.1|1130285_1131053_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141322.1|1131103_1131760_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_039023140.1|1131865_1134427_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 2
NZ_CP025627	Escherichia coli strain SCEC020007 chromosome, complete genome	4800548	1738375	1747818	4800548		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569343.1|1738375_1739302_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
WP_000783134.1|1739306_1740038_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1740018_1740126_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|1740185_1740917_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001295431.1|1741138_1742824_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001308766.1|1742820_1743540_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001551352.1|1743586_1744057_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	5.2e-82
WP_032204114.1|1744098_1744560_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	5.4e-76
WP_001551351.1|1744684_1746685_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001551350.1|1746681_1747818_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	5.0e-163
>prophage 3
NZ_CP025627	Escherichia coli strain SCEC020007 chromosome, complete genome	4800548	1836082	1846996	4800548		Enterobacteria_phage(22.22%)	10	NA	NA
WP_125922846.1|1836082_1837360_+	hypothetical protein	NA	A0A1V0E6Q2	Klebsiella_phage	24.5	1.1e-12
WP_087523500.1|1837395_1838724_+	flippase	NA	NA	NA	NA	NA
WP_087523504.1|1838871_1839195_+	serine acetyltransferase	NA	A0A191KBJ5	Streptococcus_virus	39.0	1.9e-11
WP_000043542.1|1839366_1840773_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_049139659.1|1840997_1842062_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	4.4e-105
WP_016161468.1|1842088_1842958_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	9.8e-111
WP_004206787.1|1842989_1843880_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.2	3.7e-28
WP_004206788.1|1843894_1844449_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.8	1.0e-52
WP_087523506.1|1844629_1845796_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	9.1e-112
WP_087523507.1|1845988_1846996_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.2e-30
>prophage 4
NZ_CP025627	Escherichia coli strain SCEC020007 chromosome, complete genome	4800548	2771582	2832156	4800548	integrase,transposase,holin,terminase,head,capsid,tRNA,tail,portal	Escherichia_phage(43.75%)	68	2784306:2784320	2832258:2832272
WP_039023277.1|2771582_2772779_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001295666.1|2773088_2773412_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_000444488.1|2773514_2774765_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	3.2e-22
WP_001248681.1|2774936_2775590_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|2775599_2776061_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001297484.1|2776114_2777221_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|2777256_2777898_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423742.1|2777901_2779272_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001265471.1|2779440_2780112_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|2780111_2781572_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000456506.1|2781647_2782769_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359434.1|2782817_2784044_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|2784293_2785430_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
2784306:2784320	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799406.1|2785413_2786277_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000241001.1|2786831_2787500_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_042047081.1|2787737_2788268_-|tail	tail fiber domain-containing protein	tail	A0A2D1UII2	Escherichia_phage	85.2	2.5e-69
WP_001189123.1|2789681_2791190_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_001233546.1|2795143_2795743_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	1.6e-107
WP_000515345.1|2795810_2799290_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_000090843.1|2799350_2799959_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	1.9e-100
WP_001333568.1|2799895_2800639_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	4.5e-149
WP_001152457.1|2800644_2801343_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	3.4e-130
WP_001330090.1|2801342_2801699_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_000224003.1|2801676_2804904_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
WP_000978926.1|2804950_2805229_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	95.7	5.3e-42
WP_000164661.1|2805252_2805624_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
WP_000097535.1|2805638_2806343_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	92.7	1.4e-112
WP_001206700.1|2806403_2806748_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	5.1e-55
WP_000968644.1|2806744_2807194_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001147814.1|2807190_2807529_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719064.1|2807537_2807855_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	5.3e-22
WP_000766109.1|2807931_2809149_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000923134.1|2809754_2810981_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.3	3.7e-204
WP_000811487.1|2810970_2811132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140892.1|2811128_2812886_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_001333563.1|2812885_2813368_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_001135104.1|2813515_2813866_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	8.0e-64
WP_000738421.1|2814391_2814685_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_075202333.1|2814775_2814958_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000992097.1|2815174_2815708_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
WP_000193264.1|2815771_2816122_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000372595.1|2816126_2816342_-|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_001333561.1|2816491_2816653_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	87.0	5.9e-14
WP_000874243.1|2816649_2816838_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001333560.1|2817098_2817434_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
WP_001333559.1|2817504_2817717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106104550.1|2818205_2818292_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000762879.1|2818686_2819508_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	5.1e-77
WP_000139999.1|2819504_2819885_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.3e-35
WP_001221526.1|2819885_2820944_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
WP_032155008.1|2820945_2821224_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_000813254.1|2821391_2821547_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000753060.1|2822469_2822646_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	94.8	6.7e-27
WP_001224662.1|2822638_2822821_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000403785.1|2822914_2823271_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001151150.1|2823328_2823751_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_001262390.1|2823791_2824862_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_000693850.1|2824933_2825359_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747951.1|2825342_2825585_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001420344.1|2825976_2826315_+	peptidase S24	NA	H9C160	Pectobacterium_phage	32.0	2.5e-06
WP_042046576.1|2826668_2826968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|2827039_2827258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001517906.1|2827222_2827426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|2827826_2828015_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070255.1|2828011_2828203_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102136.1|2828296_2830738_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
WP_000003742.1|2830799_2831069_+	excisionase	NA	NA	NA	NA	NA
WP_000074971.1|2831037_2832156_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.4	1.6e-84
2832258:2832272	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 5
NZ_CP025627	Escherichia coli strain SCEC020007 chromosome, complete genome	4800548	3405049	3463395	4800548	tRNA,transposase	Escherichia_phage(15.38%)	51	NA	NA
WP_001615628.1|3405049_3406162_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000935262.1|3406239_3406449_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_085947770.1|3406491_3407861_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_001130654.1|3408292_3409411_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001067855.1|3409548_3410253_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000262446.1|3410337_3410700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000217395.1|3410785_3411277_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001333498.1|3411447_3411705_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	65.7	8.3e-18
WP_000654804.1|3412303_3413272_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	1.0e-185
WP_087523609.1|3413489_3415559_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000440491.1|3415562_3416753_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000684771.1|3416800_3417955_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001581568.1|3417964_3418996_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000018742.1|3419061_3419814_-	O89/0101/0162 family O-antigen ABC transporter ATP-binding protein Wzt	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.4	1.1e-12
WP_100249844.1|3419820_3420528_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001067855.1|3420567_3421272_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000351487.1|3421450_3422104_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_001153148.1|3422211_3423459_+	mechanosensitive ion channel YbdG	NA	NA	NA	NA	NA
WP_000786319.1|3423539_3424916_-	phenylalanine transporter	NA	NA	NA	NA	NA
WP_000573945.1|3425017_3428161_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
WP_000717157.1|3428172_3429396_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000709870.1|3429411_3429744_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000074234.1|3429901_3431275_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000770953.1|3431431_3432115_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000253839.1|3432104_3433547_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.2	3.0e-11
WP_039023216.1|3433696_3435934_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_001333623.1|3435920_3438893_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224604.1|3438893_3439784_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177471.1|3439966_3440728_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
WP_000805428.1|3441092_3441725_+	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_001255230.1|3441727_3442243_-	fimbria assembly protein	NA	NA	NA	NA	NA
WP_001350487.1|3442253_3443294_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001333622.1|3443272_3445876_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000988364.1|3445906_3446599_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000776555.1|3446818_3447361_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729160.1|3447831_3448698_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|3448699_3448912_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143556.1|3449019_3449541_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912385.1|3449576_3450962_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_000255997.1|3451135_3451630_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000212247.1|3451632_3452355_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_001295318.1|3452472_3452982_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000815571.1|3452978_3454046_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000855378.1|3454240_3455134_-	carbamate kinase	NA	NA	NA	NA	NA
WP_000152519.1|3455130_3455946_-	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000495367.1|3455956_3457216_-	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000580822.1|3457225_3458893_-	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000703900.1|3459209_3460259_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_001310618.1|3460280_3461516_+	allantoate deiminase	NA	NA	NA	NA	NA
WP_000540997.1|3461526_3462312_+	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_000654804.1|3462426_3463395_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	1.0e-185
>prophage 6
NZ_CP025627	Escherichia coli strain SCEC020007 chromosome, complete genome	4800548	3714729	3767484	4800548	integrase,transposase,plate	Morganella_phage(16.67%)	54	3719434:3719449	3776916:3776931
WP_000230707.1|3714729_3715185_+	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	66.4	2.9e-45
WP_000678612.1|3715264_3715465_+	hypothetical protein	NA	H6WRV2	Salmonella_phage	43.1	1.3e-05
WP_016231257.1|3715948_3716386_+	hypothetical protein	NA	I6S5X4	Salmonella_phage	33.1	3.1e-12
WP_016231258.1|3716448_3718554_-	hypothetical protein	NA	A0A2I7QQN9	Vibrio_phage	36.2	1.4e-86
WP_016231259.1|3718553_3720020_-	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	53.3	1.4e-106
3719434:3719449	attL	TGATCTTTGATATCGA	NA	NA	NA	NA
WP_001018522.1|3720024_3720198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087523544.1|3720782_3723539_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.0	2.6e-298
WP_001058739.1|3723551_3724154_-	hypothetical protein	NA	Q8W653	Enterobacteria_phage	34.7	5.3e-23
WP_000181940.1|3724146_3724368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024673.1|3724364_3724628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065738.1|3724624_3724819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077900594.1|3724811_3725879_-	ash family protein	NA	NA	NA	NA	NA
WP_033554327.1|3725872_3726055_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_087523546.1|3726047_3726857_-	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	53.6	3.0e-29
WP_000412539.1|3726869_3727301_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.7	3.0e-28
WP_074525659.1|3727300_3727504_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_021531046.1|3727896_3729111_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	7.5e-133
WP_000893278.1|3729466_3730720_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_001285288.1|3730731_3731835_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_039023169.1|3732122_3733178_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
WP_000174677.1|3733216_3733618_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189532.1|3733675_3734920_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|3735011_3735470_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001292994.1|3735730_3737188_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001352051.1|3737244_3737802_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001295202.1|3737713_3737980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059892.1|3738285_3738738_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263489.1|3738747_3739146_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554758.1|3739148_3739442_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226164.1|3739493_3740549_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207552.1|3740619_3741405_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001334802.1|3741349_3743089_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000006255.1|3743312_3743810_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_000056849.1|3743985_3744735_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.0e-20
WP_000729703.1|3744944_3745205_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615983.1|3745207_3745486_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|3745641_3746382_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|3746352_3747120_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|3747325_3747904_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973083.1|3748143_3750588_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|3750630_3751104_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_087523548.1|3751257_3752028_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000420818.1|3752068_3753205_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000008098.1|3753635_3753812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024198219.1|3753795_3754029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039023185.1|3754006_3758239_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_032329316.1|3758314_3760456_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
WP_001142958.1|3760665_3761184_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037397.1|3761878_3762379_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|3762413_3762638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056989.1|3762688_3764164_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611744.1|3764170_3764584_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393852.1|3764587_3766438_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|3766401_3767484_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
3776916:3776931	attR	TGATCTTTGATATCGA	NA	NA	NA	NA
>prophage 7
NZ_CP025627	Escherichia coli strain SCEC020007 chromosome, complete genome	4800548	4498956	4578309	4800548	integrase,transposase,tRNA,tail,protease	Escherichia_phage(40.0%)	77	4508656:4508691	4587194:4587229
WP_000187022.1|4498956_4500057_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000806411.1|4500096_4500456_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_001309117.1|4500455_4501106_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_001120810.1|4501436_4502837_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_001025939.1|4502819_4503737_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_001230087.1|4504003_4505377_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_001352356.1|4505437_4506214_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_000935370.1|4506221_4507226_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_001298964.1|4507379_4508531_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
4508656:4508691	attL	CCGTAGGCCGGATAAGGCGCTCGCGCCGCATCCGGC	NA	NA	NA	NA
WP_001005586.1|4509128_4511780_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_000556306.1|4511961_4513695_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000274643.1|4513909_4514761_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000323841.1|4514747_4515089_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000204105.1|4515090_4515969_-	[formate-C-acetyltransferase]-activating enzyme	NA	NA	NA	NA	NA
WP_000184811.1|4515934_4518232_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|4518282_4518603_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004446.1|4518617_4519697_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_039023143.1|4520005_4522507_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	7.9e-12
WP_000424840.1|4522518_4523181_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_000374004.1|4523191_4524295_+	bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_000647894.1|4524569_4525187_+	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_001271242.1|4525213_4526119_-	cystine transporter YijE	NA	NA	NA	NA	NA
WP_001295695.1|4526211_4528392_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_000007529.1|4528720_4529611_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_000110772.1|4529959_4532392_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_001295694.1|4532394_4533555_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000852812.1|4533831_4534149_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_000797353.1|4534332_4534941_+	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000710769.1|4535001_4535214_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001333520.1|4535416_4537615_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_000644904.1|4537770_4538796_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_000068828.1|4538887_4539847_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000208242.1|4539939_4540470_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293341.1|4540479_4541811_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|4541877_4542804_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|4542896_4543382_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|4543466_4543712_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|4544136_4544982_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|4545004_4546513_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|4546647_4547658_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796332.1|4547754_4548501_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323547.1|4548505_4548934_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655989.1|4548960_4549260_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155257.1|4549471_4549912_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802214.1|4550012_4550612_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216327.1|4550719_4551487_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001326656.1|4551541_4552297_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045683.1|4552403_4553393_-	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_000591795.1|4553712_4554675_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|4554855_4555758_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_000416606.1|4555965_4556607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947770.1|4556751_4558121_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_000468308.1|4558193_4558412_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882940.1|4558493_4559657_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.8e-206
WP_000978889.1|4559656_4560136_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000069960.1|4560150_4562598_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.2	0.0e+00
WP_000785970.1|4562590_4562710_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031307.1|4562742_4563018_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001251408.1|4563074_4563593_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286718.1|4563605_4564796_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	3.7e-225
WP_062914736.1|4564855_4565458_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	95.3	3.5e-99
WP_001333339.1|4565465_4567001_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
WP_000612626.1|4567049_4567397_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|4567393_4567798_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001016257.1|4568118_4568865_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_002431311.1|4568879_4570421_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
WP_000027659.1|4571895_4572171_-	DUF5405 family protein	NA	A0A0F7LCM4	Escherichia_phage	100.0	2.3e-45
WP_001113270.1|4572167_4572392_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_001277952.1|4572391_4572694_-	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	96.0	2.5e-45
WP_000557703.1|4572693_4572918_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217670.1|4572981_4573482_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001308179.1|4573651_4573924_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000777029.1|4574060_4574354_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_000985246.1|4574423_4575404_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_001223800.1|4575590_4576091_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_001033722.1|4576240_4576939_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|4576935_4578309_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
4587194:4587229	attR	GCCGGATGCGGCGCGAGCGCCTTATCCGGCCTACGG	NA	NA	NA	NA
>prophage 1
NZ_CP025626	Escherichia coli strain SCEC020007 plasmid pNDM5_020007, complete sequence	144225	1796	64060	144225	transposase,integrase,protease	Macacine_betaherpesvirus(25.0%)	55	NA	NA
WP_000616807.1|1796_2450_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|2542_2800_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|2732_3134_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001553819.1|3270_6168_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_000509965.1|6262_6868_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
WP_001214976.1|7629_8037_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|8174_9059_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|9090_10290_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|10395_11046_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_032140899.1|11077_11320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|12941_13646_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001389366.1|14724_15198_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000503573.1|15328_16117_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_000679427.1|16322_16670_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|16663_17503_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|17907_19449_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_004201169.1|19761_20793_+	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_004201168.1|20803_21442_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201167.1|21446_21812_-	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_023408309.1|21815_22628_-	subclass B1 metallo-beta-lactamase NDM-5	NA	NA	NA	NA	NA
WP_001067855.1|23186_23891_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_152924612.1|25542_26770_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	1.8e-174
WP_089634947.1|26755_27325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012372796.1|28986_30654_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.3	1.7e-164
WP_001027495.1|30966_31158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271685.1|31154_31577_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001666994.1|31623_31926_-	antirestriction protein	NA	NA	NA	NA	NA
WP_001006251.1|32462_33233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001546462.1|33277_33712_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104873.1|33725_33947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032181561.1|33947_34631_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.0	1.1e-29
WP_064766247.1|35015_35918_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000817031.1|36655_37627_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000772446.1|37626_38793_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000852146.1|39380_40136_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
WP_000016970.1|40857_41664_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_001159871.1|41664_41970_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813630.1|41971_42190_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001261286.1|42749_42980_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001034044.1|42976_43393_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001128474.1|43467_45033_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000361402.1|45017_46040_+	helicase UvrD	NA	NA	NA	NA	NA
WP_000449408.1|48300_48459_+	DsbA family protein	NA	NA	NA	NA	NA
WP_000949452.1|48448_48955_+	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_012372823.1|49137_49953_+	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_000118029.1|50299_52186_+	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_000178050.1|52226_52754_+	iron transporter	NA	NA	NA	NA	NA
WP_000119836.1|52857_54237_+	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000964653.1|54239_55523_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000729219.1|55512_56643_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000117262.1|56647_57343_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_001267176.1|57329_57815_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000874189.1|57839_58325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|61838_62543_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845039.1|63046_64060_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
>prophage 2
NZ_CP025626	Escherichia coli strain SCEC020007 plasmid pNDM5_020007, complete sequence	144225	69479	101811	144225	transposase	Escherichia_phage(40.0%)	25	NA	NA
WP_001389365.1|69479_70244_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|70736_71321_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|71320_72559_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|72555_73461_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|73582_74287_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_023408309.1|74845_75658_+	subclass B1 metallo-beta-lactamase NDM-5	NA	NA	NA	NA	NA
WP_004201167.1|75661_76027_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201168.1|76031_76670_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201169.1|76680_77712_-	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_000050481.1|78024_79566_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|79970_80810_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|80803_81151_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000503573.1|81356_82145_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|82275_82749_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_001067855.1|83827_84532_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001235713.1|87213_87771_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|87953_88814_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_012372818.1|88983_89739_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_014342204.1|89819_90368_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_001067855.1|90974_91679_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001083369.1|93014_94292_+	MFS transporter	NA	NA	NA	NA	NA
WP_000813680.1|94291_95722_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	24.5	1.2e-28
WP_001037799.1|95916_97311_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_000912556.1|98430_99054_+	potassium channel family protein	NA	NA	NA	NA	NA
WP_085947770.1|100441_101811_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
